Optimizing the Comet Assay-Based In Vitro DNA Repair Assay for Placental Tissue: A Pilot Study with Pre-Eclamptic Patients
Abstract
1. Introduction
2. Results
2.1. Optimization of the BER Assay for Placental Tissues
2.2. Applying the Assay to a Case Study on Pre-Eclampsia
2.2.1. BER Incision Activity
2.2.2. BER-Related Gene Expression
2.2.3. Markers of Oxidative Stress
3. Discussion
3.1. Optimized Comet Assay-Based In Vitro DNA Repair Assay for Placental Tissues
3.2. The Clinical Value of the BER Assay for Placental Tissues
3.3. Concluding Remarks
4. Materials and Methods
4.1. Placental Specimen
4.2. DNA Repair Activity/BER Incision Activity
4.2.1. Principle of the Assay
4.2.2. Substrate Cells Preparation
4.2.3. Tissue Extract Preparation
4.2.4. Extract Incubation
4.2.5. Staining and Comet Analysis
4.3. Gene Expression Analysis of DNA Glycosylases
4.4. Determination of Oxidative Stress Parameters
4.4.1. 8-oxodG Lesion Quantification
4.4.2. Determination of Mitochondrial DNA (mtDNA) Copy Number and the Trolox Equivalent Antioxidant Capacity (TEAC)
4.5. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Birben, E.; Sahiner, U.M.; Sackesen, C.; Erzurum, S.; Kalayci, O. Oxidative stress and antioxidant defense. World Allergy Organ. J. 2012, 5, 9–19. [Google Scholar] [CrossRef] [PubMed]
- Liou, G.Y.; Storz, P. Reactive oxygen species in cancer. Free Radic. Res. 2010, 44, 479–496. [Google Scholar] [CrossRef] [PubMed]
- Collins, A.R. The comet assay for DNA damage and repair: Principles, applications, and limitations. Mol. Biotechnol. 2004, 26, 249–261. [Google Scholar] [CrossRef] [PubMed]
- Vodenkova, S.; Azqueta, A.; Collins, A.; Dusinska, M.; Gaivão, I.; Møller, P.; Opattova, A.; Vodicka, P.; Godschalk, R.W.L.; Langie, S.A.S. An optimized comet-based in vitro DNA repair assay to assess base and nucleotide excision repair activity. Nat. Protoc. 2020, 15, 3844–3878. [Google Scholar] [CrossRef] [PubMed]
- Fikrova, P.; Stetina, R.; Hrnciarik, M.; Hrnciarikova, D.; Hronek, M.; Zadak, Z. DNA crosslinks, DNA damage and repair in peripheral blood lymphocytes of non-small cell lung cancer patients treated with platinum derivatives. Oncol. Rep. 2013, 31, 391–396. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Slyskova, J.; Naccarati, A.; Pardini, B.; Polakova, V.; Vodickova, L.; Smerhovsky, Z.; Levy, M.; Lipska, L.; Liska, V.; Vodicka, P. Differences in nucleotide excision repair capacity between newly diagnosed colorectal cancer patients and healthy controls. Mutagenesis 2012, 27, 225–232. [Google Scholar] [CrossRef] [PubMed]
- Stoyanova, E.; Pastor, S.; Coll, E.; Azqueta, A.; Collins, A.R.; Marcos, R. Base excision repair capacity in chronic renal failure patients undergoing hemodialysis treatment. Cell Biochem. Funct. 2013, 32, 177–182. [Google Scholar] [CrossRef]
- Slyskova, J.; Korenkova, V.; Collins, A.R.; Prochazka, P.; Vodickova, L.; Svec, J.; Lipska, L.; Levy, M. Functional, genetic, and epigenetic aspects of base and nucleotide excision repair in colorectal carcinomas. Clin. Cancer Res. 2012, 18, 5878–5887. [Google Scholar] [CrossRef]
- Slyskova, J.; Langie, S.A.S.; Collins, A.R.; Vodicka, P. Functional evaluation of DNA repair in human biopsies and their relation to other cellular biomarkers. Front. Genet. 2014, 5, 116. [Google Scholar] [CrossRef]
- Manokhina, I.; Del Gobbo, G.F.; Konwar, C.; Wilson, S.L.; Robinson, W.P. Review: Placental biomarkers for assessing fetal health. Hum. Mol. Genet. 2017, 26, R237–R245. [Google Scholar] [CrossRef]
- Portelli, M.; Baron, B. Clinical Presentation of Preeclampsia and the Diagnostic Value of Proteins and Their Methylation Products as Biomarkers in Pregnant Women with Preeclampsia and Their Newborns. J. Pregnancy 2018, 2018, 2632637. [Google Scholar] [CrossRef] [PubMed]
- Rana, S.; Lemoine, E.; Granger, J.P.; Karumanchi, S.A. Preeclampsia: Pathophysiology, Challenges, and Perspectives. Circ. Res. 2019, 124, 1094–1112. [Google Scholar] [CrossRef] [PubMed]
- Cheng, M.-H.; Wang, P.-H. Placentation abnormalities in the pathophysiology of preeclampsia. Expert Rev. Mol. Diagn. 2009, 9, 37–49. [Google Scholar] [CrossRef] [PubMed]
- Chiarello, D.I.; Abad, C.; Rojas, D.; Toledo, F.; Vázquez, C.M.; Mate, A.; Sobrevia, L.; Marín, R. Oxidative stress: Normal pregnancy versus preeclampsia. Biochim. Biophys. Acta Mol. Basis Dis. 2018, 1866, 165354. [Google Scholar] [CrossRef] [PubMed]
- Kimura, C.; Watanabe, K.; Iwasaki, A.; Mori, T.; Matsushita, H.; Shinohara, K.; Wakatsuki, A. The severity of hypoxic changes and oxidative DNA damage in the placenta of early-onset preeclamptic women and fetal growth restriction. J. Matern. Neonatal Med. 2012, 26, 491–496. [Google Scholar] [CrossRef] [PubMed]
- Furness, D.L.F.; Dekker, G.A.; Hague, W.M.; Khong, T.Y.; Fenech, M.F. Increased lymphocyte micronucleus frequency in early pregnancy is associated prospectively with pre-eclampsia and/or intrauterine growth restriction. Mutagenesis 2010, 25, 489–498. [Google Scholar] [CrossRef]
- Langie, S.A.S.; Cameron, K.M.; Waldron, K.J.; Fletcher, K.P.R.; von Zglinicki, T.; Mathers, J.C. Measuring DNA repair incision activity of mouse tissue extracts towards singlet oxygen-induced DNA damage: A comet-based in vitro repair assay. Mutagenesis 2011, 26, 461–471. [Google Scholar] [CrossRef]
- Vangrieken, P.; Al-Nasiry, S.; Bast, A.; Leermakers, P.A.; Tulen, C.B.M.; Schiffers, P.M.H.; van Schooten, F.J.; Remels, A.H.V. Placental Mitochondrial Abnormalities in Preeclampsia. Reprod. Sci. 2021, 28, 2186–2199. [Google Scholar] [CrossRef]
- Gorniak, J.P.; Cameron, K.M.; Waldron, K.J.; von Zglinicki, T.; Mathers, J.C.; Langie, S.A.S. Tissue differences in BER-related incision activity and non-specific nuclease activity as measured by the comet assay. Mutagenesis 2013, 28, 673–681. [Google Scholar] [CrossRef]
- Burton, G.; Sebire, N.; Myatt, L.; Tannetta, D.; Wang, Y.-L.; Sadovsky, Y.; Staff, A.; Redman, C. Optimising sample collection for placental research. Placenta 2014, 35, 9–22. [Google Scholar] [CrossRef]
- Hao, W.; Wang, J.; Zhang, Y.; Wang, C.; Xia, L.; Zhang, W.; Zafar, M.; Kang, J.Y.; Wang, R.; Bohio, A.A.; et al. Enzymatically inactive OGG1 binds to DNA and steers base excision repair toward gene transcription. FASEB J. 2020, 34, 7427–7441. [Google Scholar] [CrossRef] [PubMed]
- Shah, A.; Gray, K.; Figg, N.; Finigan, A.; Starks, L.; Bennett, M. Defective Base Excision Repair of Oxidative DNA Damage in Vascular Smooth Muscle Cells Promotes Atherosclerosis. Circulation 2018, 138, 1446–1462. [Google Scholar] [CrossRef] [PubMed]
- Maiti, A.K.; Boldogh, I.; Spratt, H.; Mitra, S.; Hazra, T.K. Mutator phenotype of mammalian cells due to deficiency of NEIL1 DNA glycosylase, an oxidized base-specific repair enzyme. DNA Repair 2008, 7, 1213–1220. [Google Scholar] [CrossRef] [PubMed]
- Kladova, O.A.; Alekseeva, I.V.; Saparbaev, M.; Fedorova, O.S.; Kuznetsov, N.A. Modulation of the Apurinic/Apyrimidinic Endonuclease Activity of Human APE1 and of Its Natural Polymorphic Variants by Base Excision Repair Proteins. Int. J. Mol. Sci. 2020, 21, 7147. [Google Scholar] [CrossRef] [PubMed]
- Michita, R.T.; Kaminski, V.d.L.; Chies, J.A.B. Genetic Variants in Preeclampsia: Lessons from Studies in Latin-American Populations. Front. Physiol. 2018, 9, 1771. [Google Scholar] [CrossRef] [PubMed]
- Sandoval-Carrillo, A.; Méndez-Hernández, E.M.; Vazquez-Alaniz, F.; Aguilar-Durán, M.; Téllez-Valencia, A.; Barraza-Salas, M.; Castellanos-Juárez, F.X.; La Llave-León, O.; Salas-Pacheco, J.M. Polymorphisms in DNA repair genes (APEX1, XPD, XRCC1 and XRCC3) and risk of preeclampsia in a Mexican mestizo population. Int. J. Mol. Sci. 2014, 15, 4273–4283. [Google Scholar] [CrossRef] [PubMed]
- Vural, P.; Değirmencioğlu, S.; Doğru-Abbasoğlu, S.; Saral, N.Y.; Akgül, C.; Uysal, M. Genetic polymorphisms in DNA repair gene APE1, XRCC1 and XPD and the risk of pre-eclampsia. Eur. J. Obstet. Gynecol. Reprod. Biol. 2009, 146, 160–164. [Google Scholar] [CrossRef]
- Chambers, J.C.; Fusi, L.; Malik, I.S.; Haskard, D.O.; De Swiet, M.; Kooner, J.S. Association of maternal endothelial dysfunction with preeclampsia. JAMA 2001, 285, 1607–1612. [Google Scholar] [CrossRef]
- Sanchez-Aranguren, L.C.; Prada, C.E.; Riãno-Medina, C.E.; Lopez, M. Endothelial dysfunction and preeclampsia: Role of oxidative stress. Front. Physiol. 2014, 5, 372. [Google Scholar] [CrossRef]
- Lamarca, B. Endothelial dysfunction; an important mediator in the pathophysiology of hypertension during pre-eclampsia. Minerva Ginecol. 2012, 64, 309–320. [Google Scholar]
- Bhakat, K.K.; Mantha, A.K.; Mitra, S. Transcriptional regulatory functions of mammalian AP-endonuclease (APE1/Ref-1), an essential multifunctional protein. Antioxid. Redox Signal. 2009, 11, 621–638. [Google Scholar] [CrossRef]
- Tadesse, S.; Norwitz, N.G.; Guller, S.; Arcuri, F.; Toti, P.; Norwitz, E.R.; Kidane, D. Dynamics of Base Excision Repair at the Maternal-Fetal Interface in Pregnancies Complicated by Preeclampsia. Reprod. Sci. 2017, 24, 856–864. [Google Scholar] [CrossRef]
- Clancy, S. DNA damage & repair: Mechanisms for maintaining DNA integrity. Nat. Educ. 2008, 1, 103. [Google Scholar]
- Hilali, N.; Kocyigit, A.; Demir, M.; Camuzcuoglu, A.; Incebiyik, A.; Camuzcuoglu, H.; Vural, M.; Taskin, A. DNA damage and oxidative stress in patients with mild preeclampsia and offspring. Eur. J. Obstet. Gynecol. Reprod. Biol. 2013, 170, 377–380. [Google Scholar] [CrossRef]
- Shehu, C.; Ekele, B.; Suleman, B.; Eze, P.; Burodo, A.; Suleiman, B. A Comparative Study of Oxidative Stress in Preeclampsia and Normal Pregnancy. Sch. Int. J. Obstet. Gynecol. 2020, 3, 127–133. [Google Scholar] [CrossRef]
- Tadesse, S.; Kidane, D.; Guller, S.; Luo, T.; Norwitz, N.G.; Arcuri, F.; Toti, P.; Norwitz, E.R. In vivo and in vitro evidence for placental DNA damage in preeclampsia. PLoS ONE 2014, 9, e86791. [Google Scholar] [CrossRef]
- de Souza-Pinto, N.C.; Hogue, B.A.; Bohr, V.A. DNA repair and aging in mouse liver: 8-oxodG glycosylase activity increase in mitochondrial but not in nuclear extracts. Free Radic. Biol. Med. 2001, 30, 916–923. [Google Scholar] [CrossRef]
- Rong, Z.; Tu, P.; Xu, P.; Sun, Y.; Yu, F.; Tu, N.; Guo, L.; Yang, Y. The Mitochondrial Response to DNA Damage. Front. Cell Dev. Biol. 2021, 9, 669379. [Google Scholar] [CrossRef]
- Zhao, L. Mitochondrial DNA degradation: A quality control measure for mitochondrial genome maintenance and stress response. Enzyme 2019, 45, 311–341. [Google Scholar]
- Collins, A.R. Oxidative DNA damage, antioxidants, and cancer. Bioessays 1999, 21, 238–246. [Google Scholar] [CrossRef]
- Sagun, K.C.; Cárcamo, J.M.; Golde, D.W. Antioxidants prevent oxidative DNA damage and cellular transformation elicited by the over-expression of c-MYC. Mutat. Res. Mol. Mech. Mutagen. 2006, 593, 64–79. [Google Scholar]
- Wu, F.; Tian, F.; Lin, Y.; Xu, W. Oxidative Stress: Placenta Function and Dysfunction. Am. J. Reprod. Immunol. 2015, 76, 258–271. [Google Scholar] [CrossRef]
- Llurba, E.; Gratacós, E.; Martín-Gallán, P.; Cabero, L.; Dominguez, C. A comprehensive study of oxidative stress and antioxidant status in preeclampsia and normal pregnancy. Free Radic. Biol. Med. 2004, 37, 557–570. [Google Scholar] [CrossRef]
- Kaur, P.; Purewal, S.S.; Sandhu, K.S.; Kaur, M. DNA damage protection: An excellent application of bioactive compounds. Bioresour. Bioprocess. 2019, 6, 2. [Google Scholar] [CrossRef]
- Riklis, E.; Emerit, I.; Setlow, R. New approaches to biochemical radioprotection: Antioxidants and DNA repair enhancement. Adv. Space Res. 1996, 18, 51–54. [Google Scholar] [CrossRef]
- Collins, A.R.; Azqueta, A.; Langie, S.A.S. Effects of micronutrients on DNA repair. Eur. J. Nutr. 2012, 51, 261–279. [Google Scholar] [CrossRef]
- Fujimaki, A.; Watanabe, K.; Mori, T.; Kimura, C.; Shinohara, K.; Wakatsuki, A. Placental oxidative DNA damage and its repair in preeclamptic women with fetal growth restriction. Placenta 2011, 32, 367–372. [Google Scholar] [CrossRef]
- Capp, J. Interplay between genetic, epigenetic, and gene expression variability: Considering complexity in evolvability. Evol. Appl. 2021, 14, 893–901. [Google Scholar] [CrossRef]
- Hoff-Olsen, P.; Mevåg, B.; Staalstrøm, E.; Hovde, B.; Egeland, T.; Olaisen, B. Extraction of DNA from decomposed human tissue: An evaluation of five extraction methods for short tandem repeat typing. Forensic. Sci. Int. 1999, 105, 171–183. [Google Scholar] [CrossRef]
- Lunec, J. ESCODD: European Standards Committee on Oxidative DNA Damage. Free Radic. Res. 1998, 29, 601–608. [Google Scholar] [CrossRef]
- de Kok, T.M.; ten Vaarwerk, F.; Zwingman, I.; van Maanen, J.; Kleinjans, J. Peroxidation of linoleic, arachidonic and oleic acid in relation to the induction of oxidative DNA damage and cytogenetic effects. Carcinogenesis 1994, 15, 1399–1404. [Google Scholar] [CrossRef]









| Control (N = 11) | PE (N = 9) | |
|---|---|---|
| Maternal age (years) | 29 ± 4 | 30 ± 4 |
| Maternal BMI (kg/m2) | 25 ± 6 | 24 ± 4 |
| GA (weeks) | 39 ± 1 | 33 ± 4 ** |
| Birth weight (kg) | 3.3 ± 0.5 | 2.4 ± 1 * |
| CS (%) | 55 | 44 |
| IUGR (%) | 0 | 50 * |
| Gene | Forward (5′→3′) | Reverse (5′→3′) |
|---|---|---|
| OGG1 | TGGGGCATCGTACTCTAGC | AGATTGTCCAGAAGGCAGAAC |
| APE1 | TGCCTTCAAGAGACCAAATGTT | CGCCACTGTACCCTTCCTT |
| NEIL1 | GACTGGCGCTTTCTGATTTC | AGCCAAGCAACAACAACAAC |
| PARP1 | CCACACACAATGCGTATGACT | CCACAGCAATCTTCGGTTATGA |
| MUTYH | AATTTCTTTCGGTCTCACATCTC | AAATAAGCACTTTACTAACAACAGGA |
| B-ACTIN | CACCCAAGAACAGGGTTTGT | TGGCCATGGGTATGTTGTTAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mircheva, A.; Vangrieken, P.; Al-Nasiry, S.; van Schooten, F.-J.; Godschalk, R.W.L.; Langie, S.A.S. Optimizing the Comet Assay-Based In Vitro DNA Repair Assay for Placental Tissue: A Pilot Study with Pre-Eclamptic Patients. Int. J. Mol. Sci. 2024, 25, 187. https://doi.org/10.3390/ijms25010187
Mircheva A, Vangrieken P, Al-Nasiry S, van Schooten F-J, Godschalk RWL, Langie SAS. Optimizing the Comet Assay-Based In Vitro DNA Repair Assay for Placental Tissue: A Pilot Study with Pre-Eclamptic Patients. International Journal of Molecular Sciences. 2024; 25(1):187. https://doi.org/10.3390/ijms25010187
Chicago/Turabian StyleMircheva, Anastasiya, Philippe Vangrieken, Salwan Al-Nasiry, Frederik-Jan van Schooten, Roger W. L. Godschalk, and Sabine A. S. Langie. 2024. "Optimizing the Comet Assay-Based In Vitro DNA Repair Assay for Placental Tissue: A Pilot Study with Pre-Eclamptic Patients" International Journal of Molecular Sciences 25, no. 1: 187. https://doi.org/10.3390/ijms25010187
APA StyleMircheva, A., Vangrieken, P., Al-Nasiry, S., van Schooten, F.-J., Godschalk, R. W. L., & Langie, S. A. S. (2024). Optimizing the Comet Assay-Based In Vitro DNA Repair Assay for Placental Tissue: A Pilot Study with Pre-Eclamptic Patients. International Journal of Molecular Sciences, 25(1), 187. https://doi.org/10.3390/ijms25010187

