Probiotic Bacillus licheniformis ZW3 Alleviates DSS-Induced Colitis and Enhances Gut Homeostasis
Abstract
1. Introduction
2. Results
2.1. B. licheniformis ZW3 Pretreatment Alleviating DSS-Induced Colitis
2.2. B. licheniformis ZW3 Reduced the Immune Response in DSS-Induced Colitis
2.3. B. licheniformis ZW3 Restored the Intestinal Barrier in DSS-Induced Colitis
2.4. B. licheniformis ZW3 Restored Intestinal Dysbiosis in Colitis Mice
2.5. B. licheniformis ZW3 Modulates the Gut Metabolomics Profile in DSS-Induced Colitis
3. Discussion
4. Materials and Methods
4.1. Probiotics and Animals
4.2. Experimental Design
4.3. DAI
4.4. Hematoxylin–Eosin (HE) and Periodic Acid-Schiff (PAS) Staining
4.5. Immunohistochemistry (IHC) and Immunofluorescence (IF)
4.6. RT-PCR
4.7. Enzyme-Linked Immunosorbent Assays and Myeloperoxidase Activity (MPO)
4.8. Western Blot Analysis
4.9. 16S rRNA Gene Sequencing
4.10. Nontargeted Metabolomics Analysis of Colon Contents
4.11. Measurement of Uric Acid
4.12. Statistical Analyses
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Gecse, K.; Vermeire, S. Differential diagnosis of inflammatory bowel disease: Imitations and complications. Lancet Gastroenterol. 2018, 3, 644–653. [Google Scholar] [CrossRef] [PubMed]
- Ng, S.C.; Shi, H.Y.; Hamidi, N.; Underwood, F.E.; Tang, W.; Benchimol, E.I.; Panaccione, R.; Ghosh, S.; Wu, J.C.Y.; Chan, F.K.L.; et al. Worldwide incidence and prevalence of inflammatory bowel disease in the 21st century: A systematic review of population-based studies. Lancet 2017, 390, 2769–2778. [Google Scholar] [CrossRef] [PubMed]
- Holleran, G.; Lopetuso, L.; Petito, V.; Graziani, C.; Ianiro, G.; McNamara, D.; Gasbarrini, A.; Scaldaferri, F. The innate and adaptive immune system as targets for biologic therapies in inflammatory bowel disease. Int. J. Mol. Sci. 2017, 18, 2020. [Google Scholar] [CrossRef] [PubMed]
- Neurath, M.F. Current and emerging therapeutic targets for IBD. Nat. Rev. Gastroenterol. Hepatol. 2017, 14, 269–278. [Google Scholar] [CrossRef] [PubMed]
- Food and Agriculture Organization; World Health Organization. Working Group Report on Drafting Guidelines, Evaluation of Probiotics in Food, London, Ontario, Canada; Food and Agriculture Organization: Rome, Italy; World Health Organization: Geneva, Switzerland, 2002; p. 60. [Google Scholar]
- Patel, R.; DuPont, H.L. New approaches for bacteriotherapy: Prebiotics, new-generation probiotics, and synbiotics. Clin. Infect. Dis. 2015, 60, S108–S121. [Google Scholar] [CrossRef]
- Bibiloni, R.; Fedorak, R.N.; Tannock, G.W.; Madsen, K.L.; Gionchetti, P.; Campieri, M.; De Simone, C.; Sartor, R.B. VSL#3 probiotic-mixture induces remission in patients with active ulcerative colitis. Am. J. Gastroenterol. 2005, 100, 1539–1546. [Google Scholar]
- Chi, C.; Li, C.; Wu, D.; Buys, N.; Wang, W.; Fan, H.; Sun, J. Effects of probiotics on patients with hypertension: A systematic review and meta-Analysis. Curr. Hypertens. Rep. 2020, 22, 34. [Google Scholar] [CrossRef]
- Thangaleela, S.; Sivamaruthi, B.S.; Kesika, P.; Bharathi, M.; Chaiyasut, C. Role of the gut-brain axis, gut microbial composition, diet, and probiotic intervention in Parkinson’s disease. Microorganisms 2022, 10, 1544. [Google Scholar] [CrossRef]
- Xu, J.; Xu, J.; Shi, T.; Zhang, Y.; Chen, F.; Yang, C.; Guo, X.; Liu, G.; Shao, D.; Leong, K.W.; et al. Probiotic-inspired nanomedicine restores intestinal homeostasis in colitis by regulating redox balance, immune responses, and the gut microbiome. Adv. Mater. 2023, 35, e2207890. [Google Scholar] [CrossRef]
- Shang, J.; Yang, S.; Tang, Z.; Chen, Y.; Duan, B.; Meng, X. Bifidobacterium bifidum H3-R2 and its molecular communication within the context of ulcerative colitis. J. Agric. Food Chem. 2022, 70, 11678–11688. [Google Scholar] [CrossRef]
- Todorov, S.D.; Ivanova, I.V.; Popov, I.; Weeks, R.; Chikindas, M.L. Bacillus spore-forming probiotics: Benefits with concerns? Crit. Rev. Microbiol. 2022, 48, 513–530. [Google Scholar] [CrossRef] [PubMed]
- Elsharkawy, M.M.; Almasoud, M.; Alsulaiman, Y.M.; Baeshen, R.S.; Elshazly, H.; Kadi, R.H.; Hassan, M.M.; Shawer, R. Efficiency of Bacillus thuringiensis and Bacillus cereus against Rhynchophorus ferrugineus. Insects 2022, 13, 905. [Google Scholar] [CrossRef] [PubMed]
- Bravo, A.; Likitvivatanavong, S.; Gill, S.S.; Soberón, M. Bacillus thuringiensis: A story of a successful bioinsecticide. Insect Biochem. Mol. Biol. 2011, 41, 423–431. [Google Scholar] [CrossRef] [PubMed]
- Elshaghabee, F.M.; Rokana, N.; Gulhane, R.D.; Sharma, C.; Panwar, H. Bacillus as potential probiotics: Status, concerns, and future perspectives. Front. Microbiol. 2017, 8, 1490. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Li, X.; Jia, D.; Liu, J.; Wang, J.; Liu, A.; Liu, Z.; Guan, G.; Liu, G.; Luo, J.; et al. Complete genome sequence and antimicrobial activity of Bacillus velezensis JT3-1, a microbial germicide isolated from yak feces. 3 Biotech 2020, 10, 231. [Google Scholar] [CrossRef]
- Ji, L.; Zhang, L.; Liu, H.; Shen, J.; Zhang, Y.; Lu, L.; Zhang, X.; Ma, X. Bacillus subtilis M6 improves intestinal barrier, antioxidant capacity and gut microbial composition in AA broiler. Front. Nutr. 2022, 9, 965310. [Google Scholar] [CrossRef]
- Zheng, X.; Liu, B.; Wang, N.; Yang, J.; Zhou, Q.; Sun, C.; Zhao, Y. Low fish meal diet supplemented with probiotics ameliorates intestinal barrier and immunological function of Macrobrachium rosenbergii via the targeted modulation of gut microbes and derived secondary metabolites. Front. Immunol. 2022, 13, 1074399. [Google Scholar] [CrossRef]
- Malik, M.; Suboc, T.M.; Tyagi, S.; Salzman, N.; Wang, J.; Ying, R.; Tanner, M.J.; Kakarla, M.; Baker, J.E.; Widlansky, M.E. Lactobacillus plantarum 299v supplementation improves vascular endothelial function and reduces inflammatory biomarkers in men with stable coronary artery disease. Circ. Res. 2018, 123, 1091–1102. [Google Scholar] [CrossRef]
- Zhu, H.; Cao, C.; Wu, Z.; Zhang, H.; Sun, Z.; Wang, M.; Xu, H.; Zhao, Z.; Wang, Y.; Pei, G.; et al. The probiotic L. casei Zhang slows the progression of acute and chronic kidney disease. Cell Metab. 2021, 33, 1926–1942.e8. [Google Scholar] [CrossRef]
- Mehandru, S.; Colombel, J.F. The intestinal barrier, an arbitrator turned provocateur in IBD. Nat. Rev. Gastroenterol. Hepatol. 2021, 18, 83–84. [Google Scholar] [CrossRef]
- Barros, L.L.; Farias, A.Q.; Rezaie, A. Gastrointestinal motility and absorptive disorders in patients with inflammatory bowel diseases: Prevalence, diagnosis and treatment. World J. Gastroenterol. 2019, 25, 4414–4426. [Google Scholar] [CrossRef] [PubMed]
- Kuo, W.T.; Zuo, L.; Odenwald, M.A.; Madha, S.; Singh, G.; Gurniak, C.B.; Abraham, C.; Turner, J.R. The tight junction protein ZO-1 is dispensable for barrier function but critical for effective mucosal repair. Gastroenterology 2021, 161, 1924–1939. [Google Scholar] [CrossRef] [PubMed]
- Ma, L.; Shen, Q.; Lyu, W.; Lv, L.; Wang, W.; Yu, M.; Yang, H.; Tao, S.; Xiao, Y. Clostridium butyricum and its derived extracellular vesicles modulate gut homeostasis and ameliorate acute experimental colitis. Microbiol. Spectr. 2022, 10, e0136822. [Google Scholar] [CrossRef] [PubMed]
- Neurath, M.F. Cytokines in inflammatory bowel disease. Nat. Rev. Immunol. 2014, 14, 329–342. [Google Scholar] [CrossRef] [PubMed]
- Ishiguro, Y. Mucosal proinflammatory cytokine production correlates with endoscopic activity of ulcerative colitis. J. Gastroenterol. 1999, 34, 66–74. [Google Scholar] [CrossRef] [PubMed]
- Qiao, H.; Fang, D.; Chen, J.; Sun, Y.; Kang, C.; Di, L.; Li, J.; Chen, Z.; Chen, J.; Gao, Y. Orally delivered polycurcumin responsive to bacterial reduction for targeted therapy of inflammatory bowel disease. Drug Deliv. 2017, 24, 233–242. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Ding, Z.; Wang, Y.; Zhong, R.; Feng, Y.; Xia, T.; Xie, Y.; Yang, B.; Sun, X.; Shu, Z. Systems pharmacology reveals the mechanism of activity of Physalis alkekengi L. var. franchetii against lipopolysaccharide-induced acute lung injury. J. Cell. Mol. Med. 2020, 24, 5039–5056. [Google Scholar]
- Pugliese, D.; Felice, C.; Papa, A.; Gasbarrini, A.; Rapaccini, G.L.; Guidi, L.; Armuzzi, A. Anti TNF-α therapy for ulcerative colitis: Current status and prospects for the future. Expert. Rev. Clin. Immunol. 2017, 13, 223–233. [Google Scholar] [CrossRef]
- Chen, P.; Stärkel, P.; Turner, J.R.; Ho, S.B.; Schnabl, B. Dysbiosis-induced intestinal inflammation activates tumor necrosis factor receptor I and mediates alcoholic liver disease in mice. Hepatology 2015, 61, 883–894. [Google Scholar] [CrossRef]
- Al-Sadi, R.M.; Ma, T.Y. IL-1beta causes an increase in intestinal epithelial tight junction permeability. J. Immunol. 2007, 178, 4641.e9. [Google Scholar] [CrossRef]
- Dong, F.; Xiao, F.; Li, X.; Li, Y.; Wang, X.; Yu, G.; Zhang, T.; Wang, Y. Pediococcus pentosaceus CECT 8330 protects DSS-induced colitis and regulates the intestinal microbiota and immune responses in mice. J. Transl. Med. 2022, 20, 33. [Google Scholar] [CrossRef] [PubMed]
- Ott, S.J.; Musfeldt, M.; Wenderoth, D.F.; Hampe, J.; Brant, O.; Fölsch, U.R.; Timmis, K.N.; Schreiber, S. Reduction in diversity of the colonic mucosa associated bacterial microflora in patients with active inflammatory bowel disease. Gut 2004, 53, 685–693. [Google Scholar] [CrossRef] [PubMed]
- Sartor, R.B.; Wu, G.D. Roles for intestinal bacteria, viruses, and fungi in pathogenesis of inflammatory bowel diseases and therapeutic approaches. Gastroenterology 2017, 152, 327–339.e4. [Google Scholar] [CrossRef] [PubMed]
- Manichanh, C.; Rigottier-Gois, L.; Bonnaud, E.; Gloux, K.; Pelletier, E.; Frangeul, L.; Nalin, R.; Jarrin, C.; Chardon, P.; Marteau, P.; et al. Reduced diversity of faecal microbiota in Crohn’s disease revealed by a metagenomic approach. Gut 2006, 55, 205–211. [Google Scholar] [CrossRef] [PubMed]
- Shreiner, A.B.; Kao, J.K.; Young, V.B. The gut microbiome in health and in disease. Curr. Opin. Gastroen. 2015, 31, 69–75. [Google Scholar] [CrossRef] [PubMed]
- Vich Vila, A.; Imhann, F.; Collij, V.; Jankipersadsing, S.A.; Gurry, T.; Mujagic, Z.; Kurilshikov, A.; Bonder, M.J.; Jiang, X.; Tigchelaar, E.F.; et al. Gut microbiota composition and functional changes in inflammatory bowel disease and irritable bowel syndrome. Sci. Transl. Med. 2018, 10, aap8914. [Google Scholar] [CrossRef] [PubMed]
- Brown, E.M.; Ke, X.; Hitchcock, D.; Jeanfavre, S.; Avila-Pacheco, J.; Nakata, T.; Arthur, T.D.; Fornelos, N.; Heim, C.; Franzosa, E.A.; et al. Bacteroides-derived sphingolipids are critical for maintaining intestinal homeostasis and symbiosis. Cell Host Microbe 2019, 25, 668–680.e7. [Google Scholar] [CrossRef]
- Chu, H.; Khosravi, A.; Kusumawardhani, I.P.; Kwon, A.H.; Vasconcelos, A.C.; Cunha, L.D.; Mayer, A.E.; Shen, Y.; Wu, W.L.; Kambal, A.; et al. Gene-microbiota interactions contribute to the pathogenesis of inflammatory bowel disease. Science 2016, 352, 1116–1120. [Google Scholar] [CrossRef]
- Zhang, F.; Zhou, Y.; Chen, H.; Jiang, H.; Zhou, F.; Lv, B.; Xu, M. Curcumin alleviates DSS-induced anxiety-like behaviors via the microbial-brain-gut axis. Oxid. Med. Cell. Longev. 2022, 2022, 6244757. [Google Scholar] [CrossRef]
- Li, F.; Feng, Y.; Liu, H.; Kong, D.; Hsueh, C.Y.; Shi, X.; Wu, Q.; Li, W.; Wang, J.; Zhang, Y.; et al. Gut microbiome and metabolome changes in mice with acute vestibular deficit. Front. Cell. Infect. Microbiol. 2022, 12, 821780. [Google Scholar] [CrossRef]
- Lavelle, A.; Sokol, H. Gut microbiota-derived metabolites as key actors in inflammatory bowel disease. Nat. Rev. Gastroenterol. Hepatol. 2020, 17, 223–237. [Google Scholar] [CrossRef] [PubMed]
- Scott, S.A.; Fu, J.; Chang, P.V. Microbial tryptophan metabolites regulate gut barrier function via the aryl hydrocarbon receptor. Proc. Natl. Acad. Sci. USA 2020, 117, 19376–19387. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.J.; Chen, L.H.; Xu, J.; Xu, Q.X.; Xu, W.; Yang, X.W. Corylin ameliorates chronic ulcerative colitis via regulating the gut-brain axis and promoting 5-hydroxytryptophan production in the colon. Phytomedicine 2023, 110, 154651. [Google Scholar] [CrossRef] [PubMed]
- Cai, J.; Rimal, B.; Jiang, C.; Chiang, J.Y.L.; Patterson, A.D. Bile acid metabolism and signaling, the microbiota, and metabolic disease. Pharmacol. Ther. 2022, 237, 108238. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Zhang, Y.; Li, W.; Zhang, B.; Yin, J.; Liuqi, S.; Wang, J.; Peng, B.; Wang, S. Fucoidan ameliorated dextran sulfate sodium-induced ulcerative colitis by modulating gut microbiota and bile acid metabolism. J. Agric. Food Chem. 2022, 70, 14864–14876. [Google Scholar] [CrossRef] [PubMed]
- Du, K.; Zou, J.; Wang, B.; Liu, C.; Khan, M.; Xie, T.; Huang, X.; Shen, P.; Tian, Y.; Yuan, Y. A Metabolism-related gene prognostic index bridging metabolic signatures and antitumor immune cycling in head and neck squamous cell carcinoma. Front. Immunol. 2022, 13, 857934. [Google Scholar] [CrossRef] [PubMed]
- Chong, Y.C.; Toh, T.B.; Chan, Z.; Lin, Q.X.X.; Thng, D.K.H.; Hooi, L.; Ding, Z.; Shuen, T.; Toh, H.C.; Dan, Y.Y.; et al. Targeted inhibition of purine metabolism is effective in suppressing hepatocellular carcinoma progression. Hepatol. Commun. 2020, 4, 1362–1381. [Google Scholar] [CrossRef]
- Ali-Sisto, T.; Tolmunen, T.; Toffol, E.; Viinamäki, H.; Mäntyselkä, P.; Valkonen-Korhonen, M.; Honkalampi, K.; Ruusunen, A.; Velagapudi, V.; Lehto, S.M. Purine metabolism is dysregulated in patients with major depressive disorder. Psychoneuroendocrinology 2016, 70, 25–32. [Google Scholar] [CrossRef]
- Ohradanova-Repic, A.; Machacek, C.; Charvet, C.; Lager, F.; Le Roux, D.; Platzer, R.; Leksa, V.; Mitulovic, G.; Burkard, T.R.; Zlabinger, G.J.; et al. Extracellular purine metabolism is the switchboard of immunosuppressive macrophages and a novel target to treat diseases with macrophage imbalances. Front. Immunol. 2018, 9, 852. [Google Scholar] [CrossRef]
- Zhu, F.; Feng, D.; Zhang, T.; Gu, L.; Zhu, W.; Guo, Z.; Li, Y.; Lu, N.; Gong, J.; Li, N. Altered uric acid metabolism in isolated colonic Crohn’s disease but not ulcerative colitis. J. Gastroenterol. Hepatol. 2019, 34, 154–161. [Google Scholar] [CrossRef]
- Wu, J.; Wei, Z.; Cheng, P.; Qian, C.; Xu, F.; Yang, Y.; Wang, A.; Chen, W.; Sun, Z.; Lu, Y. Rhein modulates host purine metabolism in intestine through gut microbiota and ameliorates experimental colitis. Theranostics 2020, 10, 10665–10679. [Google Scholar] [CrossRef] [PubMed]
- Lv, Q.; Xu, D.; Ma, J.; Wang, Y.; Yang, X.; Zhao, P.; Ma, L.; Li, Z.; Yang, W.; Liu, X.; et al. Uric acid drives intestinal barrier dysfunction through TSPO-mediated NLRP3 inflammasome activation. Inflamm. Res. 2021, 70, 127–137. [Google Scholar] [CrossRef] [PubMed]
- Xu, L.; Liu, B.; Huang, L.; Li, Z.; Cheng, Y.; Tian, Y.; Pan, G.; Li, H.; Xu, Y.; Wu, W.; et al. Probiotic consortia and their metabolites ameliorate the symptoms of inflammatory bowel diseases in a colitis mouse model. Microbiol. Spectr. 2022, 10, e0065722. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.Y.; Suh, J.S.; Kim, J.M.; Kim, J.H.; Park, H.J.; Park, Y.J.; Chung, C.P. Identification of a cell-penetrating peptide domain from human beta-defensin 3 and characterization of its anti-inflammatory activity. Int. J. Nanomed. 2015, 10, 5423. [Google Scholar]
- Viennois, E.; Tahsin, A.; Merlin, D. Purification of total RNA from DSS-treated murine tissue via lithium chloride precipitation. Bio-Protocol 2018, 8, e2829. [Google Scholar] [CrossRef]
- Logue, J.B.; Stedmon, C.A.; Kellerman, A.M.; Nielsen, N.J.; Andersson, A.F.; Laudon, H.; Lindström, E.S.; Kritzberg, E.S. Experimental insights into the importance of aquatic bacterial community composition to the degradation of dissolved organic matter. ISME J. 2016, 10, 533–545. [Google Scholar] [CrossRef]
Gene | Forward Primer | Reverse Primer |
---|---|---|
IL-1β | TTGACGGACCCCAAAAGAT | AGCTGGATGCTCTCATCAGG |
TNF-α | GCGACGTGGAACTGGCAGAAG | GCCACAAGCAGGAATGAGAAGAGG |
IL-6 | CCGGAGAGGAGACTTCACAG | CAGAATTGCCATTGCACAAC |
GAPDH | TGTGTCCGTCGTGGATCTGA | TTGCTGTTGAAGTCGCAGGAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jia, D.; Li, Y.; Wang, Y.; Guo, Y.; Liu, J.; Zhao, S.; Wang, J.; Guan, G.; Luo, J.; Yin, H.; et al. Probiotic Bacillus licheniformis ZW3 Alleviates DSS-Induced Colitis and Enhances Gut Homeostasis. Int. J. Mol. Sci. 2024, 25, 561. https://doi.org/10.3390/ijms25010561
Jia D, Li Y, Wang Y, Guo Y, Liu J, Zhao S, Wang J, Guan G, Luo J, Yin H, et al. Probiotic Bacillus licheniformis ZW3 Alleviates DSS-Induced Colitis and Enhances Gut Homeostasis. International Journal of Molecular Sciences. 2024; 25(1):561. https://doi.org/10.3390/ijms25010561
Chicago/Turabian StyleJia, Dan, Yingying Li, Yingjie Wang, Yanan Guo, Junlong Liu, Shuaiyang Zhao, Jinming Wang, Guiquan Guan, Jianxun Luo, Hong Yin, and et al. 2024. "Probiotic Bacillus licheniformis ZW3 Alleviates DSS-Induced Colitis and Enhances Gut Homeostasis" International Journal of Molecular Sciences 25, no. 1: 561. https://doi.org/10.3390/ijms25010561
APA StyleJia, D., Li, Y., Wang, Y., Guo, Y., Liu, J., Zhao, S., Wang, J., Guan, G., Luo, J., Yin, H., Tang, L., & Li, Y. (2024). Probiotic Bacillus licheniformis ZW3 Alleviates DSS-Induced Colitis and Enhances Gut Homeostasis. International Journal of Molecular Sciences, 25(1), 561. https://doi.org/10.3390/ijms25010561