Leptin Promotes Vasculogenic Mimicry in Breast Cancer Cells by Regulating Aquaporin-1
Abstract
:1. Introduction
2. Results
2.1. Leptin Promotes VM in Human Breast Cancer Cells
2.2. Leptin Promotes VM through the Ob-R/STAT3 Pathway in Human Breast Cancer Cells
2.3. Leptin Upregulates AQP1 Expression through the Ob-R/STAT3 Pathway in Human Breast Cancer Cells
2.4. AQP1 Is a Key Mediator of Leptin-Induced VM in Human Breast Cancer Cells
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Three-Dimensional (3D) Culture VM Tube Formation Assay
4.3. Western Blot Analysis
4.4. Isolation of RNA and Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR)
4.5. The Cancer Genome Altas (TCGA) Data Analysis
4.6. AQP1 Overexpression by CRISPR Activation Plasmid
4.7. AQP1 Silencing by Small Interfering RNA (siRNA)
4.8. Statistical Analysis
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Nishida, N.; Yano, H.; Nishida, T.; Kamura, T.; Kojiro, M. Angiogenesis in cancer. Vasc. Health Risk Manag. 2006, 2, 213–219. [Google Scholar] [CrossRef] [PubMed]
- Jiang, X.; Wang, J.; Deng, X.; Xiong, F.; Zhang, S.; Gong, Z.; Li, X.; Cao, K.; Deng, H.; He, Y. The role of microenvironment in tumor angiogenesis. J. Exp. Clin. Cancer Res. 2020, 39, 204. [Google Scholar] [CrossRef] [PubMed]
- Khan, K.A.; Bicknell, R. Anti-angiogenic alternatives to VEGF blockade. Clin. Exp. Metastasis 2016, 33, 197–210. [Google Scholar] [CrossRef] [PubMed]
- Lugano, R.; Ramachandran, M.; Dimberg, A. Tumor angiogenesis: Causes, consequences, challenges and opportunities. Cell. Mol. Life Sci. 2020, 77, 1745–1770. [Google Scholar] [CrossRef] [PubMed]
- Saman, H.; Raza, S.S.; Uddin, S.; Rasul, K. Inducing angiogenesis, a key step in cancer vascularization, and treatment approaches. Cancers 2020, 12, 1172. [Google Scholar] [CrossRef] [PubMed]
- Ribatti, D.; Pezzella, F. Overview on the different patterns of tumor vascularization. Cells 2021, 10, 639. [Google Scholar] [CrossRef] [PubMed]
- Donnem, T.; Reynolds, A.R.; Kuczynski, E.A.; Gatter, K.; Vermeulen, P.B.; Kerbel, R.S.; Harris, A.L.; Pezzella, F. Non-angiogenic tumours and their influence on cancer biology. Nat. Rev. Cancer 2018, 18, 323–336. [Google Scholar] [CrossRef] [PubMed]
- Kirschmann, D.A.; Seftor, E.A.; Hardy, K.M.; Seftor, R.E.; Hendrix, M.J. Molecular pathways: Vasculogenic mimicry in tumor cells: Diagnostic and therapeutic implications. Clin. Cancer Res. 2012, 18, 2726–2732. [Google Scholar] [CrossRef]
- Chen, Y.-S.; Chen, Z.-P. Vasculogenic mimicry: A novel target for glioma therapy. Chin. J. Cancer 2014, 33, 74. [Google Scholar] [CrossRef]
- Cai, H.; Liu, W.; Liu, X.; Li, Z.; Feng, T.; Xue, Y.; Liu, Y. Advances and prospects of vasculogenic mimicry in glioma: A potential new therapeutic target? Onco Targets Ther. 2020, 13, 4473–4483. [Google Scholar] [CrossRef]
- Xia, Y.; Cai, X.Y.; Fan, J.Q.; Zhang, L.L.; Ren, J.H.; Li, Z.Y.; Zhang, R.G.; Zhu, F.; Wu, G. The role of sema4D in vasculogenic mimicry formation in non-small cell lung cancer and the underlying mechanisms. Int. J. Cancer 2019, 144, 2227–2238. [Google Scholar] [CrossRef] [PubMed]
- Morales-Guadarrama, G.; García-Becerra, R.; Méndez-Pérez, E.A.; García-Quiroz, J.; Avila, E.; Díaz, L. Vasculogenic mimicry in breast cancer: Clinical relevance and drivers. Cells 2021, 10, 1758. [Google Scholar] [CrossRef] [PubMed]
- Luo, Q.; Wang, J.; Zhao, W.; Peng, Z.; Liu, X.; Li, B.; Zhang, H.; Shan, B.; Zhang, C.; Duan, C. Vasculogenic mimicry in carcinogenesis and clinical applications. J. Hematol. Oncol. 2020, 13, 19. [Google Scholar] [CrossRef] [PubMed]
- Valdivia, A.; Mingo, G.; Aldana, V.; Pinto, M.P.; Ramirez, M.; Retamal, C.; Gonzalez, A.; Nualart, F.; Corvalan, A.H.; Owen, G.I. Fact or Fiction, It Is Time for a Verdict on Vasculogenic Mimicry? Front. Oncol. 2019, 9, 680. [Google Scholar] [CrossRef] [PubMed]
- Park, H.-K.; Ahima, R.S. Physiology of leptin: Energy homeostasis, neuroendocrine function and metabolism. Metabolism 2015, 64, 24–34. [Google Scholar] [CrossRef] [PubMed]
- Picon-Ruiz, M.; Morata-Tarifa, C.; Valle-Goffin, J.J.; Friedman, E.R.; Slingerland, J.M. Obesity and adverse breast cancer risk and outcome: Mechanistic insights and strategies for intervention. CA Cancer J. Clin. 2017, 67, 378–397. [Google Scholar] [CrossRef] [PubMed]
- Barone, I.; Giordano, C.; Bonofiglio, D.; Andò, S.; Catalano, S. Leptin, obesity and breast cancer: Progress to understanding the molecular connections. Curr. Opin. Pharmacol. 2016, 31, 83–89. [Google Scholar] [CrossRef] [PubMed]
- Ishikawa, M.; Kitayama, J.; Nagawa, H. Enhanced expression of leptin and leptin receptor (OB-R) in human breast cancer. Clin. Cancer Res. 2004, 10, 4325–4331. [Google Scholar] [CrossRef] [PubMed]
- Ando, S.; Barone, I.; Giordano, C.; Bonofiglio, D.; Catalano, S. The Multifaceted Mechanism of Leptin Signaling within Tumor Microenvironment in Driving Breast Cancer Growth and Progression. Front. Oncol. 2014, 4, 340. [Google Scholar]
- Kozono, D.; Yasui, M.; King, L.S.; Agre, P. Aquaporin water channels: Atomic structure molecular dynamics meet clinical medicine. J. Clin. Investig. 2002, 109, 1395–1399. [Google Scholar] [CrossRef]
- Verkman, A. Aquaporins. Curr. Biol. 2013, 23, R52–R55. [Google Scholar] [CrossRef]
- Wei, M.; Yu, H.; Cai, C.; Gao, R.; Liu, X.; Zhu, H. MiR-3194-3p inhibits breast cancer progression by targeting Aquaporin1. Front. Oncol. 2020, 10, 1513. [Google Scholar] [CrossRef]
- Chong, W.; Zhang, H.; Guo, Z.; Yang, L.; Shao, Y.; Liu, X.; Zhao, Y.; Wang, Z.; Zhang, M.; Guo, C. Aquaporin 1 promotes sensitivity of anthracycline chemotherapy in breast cancer by inhibiting β-catenin degradation to enhance TopoIIα activity. Cell Death Differ. 2021, 28, 382–400. [Google Scholar] [CrossRef]
- Charlestin, V.; Fulkerson, D.; Arias Matus, C.E.; Walker, Z.T.; Carthy, K.; Littlepage, L.E. Aquaporins: New players in breast cancer progression and treatment response. Front. Oncol. 2022, 12, 988119. [Google Scholar] [CrossRef]
- Papadopoulos, M.C.; Saadoun, S. Key roles of aquaporins in tumor biology. Biochim. Biophys. Acta. 2015, 1848, 2576–2583. [Google Scholar] [CrossRef]
- De Ieso, M.L.; Yool, A.J. Mechanisms of aquaporin-facilitated cancer invasion and metastasis. Front. Chem. 2018, 6, 135. [Google Scholar] [CrossRef]
- Yang, W.Y.; Tan, Z.F.; Dong, D.W.; Ding, Y.; Meng, H.; Zhao, Y.; Xin, X.F.; Bi, W. Association of aquaporin-1 with tumor migration, invasion and vasculogenic mimicry in glioblastoma multiforme. Mol. Med. Rep. 2018, 17, 3206–3211. [Google Scholar] [CrossRef]
- Pulford, E.; McEvoy, J.; Hocking, A.; Prabhakaran, S.; Griggs, K.; Klebe, S. The effect of aquaporin 1-inhibition on vasculogenic mimicry in malignant mesothelioma. Int. J. Mol. Sci. 2017, 18, 2293. [Google Scholar] [CrossRef]
- Herrera-Vargas, A.K.; Garcia-Rodriguez, E.; Olea-Flores, M.; Mendoza-Catalan, M.A.; Flores-Alfaro, E.; Navarro-Tito, N. Pro-angiogenic activity and vasculogenic mimicry in the tumor microenvironment by leptin in cancer. Cytokine Growth Factor. Rev. 2021, 62, 23–41. [Google Scholar] [CrossRef]
- Han, G.; Li, Y.; Cao, Y.; Yue, Z.; Zhang, Y.; Wang, L.; Liu, J. Overexpression of leptin receptor in human glioblastoma: Correlation with vasculogenic mimicry and poor prognosis. Oncotarget 2017, 8, 58163–58171. [Google Scholar] [CrossRef]
- Costa, I.P.; Hautem, N.; Schiano, G.; Uchida, S.; Nishino, T.; Devuyst, O. Fasting influences aquaporin expression, water transport and adipocyte metabolism in the peritoneal membrane. Nephrol. Dial. Transplant. 2023, 38, 1408–1420. [Google Scholar] [CrossRef] [PubMed]
- Greco, M.; De Santo, M.; Comandè, A.; Belsito, E.L.; Andò, S.; Liguori, A.; Leggio, A. Leptin-activity modulators and their potential pharmaceutical applications. Biomolecules 2021, 11, 1045. [Google Scholar] [CrossRef]
- Yang, R.; Barouch, L.A. Leptin signaling and obesity: Cardiovascular consequences. Cir. Res. 2007, 101, 545–559. [Google Scholar] [CrossRef] [PubMed]
- Seo, I.A.; Lee, H.K.; Shin, Y.K.; Lee, S.H.; Seo, S.-Y.; Park, J.W.; Park, H.T. Janus kinase 2 inhibitor AG490 inhibits the STAT3 signaling pathway by suppressing protein translation of gp130. Korean J. Physiol. Pharmacol. 2009, 13, 131. [Google Scholar] [CrossRef] [PubMed]
- Chavoshi, H.; Poormolaie, N.; Vahedian, V.; Kazemzadeh, H.; Mir, A.; Nejabati, H.R.; Behroozi, J.; Isazadeh, A.; Hajezimian, S.; Nouri, M.; et al. Vascular mimicry: A potential therapeutic target in breast cancer. Pathol. Res. Pract. 2022, 234, 153922. [Google Scholar] [CrossRef]
- Andonegui-Elguera, M.A.; Alfaro-Mora, Y.; Cáceres-Gutiérrez, R.; Caro-Sánchez, C.H.S.; Herrera, L.A.; Díaz-Chávez, J. An overview of vasculogenic mimicry in breast cancer. Front. Oncol. 2020, 10, 220. [Google Scholar] [CrossRef]
- Shen, Y.; Quan, J.; Wang, M.; Li, S.; Yang, J.; Lv, M.; Chen, Z.; Zhang, L.; Zhao, X.; Yang, J. Tumor vasculogenic mimicry formation as an unfavorable prognostic indicator in patients with breast cancer. Oncotarget 2017, 8, 56408–56416. [Google Scholar] [CrossRef]
- Ma, J.-h.; Qin, L.; Li, X. Role of STAT3 signaling pathway in breast cancer. Cell Commun. Signal. 2020, 18, 33. [Google Scholar] [CrossRef]
- Liu, H.; Du, T.; Li, C.; Yang, G. STAT3 phosphorylation in central leptin resistance. Nutr. Metab. 2021, 18, 39. [Google Scholar] [CrossRef]
- Ohba, S.; Lanigan, T.M.; Roessler, B.J. Leptin receptor JAK2/STAT3 signaling modulates expression of Frizzled receptors in articular chondrocytes. Osteoarthr. Cartil. 2010, 18, 1620–1629. [Google Scholar] [CrossRef]
- Sanchez-Jimenez, F.; Perez-Perez, A.; de la Cruz-Merino, L.; Sanchez-Margalet, V. Obesity and Breast Cancer: Role of Leptin. Front. Oncol. 2019, 9, 596. [Google Scholar] [CrossRef]
- Han, D.-S.; Lee, H.-J.; Lee, E.-O. Resveratrol suppresses serum-induced vasculogenic mimicry through impairing the EphA2/twist-VE-cadherin/AKT pathway in human prostate cancer PC-3 cells. Sci. Rep. 2022, 12, 20125. [Google Scholar] [CrossRef]
- Yeo, C.; Han, D.-S.; Lee, H.-J.; Lee, E.-O. Epigallocatechin-3-gallate suppresses vasculogenic mimicry through inhibiting the twist/VE-cadherin/AKT pathway in human prostate cancer PC-3 cells. Int. J. Mol. Sci. 2020, 21, 439. [Google Scholar] [CrossRef] [PubMed]
- Han, D.-S.; Lee, E.-O. Sp1 plays a key role in vasculogenic mimicry of human prostate cancer cells. Int. J. Mol. Sci. 2022, 23, 1321. [Google Scholar] [CrossRef]
- Herrera, M.; Hong, N.J.; Garvin, J.L. Aquaporin-1 transports NO across cell membranes. Hypertension 2006, 48, 157–164. [Google Scholar] [CrossRef]
- Wang, Z.; Wang, Y.; He, Y.; Zhang, N.; Chang, W.; Niu, Y. Aquaporin-1 facilitates proliferation and invasion of gastric cancer cells via GRB7-mediated ERK and Ras activation. Anim. Cells Syst. 2020, 24, 253–259. [Google Scholar] [CrossRef]
- Guo, Z.; Zhang, H.; Liu, X.; Zhao, Y.; Chen, Y.; Jin, J.; Guo, C.; Zhang, M.; Gu, F.; Ma, Y. Water channel protein AQP1 in cytoplasm is a critical factor in breast cancer local invasion. J. Exp. Clin. Cancer Res. 2023, 42, 49. [Google Scholar] [CrossRef] [PubMed]
- Traberg-Nyborg, L.; Login, F.H.; Edamana, S.; Tramm, T.; Borgquist, S.; Nejsum, L.N. Aquaporin-1 in breast cancer. APMIS 2022, 130, 3–10. [Google Scholar] [CrossRef] [PubMed]
- cBioPortal for Cancer. Genomics. Available online: https://www.cbioportal.org (accessed on 6 March 2023).
Antibody | Company | Dilution | Product No. |
---|---|---|---|
AQP1 | Santa Cruz | 1:500 | SC-25287 |
β-actin | Sigma-Aldrich | 1:20,000 | A5316 |
p-STAT3 | CST | 1:1000 | 9145 |
STAT3 | CST | 1:5000 | 12640 |
MMP-2 | Abcam | 1:1000 | ab86607 |
LAMC2 | Abcam | 1:1000 | ab96327 |
VE-cadherin | Abgent | 1:1000 | AP2724a |
Twist | Abcam | 1:1000 | ab50887 |
goat anti-rabbit IgG-HRP | CST | 1:5000 | 7074P2 |
goat anti-mouse IgG-HRP | Bio-Rad | 1:5000 | STAR120P |
mRNA | Primer Sequences | Size | Annealing Temperature |
---|---|---|---|
β-actin | S: GAGAAGATGACCCAGATCATGT AS: ACTCCATGCCCAGGAAGGAAGG | 463 | 60 |
AQP1 | S: CAGCCCAAGGACAGTTCAGAG AS: CCATCATGGCTAAGTGCACAG | 118 | 60 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Han, D.-S.; Lee, E.-O. Leptin Promotes Vasculogenic Mimicry in Breast Cancer Cells by Regulating Aquaporin-1. Int. J. Mol. Sci. 2024, 25, 5215. https://doi.org/10.3390/ijms25105215
Han D-S, Lee E-O. Leptin Promotes Vasculogenic Mimicry in Breast Cancer Cells by Regulating Aquaporin-1. International Journal of Molecular Sciences. 2024; 25(10):5215. https://doi.org/10.3390/ijms25105215
Chicago/Turabian StyleHan, Deok-Soo, and Eun-Ok Lee. 2024. "Leptin Promotes Vasculogenic Mimicry in Breast Cancer Cells by Regulating Aquaporin-1" International Journal of Molecular Sciences 25, no. 10: 5215. https://doi.org/10.3390/ijms25105215