Mesenchymal Stem Cell Exosomes as Immunomodulatory Therapy for Corneal Scarring
Abstract
1. Introduction
2. Results
2.1. In Vitro Cellular Uptake and Immunological Effects of Mesenchymal Stem Cells-Derived Exosomes
2.2. Dosing and Retention of Topically Applied AlexaFluo-488-Labeled Exosomes on Corneal Stroma
2.3. Effects of Mesenchymal Stem Cells-Derived Exosome Treatment on Epithelial Wound Closure
2.4. Effects of Topical Mesenchymal Stem Cells-Derived Exosome Treatment on Corneal Stromal Haze Development in Rat Corneas Injured by Irregular Phototherapeutic Keratectomy
2.5. Immunohistochemistry to Assess the Relative Molecular Changes in the Injured Corneas
2.6. In Vivo Immunomodulatory Effects of Mesenchymal Stem Cells-Derived Exosome Treatment
3. Discussion
4. Material and Methods
4.1. Purified Exosomes from Embryonic Stem Cell-Derived Mesenchymal Stem Cells
4.2. Fluorescence Labeling of Exosomes
4.3. Primary Corneal Stromal Fibroblast and Myofibroblast Culture
4.4. In Vitro Cellular Uptake of Exosomes
4.5. In Vitro Inflammatory Assay by Lipopolysaccharide Treatment
4.6. Corneal Epithelial Scratch Wound Assay
4.7. Time-Lapse Tracing Studies: Dosing and Retention of AlexaFluo-488-Labeled Exosomes on Corneal Stroma
4.8. Rat Corneal Opacity Model by Irregular Phototherapeutic Keratectomy (irrPTK) and Exosome Eyedrops
4.9. Ophthalmic Examinations and Measurements
4.10. Assay of Corneal Neovascularisation
4.11. Immunohistochemistry
4.12. Gene Expression by Real-Time Polymerase Chain Reaction
4.13. Enzyme-Linked Immunosorbent Assay and Multiplex Immunoassay
4.14. Statistical Analyses
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ong, H.S.; Corbett, M.C. Corneal infections in the 21st century. Postgrad. Med. J. 2015, 91, 565–571. [Google Scholar] [CrossRef] [PubMed]
- Ong, H.S.; Dart, J.K. Managing ocular surface disease: A common-sense approach. Community Eye Health 2016, 29, 44–46. [Google Scholar] [PubMed]
- Ong, H.S.; Minassian, D.; Rauz, S.; Mehta, J.S.; Dart, J.K. Validation of a clinical assessment tool for cicatrising conjunctivitis. Ocul. Surf. 2020, 18, 121–129. [Google Scholar] [CrossRef] [PubMed]
- Saccu, G.; Menchise, V.; Giordano, C.; Delli Castelli, D.; Dastru, W.; Pellicano, R.; Tolosano, E.; Van Pham, P.; Altruda, F.; Fagoonee, S. Regenerative Approaches and Future Trends for the Treatment of Corneal Burn Injuries. J. Clin. Med. 2021, 10, 317. [Google Scholar] [CrossRef] [PubMed]
- EBAA. Eye Banking Statistical Report. Available online: https://restoresight.org/wp-content/uploads/2020/04/2019-EBAA-Stat-Report-FINAL.pdf (accessed on 10 October 2020).
- Williams, K.A.; Lowe, M.; Bartlett, C.; Kelly, T.L.; Coster, D.J.; All, C. Risk factors for human corneal graft failure within the Australian corneal graft registry. Transplantation 2008, 86, 1720–1724. [Google Scholar] [CrossRef]
- Tan, D.; Ang, M.; Arundhati, A.; Khor, W.B. Development of Selective Lamellar Keratoplasty within an Asian Corneal Transplant Program: The Singapore Corneal Transplant Study (An American Ophthalmological Society Thesis). Trans. Am. Ophthalmol. Soc. 2015, 113, T10. [Google Scholar] [PubMed]
- Ong, H.S.; Ang, M.; Mehta, J. Evolution of therapies for the corneal endothelium: Past, present and future approaches. Br. J. Ophthalmol. 2021, 105, 454–467. [Google Scholar] [CrossRef]
- Pascolini, D.; Mariotti, S.P. Global estimates of visual impairment: 2010. Br. J. Ophthalmol. 2012, 96, 614–618. [Google Scholar] [CrossRef][Green Version]
- Tan, D.T.; Dart, J.K.; Holland, E.J.; Kinoshita, S. Corneal transplantation. Lancet 2012, 379, 1749–1761. [Google Scholar] [CrossRef]
- Coster, D.J.; Lowe, M.T.; Keane, M.C.; Williams, K.A.; Australian Corneal Graft Registry, C. A comparison of lamellar and penetrating keratoplasty outcomes: A registry study. Ophthalmology 2014, 121, 979–987. [Google Scholar] [CrossRef]
- Ogawa, A.; Yamaguchi, T.; Mitamura, H.; Tomida, D.; Shimazaki-Den, S.; Murat, D.; Satake, Y.; Shimazaki, J. Aetiology-specific comparison of long-term outcome of deep anterior lamellar keratoplasty for corneal diseases. Br. J. Ophthalmol. 2016, 100, 1176–1182. [Google Scholar] [CrossRef]
- Gain, P.; Jullienne, R.; He, Z.; Aldossary, M.; Acquart, S.; Cognasse, F.; Thuret, G. Global Survey of Corneal Transplantation and Eye Banking. JAMA Ophthalmol. 2016, 134, 167–173. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Moriyama, A.S.; Erbs Pessoa, J.L.; Silva Bessa, T.R.; Pereira, N.C.; Mehta, J.S.; Hofling-Lima, A.L.; Dos Santos Forseto, A. The Impact of the COVID-19 Pandemic on Corneal Transplantation in Brazil. Cornea 2022, 41, 322–327. [Google Scholar] [CrossRef] [PubMed]
- Das, A.V.; Chaurasia, S.; Vaddavalli, P.K.; Garg, P. Year one of COVID-19 pandemic in India: Effect of lockdown and unlock on trends in keratoplasty at a tertiary eye centre. Indian J. Ophthalmol. 2021, 69, 3658–3662. [Google Scholar] [CrossRef] [PubMed]
- Australian Corneal Graft Registry, C. The Australian Graft Registry 2018 Report. Available online: https://dspace.flinders.edu.au/xmlui/bitstream/handle/2328/37917/ACGR%202018%20Report.pdf?sequence=3&isAllowed=y (accessed on 9 May 2019).
- Woo, J.H.; Ang, M.; Htoon, H.M.; Tan, D. Descemet Membrane Endothelial Keratoplasty Versus Descemet Stripping Automated Endothelial Keratoplasty and Penetrating Keratoplasty. Am. J. Ophthalmol. 2019, 207, 288–303. [Google Scholar] [CrossRef]
- Fuest, M.; Yam, G.H.; Peh, G.S.; Mehta, J.S. Advances in corneal cell therapy. Regen. Med. 2016, 11, 601–615. [Google Scholar] [CrossRef][Green Version]
- Medeiros, C.S.; Marino, G.K.; Santhiago, M.R.; Wilson, S.E. The Corneal Basement Membranes and Stromal Fibrosis. Investig. Ophthalmol. Vis. Sci. 2018, 59, 4044–4053. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Xi, X.; McMillan, D.H.; Lehmann, G.M.; Sime, P.J.; Libby, R.T.; Huxlin, K.R.; Feldon, S.E.; Phipps, R.P. Ocular fibroblast diversity: Implications for inflammation and ocular wound healing. Investig. Ophthalmol. Vis. Sci. 2011, 52, 4859–4865. [Google Scholar] [CrossRef][Green Version]
- Liu, Y.; Kimura, K.; Yanai, R.; Chikama, T.; Nishida, T. Cytokine, chemokine, and adhesion molecule expression mediated by MAPKs in human corneal fibroblasts exposed to poly(I:C). Investig. Ophthalmol. Vis. Sci. 2008, 49, 3336–3344. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Mondino, B.J.; Sundar-Raj, C.V.; Brady, K.J. Production of first component of complement by corneal fibroblasts in tissue culture. Arch. Ophthalmol. 1982, 100, 478–480. [Google Scholar] [CrossRef]
- Rothman, B.; Despins, A.; Webb, S.; Taylor, D.; Sundarraj, N.; O’Rourke, J.; Kreutzer, D. Cytokine regulation of C3 and C5 production by human corneal fibroblasts. Exp. Eye Res. 1991, 53, 353–361. [Google Scholar] [CrossRef] [PubMed]
- Bora, N.S.; Jha, P.; Bora, P.S. The role of complement in ocular pathology. Semin. Immunopathol. 2008, 30, 85–95. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Lee, S.H.; Kim, K.W.; Joo, K.; Kim, J.C. Angiogenin ameliorates corneal opacity and neovascularization via regulating immune response in corneal fibroblasts. BMC Ophthalmol. 2016, 16, 57. [Google Scholar] [CrossRef][Green Version]
- Liu, J.; Li, Z. Resident Innate Immune Cells in the Cornea. Front. Immunol. 2021, 12, 620284. [Google Scholar] [CrossRef]
- Liu, J.; Xue, Y.; Dong, D.; Xiao, C.; Lin, C.; Wang, H.; Song, F.; Fu, T.; Wang, Z.; Chen, J.; et al. CCR2(-) and CCR2(+) corneal macrophages exhibit distinct characteristics and balance inflammatory responses after epithelial abrasion. Mucosal. Immunol. 2017, 10, 1145–1159. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Zhang, S.; Chuah, S.J.; Lai, R.C.; Hui, J.H.P.; Lim, S.K.; Toh, W.S. MSC exosomes mediate cartilage repair by enhancing proliferation, attenuating apoptosis and modulating immune reactivity. Biomaterials 2018, 156, 16–27. [Google Scholar] [CrossRef] [PubMed]
- Chuah, S.J.; Yong, C.W.; Teo, K.Y.W.; Chew, J.R.J.; Cheow, Y.A.; Zhang, S.; Wong, R.C.W.; Lim, A.A.T.; Lim, S.K.; Toh, W.S. Mesenchymal stromal cell-derived small extracellular vesicles modulate macrophage polarization and enhance angio-osteogenesis to promote bone healing. Genes Dis. 2021, 9, 841–844. [Google Scholar] [CrossRef]
- Pittenger, M.; Mackay, A.; Beck, S.; Jaiswal, R.; Douglas, R.; Mosca, J.; Moorman, M.; Simonetti, D.; Craig, S.; Marshak, D. Multilineage potential of adult human mesenchymal stem cells. Science 1999, 284, 143–147. [Google Scholar] [CrossRef][Green Version]
- Le Blanc, K.; Rasmusson, I.; Sundberg, B.; Gotherstrom, C.; Hassan, M.; Uzunel, M.; Ringden, O. Treatment of severe acute graft-versus-host disease with third party haploidentical mesenchymal stem cells. Lancet 2004, 363, 1439–1441. [Google Scholar] [CrossRef]
- Le Blanc, K. Mesenchymal stem cells for treatment of steroid-resistant, severe, acute graft-versus-host disease: A phase II study. Lancet 2008, 371, 1579–1586. [Google Scholar] [CrossRef]
- Ghannam, S.; Bouffi, C.; Djouad, F.; Jorgensen, C.; Noel, D. Immunosuppression by mesenchymal stem cells: Mechanisms and clinical applications. Stem Cell Res. Ther. 2010, 1, 2. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Bruno, S.; Grange, C.; Deregibus, M.C.; Calogero, R.A.; Saviozzi, S.; Collino, F.; Morando, L.; Busca, A.; Falda, M.; Bussolati, B.; et al. Mesenchymal stem cell-derived microvesicles protect against acute tubular injury. J. Am. Soc. Nephrol. 2009, 20, 1053–1067. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Lai, R.C.; Arslan, F.; Lee, M.M.; Sze, N.S.K.; Choo, A.; Chen, T.S.; Salto-Tellez, M.; Timmers, L.; Lee, C.N.; El Oakley, R.M. Exosome secreted by MSC reduces myocardial ischemia/reperfusion injury. Stem Cell Res. 2010, 4, 214–222. [Google Scholar] [CrossRef] [PubMed][Green Version]
- He, J.; Wang, Y.; Sun, S.; Yu, M.; Wang, C.; Pei, X.; Zhu, B.; Wu, J.; Zhao, W. Bone marrow stem cells-derived microvesicles protect against renal injury in the mouse remnant kidney model. Nephrology (Carlton) 2012, 17, 493–500. [Google Scholar] [CrossRef] [PubMed]
- Doeppner, T.R.; Herz, J.; Görgens, A.; Schlechter, J.; Ludwig, A.-K.; Radtke, S.; de Miroschedji, K.; Horn, P.A.; Giebel, B.; Hermann, D.M. Extracellular Vesicles Improve Post-Stroke Neuroregeneration and Prevent Postischemic Immunosuppression. Stem Cells Transl. Med. 2015, 4, 1131–1143. [Google Scholar] [CrossRef][Green Version]
- Bruno, S.; Tapparo, M.; Collino, F.; Chiabotto, G.; Deregibus, M.C.; Soares Lindoso, R.; Neri, F.; Kholia, S.; Giunti, S.; Wen, S. Renal regenerative potential of different extracellular vesicle populations derived from bone marrow mesenchymal stromal cells. Tissue Eng. Part A 2017, 23, 1262–1273. [Google Scholar] [CrossRef]
- Witwer, K.W.; Van Balkom, B.W.M.; Bruno, S.; Choo, A.; Dominici, M.; Gimona, M.; Hill, A.F.; De Kleijn, D.; Koh, M.; Lai, R.C.; et al. Defining mesenchymal stromal cell (MSC)-derived small extracellular vesicles for therapeutic applications. J. Extracell. Vesicles 2019, 8, 1609206. [Google Scholar] [CrossRef][Green Version]
- Lai, R.C.; Yeo, R.W.; Lim, S.K. Mesenchymal stem cell exosomes. Semin. Cell Dev. Biol. 2015, 40, 82–88. [Google Scholar] [CrossRef]
- Toh, W.S.; Lai, R.C.; Zhang, B.; Lim, S.K. MSC exosome works through a protein-based mechanism of action. Biochem. Soc. Trans. 2018, 46, 843–853. [Google Scholar] [CrossRef][Green Version]
- Bai, L.; Shao, H.; Wang, H.; Zhang, Z.; Su, C.; Dong, L.; Yu, B.; Chen, X.; Li, X.; Zhang, X. Effects of Mesenchymal Stem Cell-Derived Exosomes on Experimental Autoimmune Uveitis. Sci. Rep. 2017, 7, 4323. [Google Scholar] [CrossRef][Green Version]
- Li, Y.; Ren, X.; Zhang, Z.; Duan, Y.; Li, H.; Chen, S.; Shao, H.; Li, X.; Zhang, X. Effect of small extracellular vesicles derived from IL-10-overexpressing mesenchymal stem cells on experimental autoimmune uveitis. Stem Cell Res. Ther. 2022, 13, 100. [Google Scholar] [CrossRef] [PubMed]
- Yu, B.; Shao, H.; Su, C.; Jiang, Y.; Chen, X.; Bai, L.; Zhang, Y.; Li, Q.; Zhang, X.; Li, X. Exosomes derived from MSCs ameliorate retinal laser injury partially by inhibition of MCP-1. Sci. Rep. 2016, 6, 34562. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Zhang, W.; Wang, Y.; Kong, Y. Exosomes Derived From Mesenchymal Stem Cells Modulate miR-126 to Ameliorate Hyperglycemia-Induced Retinal Inflammation Via Targeting HMGB1. Investig. Ophthalmol. Vis. Sci. 2019, 60, 294–303. [Google Scholar] [CrossRef] [PubMed][Green Version]
- He, G.H.; Zhang, W.; Ma, Y.X.; Yang, J.; Chen, L.; Song, J.; Chen, S. Mesenchymal stem cells-derived exosomes ameliorate blue light stimulation in retinal pigment epithelium cells and retinal laser injury by VEGF-dependent mechanism. Int. J. Ophthalmol. 2018, 11, 559–566. [Google Scholar] [CrossRef]
- Mead, B.; Tomarev, S. Retinal ganglion cell neuroprotection by growth factors and exosomes: Lessons from mesenchymal stem cells. Neural Regen Res. 2018, 13, 228–229. [Google Scholar] [CrossRef] [PubMed]
- Gimona, M.; Brizzi, M.F.; Choo, A.B.H.; Dominici, M.; Davidson, S.M.; Grillari, J.; Hermann, D.M.; Hill, A.F.; de Kleijn, D.; Lai, R.C.; et al. Critical considerations for the development of potency tests for therapeutic applications of mesenchymal stromal cell-derived small extracellular vesicles. Cytotherapy 2021, 23, 373–380. [Google Scholar] [CrossRef]
- Chen, T.S.; Arslan, F.; Yin, Y.; Tan, S.S.; Lai, R.C.; Choo, A.B.; Padmanabhan, J.; Lee, C.N.; de Kleijn, D.P.; Lim, S.K. Enabling a robust scalable manufacturing process for therapeutic exosomes through oncogenic immortalization of human ESC-derived MSCs. J. Transl. Med. 2011, 9, 47. [Google Scholar] [CrossRef][Green Version]
- Tan, T.T.; Lai, R.C.; Padmanabhan, J.; Sim, W.K.; Choo, A.B.H.; Lim, S.K. Assessment of Tumorigenic Potential in Mesenchymal-Stem/Stromal-Cell-Derived Small Extracellular Vesicles (MSC-sEV). Pharmaceuticals 2021, 14, 345. [Google Scholar] [CrossRef]
- Lai, R.C.; Chen, T.S.; Lim, S.K. Mesenchymal stem cell exosome: A novel stem cell-based therapy for cardiovascular disease. Regen. Med. 2011, 6, 481–492. [Google Scholar] [CrossRef][Green Version]
- Tan, C.Y.; Lai, R.C.; Wong, W.; Dan, Y.Y.; Lim, S.K.; Ho, H.K. Mesenchymal stem cell-derived exosomes promote hepatic regeneration in drug-induced liver injury models. Stem Cell Res. Ther. 2014, 5, 76. [Google Scholar] [CrossRef][Green Version]
- Zhang, B.; Yin, Y.; Lai, R.C.; Tan, S.S.; Choo, A.B.; Lim, S.K. Mesenchymal stem cells secrete immunologically active exosomes. Stem Cells Dev. 2014, 23, 1233–1244. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.; Yeo, R.W.Y.; Lai, R.C.; Sim, E.W.K.; Chin, K.C.; Lim, S.K. Mesenchymal stromal cell exosome–enhanced regulatory T-cell production through an antigen-presenting cell–mediated pathway. Cytotherapy 2018, 20, 687–696. [Google Scholar] [CrossRef]
- Zhang, S.; Chu, W.C.; Lai, R.C.; Lim, S.K.; Hui, J.H.; Toh, W.S. Exosomes derived from human embryonic mesenchymal stem cells promote osteochondral regeneration. Osteoarthr. Cartil. 2016, 24, 2135–2140. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Zhang, S.; Teo, K.Y.W.; Chuah, S.J.; Lai, R.C.; Lim, S.K.; Toh, W.S. MSC exosomes alleviate temporomandibular joint osteoarthritis by attenuating inflammation and restoring matrix homeostasis. Biomaterials 2019, 200, 35–47. [Google Scholar] [CrossRef] [PubMed]
- Wong, K.L.; Zhang, S.; Wang, M.; Ren, X.; Afizah, H.; Lai, R.C.; Lim, S.K.; Lee, E.H.; Hui, J.H.P.; Toh, W.S. Intra-Articular Injections of Mesenchymal Stem Cell Exosomes and Hyaluronic Acid Improve Structural and Mechanical Properties of Repaired Cartilage in a Rabbit Model. Arthroscopy 2020, 36, 2215–2228.e2212. [Google Scholar] [CrossRef]
- Dorronsoro, A.; Santiago, F.E.; Grassi, D.; Zhang, T.; Lai, R.C.; McGowan, S.J.; Angelini, L.; Lavasani, M.; Corbo, L.; Lu, A.; et al. Mesenchymal stem cell-derived extracellular vesicles reduce senescence and extend health span in mouse models of aging. Aging Cell 2021, 20, e13337. [Google Scholar] [CrossRef]
- Accarie, A.; l’Homme, B.; Benadjaoud, M.A.; Lim, S.K.; Guha, C.; Benderitter, M.; Tamarat, R.; Sémont, A. Extracellular vesicles derived from mesenchymal stromal cells mitigate intestinal toxicity in a mouse model of acute radiation syndrome. Stem Cell Res. Ther. 2020, 11, 371. [Google Scholar] [CrossRef]
- Zhang, B.; Lai, R.C.; Sim, W.K.; Choo, A.B.H.; Lane, E.B.; Lim, S.K. Topical Application of Mesenchymal Stem Cell Exosomes Alleviates the Imiquimod Induced Psoriasis-Like Inflammation. Int. J. Mol. Sci. 2021, 22, 720. [Google Scholar] [CrossRef]
- Lai, R.C.; Yeo, R.W.; Tan, S.S.; Zhang, B.; Yin, Y.; Sze, N.S.; Choo, A.; Lim, S.K. Mesenchymal Stem Cell Exosomes: The Future MSC-based Therapy? In Mesenchymal Stem Cell Therapy; Chase, L.G., Vemuri, M.C., Eds.; Humana Press: Totowa, NJ, USA, 2012. [Google Scholar]
- Yam, G.H.F.; Riau, A.K.; Funderburgh, M.L.; Mehta, J.S.; Jhanji, V. Keratocyte biology. Exp. Eye Res. 2020, 196, 108062. [Google Scholar] [CrossRef]
- Kumagai, N.; Fukuda, K.; Fujitsu, Y.; Lu, Y.; Chikamoto, N.; Nishida, T. Lipopolysaccharide-induced expression of intercellular adhesion molecule-1 and chemokines in cultured human corneal fibroblasts. Investig. Ophthalmol. Vis. Sci. 2005, 46, 114–120. [Google Scholar] [CrossRef]
- Barbosa, F.L.; Chaurasia, S.S.; Cutler, A.; Asosingh, K.; Kaur, H.; de Medeiros, F.W.; Agrawal, V.; Wilson, S.E. Corneal myofibroblast generation from bone marrow-derived cells. Exp. Eye Res. 2010, 91, 92–96. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Bargagna-Mohan, P.; Ishii, A.; Lei, L.; Sheehy, D.; Pandit, S.; Chan, G.; Bansal, R.; Mohan, R. Sustained activation of ERK1/2 MAPK in Schwann cells causes corneal neurofibroma. J. Neurosci. Res. 2017, 95, 1712–1729. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Kawashima, M.; Kawakita, T.; Higa, K.; Satake, Y.; Omoto, M.; Tsubota, K.; Shimmura, S.; Shimazaki, J. Subepithelial corneal fibrosis partially due to epithelial-mesenchymal transition of ocular surface epithelium. Mol. Vis. 2010, 16, 2727–2732. [Google Scholar] [PubMed]
- Wilson, S.E. Coordinated Modulation of Corneal Scarring by the Epithelial Basement Membrane and Descemet’s Basement Membrane. J. Refract. Surg. 2019, 35, 506–516. [Google Scholar] [CrossRef]
- Samaeekia, R.; Rabiee, B.; Putra, I.; Shen, X.; Park, Y.J.; Hematti, P.; Eslani, M.; Djalilian, A.R. Effect of Human Corneal Mesenchymal Stromal Cell-derived Exosomes on Corneal Epithelial Wound Healing. Investig. Ophthalmol. Vis. Sci. 2018, 59, 5194–5200. [Google Scholar] [CrossRef][Green Version]
- Han, K.Y.; Tran, J.A.; Chang, J.H.; Azar, D.T.; Zieske, J.D. Potential role of corneal epithelial cell-derived exosomes in corneal wound healing and neovascularization. Sci. Rep. 2017, 7, 40548. [Google Scholar] [CrossRef][Green Version]
- Bolanos-Jimenez, R.; Navas, A.; Lopez-Lizarraga, E.P.; de Ribot, F.M.; Pena, A.; Graue-Hernandez, E.O.; Garfias, Y. Ocular Surface as Barrier of Innate Immunity. Open Ophthalmol. J. 2015, 9, 49–55. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Lai, R.C.; Arslan, F.; Tan, S.S.; Tan, B.; Choo, A.; Lee, M.M.; Chen, T.S.; Teh, B.J.; Eng, J.K.; Sidik, H.; et al. Derivation and characterization of human fetal MSCs: An alternative cell source for large-scale production of cardioprotective microparticles. J. Mol. Cell Cardiol. 2010, 48, 1215–1224. [Google Scholar] [CrossRef]
- Sze, S.K.; de Kleijn, D.P.; Lai, R.C.; Khia Way Tan, E.; Zhao, H.; Yeo, K.S.; Low, T.Y.; Lian, Q.; Lee, C.N.; Mitchell, W.; et al. Elucidating the secretion proteome of human embryonic stem cell-derived mesenchymal stem cells. Mol. Cell Proteomics. 2007, 6, 1680–1689. [Google Scholar] [CrossRef][Green Version]
- Shtein, R.M.; Elner, S.G.; Bian, Z.M.; Elner, V.M. IL-8 and MCP Gene Expression and Production by LPS-Stimulated Human Corneal Stromal Cells. Int. J. Inflamm. 2012, 2012, 714704. [Google Scholar] [CrossRef][Green Version]
- Tong, L.; Png, E.; Aihua, H.; Yong, S.S.; Yeo, H.L.; Riau, A.; Mendoz, E.; Chaurasia, S.S.; Lim, C.T.; Yiu, T.W.; et al. Molecular mechanism of transglutaminase-2 in corneal epithelial migration and adhesion. Biochim. Biophys. Acta 2013, 1833, 1304–1315. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Chaurasia, S.S.; Perera, P.R.; Poh, R.; Lim, R.R.; Wong, T.T.; Mehta, J.S. Hevin plays a pivotal role in corneal wound healing. PLoS ONE 2013, 8, e81544. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Munger, R.J. Veterinary ophthalmology in laboratory animal studies. Vet. Ophthalmol. 2002, 5, 167–175. [Google Scholar] [CrossRef] [PubMed]
- Yam, G.H.; Fuest, M.; Yusoff, N.; Goh, T.W.; Bandeira, F.; Setiawan, M.; Seah, X.Y.; Lwin, N.C.; Stanzel, T.P.; Ong, H.S.; et al. Safety and Feasibility of Intrastromal Injection of Cultivated Human Corneal Stromal Keratocytes as Cell-Based Therapy for Corneal Opacities. Investig. Ophthalmol. Vis. Sci. 2018, 59, 3340–3354. [Google Scholar] [CrossRef] [PubMed][Green Version]
Gene | Accession No. | Sequence/Assay ID |
---|---|---|
CD90 (human) | NM_006288 | F: GACCCGTGAGACAAAGAAGCR: TGGAGTGCACACGTGTAGG |
ACTA2 (human) | BC017554 | F: CCTCCCTTGAGAAGAGTTACGR: GAGCAGGAAAGTGTTTTAGAA |
GAPDH (human) | NM_002046 | F: TGTGGTCATGAGTCCTTCCAR: CGAGATCCCTCCAAAATCAA |
CD80 (rat) | NM_012926 | Rn00709368_m1 |
CD86 (rat) | NM_020081 | Rn00571654_m1 |
CD163 (rat) | NM_001107887 | Rn01492519_m1 |
CD206 (rat) | NM_001106123 | Rn01487342_m1 |
NOS2 (rat) | NM_012611 | Rn00561646_m1 |
ARG1 (rat) | NM_017134 | Rn00691090_m1 |
HPRT1 (rat) | NM_012583 | Rn01527840_m1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ong, H.S.; Riau, A.K.; Yam, G.H.-F.; Yusoff, N.Z.B.M.; Han, E.J.Y.; Goh, T.-W.; Lai, R.C.; Lim, S.K.; Mehta, J.S. Mesenchymal Stem Cell Exosomes as Immunomodulatory Therapy for Corneal Scarring. Int. J. Mol. Sci. 2023, 24, 7456. https://doi.org/10.3390/ijms24087456
Ong HS, Riau AK, Yam GH-F, Yusoff NZBM, Han EJY, Goh T-W, Lai RC, Lim SK, Mehta JS. Mesenchymal Stem Cell Exosomes as Immunomodulatory Therapy for Corneal Scarring. International Journal of Molecular Sciences. 2023; 24(8):7456. https://doi.org/10.3390/ijms24087456
Chicago/Turabian StyleOng, Hon Shing, Andri K. Riau, Gary Hin-Fai Yam, Nur Zahirah Binte M. Yusoff, Evelina J. Y. Han, Tze-Wei Goh, Ruenn Chai Lai, Sai Kiang Lim, and Jodhbir S. Mehta. 2023. "Mesenchymal Stem Cell Exosomes as Immunomodulatory Therapy for Corneal Scarring" International Journal of Molecular Sciences 24, no. 8: 7456. https://doi.org/10.3390/ijms24087456
APA StyleOng, H. S., Riau, A. K., Yam, G. H.-F., Yusoff, N. Z. B. M., Han, E. J. Y., Goh, T.-W., Lai, R. C., Lim, S. K., & Mehta, J. S. (2023). Mesenchymal Stem Cell Exosomes as Immunomodulatory Therapy for Corneal Scarring. International Journal of Molecular Sciences, 24(8), 7456. https://doi.org/10.3390/ijms24087456