MiR-199a-5p-Regulated SMARCA4 Promotes Oral Squamous Cell Carcinoma Tumorigenesis
Abstract
1. Introduction
2. Results
2.1. SMARCA4 Is Highly Expressed in OSCC
2.2. SMARCA4 Expression Is Associated with Tumor Invasion and Metastasis through EMT in OSCC
2.3. SMARCA4 Is a Target Gene of miR-199a-5p in OSCC
2.4. MiR-199a-5p-Regulated SMARCA4 Promotes OSCC Cell Migration and Invasion
2.5. Effect of SMARCA4 Knockdown on the Tumorigenesis of OSCC In Vivo
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Human Tissue Microarray
4.3. Cell Transfection
4.4. Protein Extraction and Western Blot Analysis
4.5. Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR)
4.6. Immunofluorescence
4.7. Bioinformatics Analysis and Dual-Luciferase Reporter Gene Assay
4.8. Cell-Based Assays
4.8.1. Wound Healing Assay
4.8.2. Transwell Migration and Invasion Assays
4.9. Tumorigenicity Assays in Nude Mice
4.10. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Leemans, C.R.; Snijders, P.J.F.; Brakenhoff, R.H. The molecular landscape of head and neck cancer. Nat. Rev. Cancer 2018, 18, 269–282. [Google Scholar] [CrossRef] [PubMed]
- Cancer Genome Atlas Network. Comprehensive genomic characterization of head and neck squamous cell carcinomas. Nature 2015, 517, 576–582. [Google Scholar] [CrossRef]
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef] [PubMed]
- Genden, E.M.; Ferlito, A.; Bradley, P.J.; Rinaldo, A.; Scully, C. Neck disease and distant metastases. Oral Oncol. 2003, 39, 207–212. [Google Scholar] [CrossRef] [PubMed]
- Ling, Z.; Cheng, B.; Tao, X. Epithelial-to-mesenchymal transition in oral squamous cell carcinoma: Challenges and opportunities. Int. J. Cancer 2021, 148, 1548–1561. [Google Scholar] [CrossRef] [PubMed]
- Loh, C.Y.; Chai, J.Y.; Tang, T.F.; Wong, W.F.; Sethi, G.; Shanmugam, M.K.; Chong, P.P.; Looi, C.Y. The E-Cadherin and N-Cadherin Switch in Epithelial-to-Mesenchymal Transition: Signaling, Therapeutic Implications, and Challenges. Cells 2019, 8, 1118. [Google Scholar] [CrossRef] [PubMed]
- Usman, S.; Waseem, N.H.; Nguyen, T.K.N.; Mohsin, S.; Jamal, A.; Teh, M.T.; Waseem, A. Vimentin Is at the Heart of Epithelial Mesenchymal Transition (EMT) Mediated Metastasis. Cancers 2021, 13, 4985. [Google Scholar] [CrossRef]
- Aiello, N.M.; Kang, Y. Context-dependent EMT programs in cancer metastasis. J. Exp. Med. 2019, 216, 1016–1026. [Google Scholar] [CrossRef]
- Trotter, K.W.; Archer, T.K. The BRG1 transcriptional coregulator. Nucl. Recept. Signal. 2008, 6, e004. [Google Scholar] [CrossRef]
- Gong, F.; Chiu, L.Y.; Cox, B.; Aymard, F.; Clouaire, T.; Leung, J.W.; Cammarata, M.; Perez, M.; Agarwal, P.; Brodbelt, J.S.; et al. Screen identifies bromodomain protein ZMYND8 in chromatin recognition of transcription-associated DNA damage that promotes homologous recombination. Genes Dev. 2015, 29, 197–211. [Google Scholar] [CrossRef]
- Seo, S.; Herr, A.; Lim, J.W.; Richardson, G.A.; Richardson, H.; Kroll, K.L. Geminin regulates neuronal differentiation by antagonizing Brg1 activity. Genes Dev. 2005, 19, 1723–1734. [Google Scholar] [CrossRef] [PubMed]
- Kaufmann, B.; Wang, B.; Zhong, S.; Laschinger, M.; Patil, P.; Lu, M.; Assfalg, V.; Cheng, Z.; Friess, H.; Huser, N.; et al. BRG1 promotes hepatocarcinogenesis by regulating proliferation and invasiveness. PLoS ONE 2017, 12, e0180225. [Google Scholar] [CrossRef] [PubMed]
- Peng, L.; Li, J.; Wu, J.; Xu, B.; Wang, Z.; Giamas, G.; Stebbing, J.; Yu, Z. A Pan-Cancer Analysis of SMARCA4 Alterations in Human Cancers. Front. Immunol. 2021, 12, 762598. [Google Scholar] [CrossRef] [PubMed]
- Wilson, B.G.; Roberts, C.W. SWI/SNF nucleosome remodellers and cancer. Nat. Rev. Cancer 2011, 11, 481–492. [Google Scholar] [CrossRef] [PubMed]
- Mardinian, K.; Adashek, J.J.; Botta, G.P.; Kato, S.; Kurzrock, R. SMARCA4: Implications of an Altered Chromatin-Remodeling Gene for Cancer Development and Therapy. Mol. Cancer Ther. 2021, 20, 2341–2351. [Google Scholar] [CrossRef] [PubMed]
- Kadoch, C.; Crabtree, G.R. Mammalian SWI/SNF chromatin remodeling complexes and cancer: Mechanistic insights gained from human genomics. Sci. Adv. 2015, 1, e1500447. [Google Scholar] [CrossRef] [PubMed]
- Helming, K.C.; Wang, X.; Roberts, C.W.M. Vulnerabilities of mutant SWI/SNF complexes in cancer. Cancer Cell. 2014, 26, 309–317. [Google Scholar] [CrossRef]
- Wu, Q.; Madany, P.; Dobson, J.R.; Schnabl, J.M.; Sharma, S.; Smith, T.C.; van Wijnen, A.J.; Stein, J.L.; Lian, J.B.; Stein, G.S.; et al. The BRG1 chromatin remodeling enzyme links cancer cell metabolism and proliferation. Oncotarget 2016, 7, 38270–38281. [Google Scholar] [CrossRef]
- Reisman, D.N.; Sciarrotta, J.; Wang, W.; Funkhouser, W.K.; Weissman, B.E. Loss of BRG1/BRM in human lung cancer cell lines and primary lung cancers: Correlation with poor prognosis. Cancer Res. 2003, 63, 560–566. [Google Scholar]
- Medina, P.P.; Romero, O.A.; Kohno, T.; Montuenga, L.M.; Pio, R.; Yokota, J.; Sanchez-Cespedes, M. Frequent BRG1/SMARCA4-inactivating mutations in human lung cancer cell lines. Hum. Mutat. 2008, 29, 617–622. [Google Scholar] [CrossRef]
- Lu, P.; Roberts, C.W. The SWI/SNF tumor suppressor complex: Regulation of promoter nucleosomes and beyond. Nucleus 2013, 4, 374–378. [Google Scholar] [CrossRef]
- Tagal, V.; Wei, S.; Zhang, W.; Brekken, R.A.; Posner, B.A.; Peyton, M.; Girard, L.; Hwang, T.; Wheeler, D.A.; Minna, J.D.; et al. SMARCA4-inactivating mutations increase sensitivity to Aurora kinase A inhibitor VX-680 in non-small cell lung cancers. Nat. Commun. 2017, 8, 14098. [Google Scholar] [CrossRef]
- Shain, A.H.; Giacomini, C.P.; Matsukuma, K.; Karikari, C.A.; Bashyam, M.D.; Hidalgo, M.; Maitra, A.; Pollack, J.R. Convergent structural alterations define SWItch/Sucrose NonFermentable (SWI/SNF) chromatin remodeler as a central tumor suppressive complex in pancreatic cancer. Proc. Natl. Acad. Sci. USA 2012, 109, E252–E259. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Liu, L.; Li, M.; Cheng, X.; Fang, M.; Zeng, Q.; Xu, Y. The chromatin remodeling protein BRG1 links ELOVL3 trans-activation to prostate cancer metastasis. Biochim. Biophys. Acta (BBA) Gene Regul. Mech. 2019, 1862, 834–845. [Google Scholar] [CrossRef] [PubMed]
- Sun, L.; Yuan, Y.; Chen, J.; Ma, C.; Xu, Y. Brahma related gene 1 (BRG1) regulates breast cancer cell migration and invasion by activating MUC1 transcription. Biochem. Biophys. Res. Commun. 2019, 511, 536–543. [Google Scholar] [CrossRef]
- Wang, P.; Song, X.; Cao, D.; Cui, K.; Wang, J.; Utpatel, K.; Shang, R.; Wang, H.; Che, L.; Evert, M.; et al. Oncogene-dependent function of BRG1 in hepatocarcinogenesis. Cell. Death Dis. 2020, 11, 91. [Google Scholar] [CrossRef] [PubMed]
- Ma, P.; Pan, Y.; Yang, F.; Fang, Y.; Liu, W.; Zhao, C.; Yu, T.; Xie, M.; Jing, X.; Wu, X.; et al. KLF5-Modulated lncRNA NEAT1 Contributes to Tumorigenesis by Acting as a Scaffold for BRG1 to Silence GADD45A in Gastric Cancer. Mol. Ther. Nucleic Acids 2020, 22, 382–395. [Google Scholar] [CrossRef] [PubMed]
- Bai, J.; Mei, P.J.; Liu, H.; Li, C.; Li, W.; Wu, Y.P.; Yu, Z.Q.; Zheng, J.N. BRG1 expression is increased in human glioma and controls glioma cell proliferation, migration and invasion in vitro. J. Cancer Res. Clin. Oncol. 2012, 138, 991–998. [Google Scholar] [CrossRef] [PubMed]
- Saladi, S.V.; Keenen, B.; Marathe, H.G.; Qi, H.; Chin, K.V.; de la Serna, I.L. Modulation of extracellular matrix/adhesion molecule expression by BRG1 is associated with increased melanoma invasiveness. Mol. Cancer 2010, 9, 280. [Google Scholar] [CrossRef]
- Gunduz, E.; Gunduz, M.; Ouchida, M.; Nagatsuka, H.; Beder, L.; Tsujigiwa, H.; Fukushima, K.; Nishizaki, K.; Shimizu, K.; Nagai, N. Genetic and epigenetic alterations of BRG1 promote oral cancer development. Int. J. Oncol. 2005, 26, 201–210. [Google Scholar] [CrossRef]
- Lu, T.X.; Rothenberg, M.E. MicroRNA. J. Allergy Clin. Immunol. 2018, 141, 1202–1207. [Google Scholar] [CrossRef] [PubMed]
- Carron, J.; Torricelli, C.; Silva, J.K.; Queiroz, G.S.R.; Ortega, M.M.; Lima, C.S.P.; Lourenco, G.J. microRNAs deregulation in head and neck squamous cell carcinoma. Head Neck 2021, 43, 645–667. [Google Scholar] [CrossRef] [PubMed]
- Domingues, C.; Serambeque, B.P.; Laranjo Candido, M.S.; Marto, C.M.M.; Veiga, F.J.B.; Sarmento Antunes Cruz Ribeiro, A.B.; Figueiras, A.R.R.; Botelho, M.F.R.; Dourado, M. Epithelial-mesenchymal transition and microRNAs: Challenges and future perspectives in oral cancer. Head Neck 2018, 40, 2304–2313. [Google Scholar] [CrossRef] [PubMed]
- Li, B.; Cao, Y.; Sun, M.; Feng, H. Expression, regulation, and function of exosome-derived miRNAs in cancer progression and therapy. FASEB J. 2021, 35, e21916. [Google Scholar] [CrossRef]
- Wei, D.; Shen, B.; Wang, W.; Zhou, Y.; Yang, X.; Lu, G.; Yang, J.; Shao, Y. MicroRNA199a5p functions as a tumor suppressor in oral squamous cell carcinoma via targeting the IKKbeta/NFkappaB signaling pathway. Int. J. Mol. Med. 2019, 43, 1585–1596. [Google Scholar] [CrossRef]
- Koshizuka, K.; Hanazawa, T.; Kikkawa, N.; Arai, T.; Okato, A.; Kurozumi, A.; Kato, M.; Katada, K.; Okamoto, Y.; Seki, N. Regulation of ITGA3 by the anti-tumor miR-199 family inhibits cancer cell migration and invasion in head and neck cancer. Cancer Sci. 2017, 108, 1681–1692. [Google Scholar] [CrossRef]
- Wei, D.; Wang, W.; Shen, B.; Zhou, Y.; Yang, X.; Lu, G.; Yang, J.; Shao, Y. MicroRNA-199a-5p suppresses migration and invasion in oral squamous cell carcinoma through inhibiting the EMT-related transcription factor SOX4. Int. J. Mol. Med. 2019, 44, 185–195. [Google Scholar] [CrossRef]
- Jiang, X.; Liu, J.; Li, S.; Jia, B.; Huang, Z.; Shen, J.; Luo, H.; Zhao, J. CCL18-induced LINC00319 promotes proliferation and metastasis in oral squamous cell carcinoma via the miR-199a-5p/FZD4 axis. Cell. Death Dis. 2020, 11, 777. [Google Scholar] [CrossRef]
- Polyak, K.; Weinberg, R.A. Transitions between epithelial and mesenchymal states: Acquisition of malignant and stem cell traits. Nat. Rev. Cancer 2009, 9, 265–273. [Google Scholar] [CrossRef]
- Hodges, C.; Kirkland, J.G.; Crabtree, G.R. The Many Roles of BAF (mSWI/SNF) and PBAF Complexes in Cancer. Cold Spring Harb. Perspect. Med. 2016, 6, a026930. [Google Scholar] [CrossRef]
- Sentani, K.; Oue, N.; Kondo, H.; Kuraoka, K.; Motoshita, J.; Ito, R.; Yokozaki, H.; Yasui, W. Increased expression but not genetic alteration of BRG1, a component of the SWI/SNF complex, is associated with the advanced stage of human gastric carcinomas. Pathobiology 2001, 69, 315–320. [Google Scholar] [CrossRef] [PubMed]
- Roy, N.; Malik, S.; Villanueva, K.E.; Urano, A.; Lu, X.; Von Figura, G.; Seeley, E.S.; Dawson, D.W.; Collisson, E.A.; Hebrok, M. Brg1 promotes both tumor-suppressive and oncogenic activities at distinct stages of pancreatic cancer formation. Genes Dev. 2015, 29, 658–671. [Google Scholar] [CrossRef] [PubMed]
- De Craene, B.; Berx, G. Regulatory networks defining EMT during cancer initiation and progression. Nat. Rev. Cancer 2013, 13, 97–110. [Google Scholar] [CrossRef] [PubMed]
- Goossens, S.; Vandamme, N.; Van Vlierberghe, P.; Berx, G. EMT transcription factors in cancer development re-evaluated: Beyond EMT and MET. Biochim. Biophys. Acta Rev. Cancer 2017, 1868, 584–591. [Google Scholar] [CrossRef]
- Hu, Y.P.; Jin, Y.P.; Wu, X.S.; Yang, Y.; Li, Y.S.; Li, H.F.; Xiang, S.S.; Song, X.L.; Jiang, L.; Zhang, Y.J.; et al. LncRNA-HGBC stabilized by HuR promotes gallbladder cancer progression by regulating miR-502-3p/SET/AKT axis. Mol. Cancer 2019, 18, 167. [Google Scholar] [CrossRef]
- Brabletz, S.; Schuhwerk, H.; Brabletz, T.; Stemmler, M.P. Dynamic EMT: A multi-tool for tumor progression. EMBO J. 2021, 40, e108647. [Google Scholar] [CrossRef]
- Yan, X.; Han, D.; Chen, Z.; Han, C.; Dong, W.; Han, L.; Zou, L.; Zhang, J.; Liu, Y.; Chai, J. RUNX2 interacts with BRG1 to target CD44 for promoting invasion and migration of colorectal cancer cells. Cancer Cell. Int. 2020, 20, 505. [Google Scholar] [CrossRef]
- Huang, L.Y.; Zhao, J.; Chen, H.; Wan, L.; Inuzuka, H.; Guo, J.; Fu, X.; Zhai, Y.; Lu, Z.; Wang, X.; et al. SCF(FBW7)-mediated degradation of Brg1 suppresses gastric cancer metastasis. Nat. Commun. 2018, 9, 3569. [Google Scholar] [CrossRef]
- Harrandah, A.M.; Mora, R.A.; Chan, E.K.L. Emerging microRNAs in cancer diagnosis, progression, and immune surveillance. Cancer Lett. 2018, 438, 126–132. [Google Scholar] [CrossRef]
- Karatas, O.F.; Oner, M.; Abay, A.; Diyapoglu, A. MicroRNAs in human tongue squamous cell carcinoma: From pathogenesis to therapeutic implications. Oral Oncol. 2017, 67, 124–130. [Google Scholar] [CrossRef]
- Zhang, H.; Sun, Z.; Yu, L.; Sun, J. MiR-139-5p inhibits proliferation and promoted apoptosis of human airway smooth muscle cells by downregulating the Brg1 gene. Respir. Physiol. Neurobiol. 2017, 246, 9–16. [Google Scholar] [CrossRef] [PubMed]
- Li, F.; Liang, J.; Tong, H.; Zhu, S.; Tang, D. Inhibition of microRNA-199a-5p ameliorates oxygen-glucose deprivation/reoxygenation-induced apoptosis and oxidative stress in HT22 neurons by targeting Brg1 to activate Nrf2/HO-1 signalling. Clin. Exp. Pharmacol. Physiol. 2020, 47, 1020–1029. [Google Scholar] [CrossRef]
- Chang, Y.; Cui, M.; Fu, X.; Zhang, L.; Li, X.; Li, L.; Wu, J.; Sun, Z.; Zhang, X.; Li, Z.; et al. MiRNA-155 regulates lymphangiogenesis in natural killer/T-cell lymphoma by targeting BRG1. Cancer Biol. Ther. 2019, 20, 31–41. [Google Scholar] [CrossRef] [PubMed]
- Seeley, J.J.; Baker, R.G.; Mohamed, G.; Bruns, T.; Hayden, M.S.; Deshmukh, S.D.; Freedberg, D.E.; Ghosh, S. Induction of innate immune memory via microRNA targeting of chromatin remodelling factors. Nature 2018, 559, 114–119. [Google Scholar] [CrossRef] [PubMed]
- Sakurai, K.; Furukawa, C.; Haraguchi, T.; Inada, K.; Shiogama, K.; Tagawa, T.; Fujita, S.; Ueno, Y.; Ogata, A.; Ito, M.; et al. MicroRNAs miR-199a-5p and -3p target the Brm subunit of SWI/SNF to generate a double-negative feedback loop in a variety of human cancers. Cancer Res. 2011, 71, 1680–1689. [Google Scholar] [CrossRef]
- Xu, M.Y.; Porte, J.; Knox, A.J.; Weinreb, P.H.; Maher, T.M.; Violette, S.M.; McAnulty, R.J.; Sheppard, D.; Jenkins, G. Lysophosphatidic Acid Induces {alpha}v{beta}6 Integrin-Mediated TGF-{beta} Activation via the LPA2 Receptor and the Small G Protein G{alpha}q. Am. J. Pathol. 2009, 174, 1264–1279. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]









| microRNA | Oligonucleotide Sequences (5′ > 3′) |
|---|---|
| hsa-miR-199a-5p mimics | CCCAGUGUUCAGACUACCUGUUC |
| ACAGGUAGUCUGAACACUGGGUU | |
| mimics NC | UUCUCCGAACGUGUCACGUTT |
| ACGUGACACGUUCGGAGAATT | |
| hsa-miR-199a-5p inhibitor | GAACAGGUAGUCUGAACACUGGG |
| inhibitor NC | CAGUACUUUUGUGUAGUACAA |
| Target | Forward Primer (5′ > 3′) | Reverse Primer (5′ > 3′) |
|---|---|---|
| has-miR-199a-5p | CGCGCCCAGTGTTCAGACTAC | AGTGCAGGGTCCGAGGTATT |
| U6 | CTCGCTTCGGCAGCACA | AACGCTTCACGAATTTGCGT |
| SMARCA4 | AGTGCTGCTGTTCTGCCAAAT | GGCTGGTTGAAGGTTTTCAG |
| GAPDH | GGAGCGAGATCCCTCCAAAAT | CTGGCCCGGAAGACATCTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, M.; Zhang, J.; Lu, X.; Liu, F.; Shi, S.; Deng, X. MiR-199a-5p-Regulated SMARCA4 Promotes Oral Squamous Cell Carcinoma Tumorigenesis. Int. J. Mol. Sci. 2023, 24, 4756. https://doi.org/10.3390/ijms24054756
Xu M, Zhang J, Lu X, Liu F, Shi S, Deng X. MiR-199a-5p-Regulated SMARCA4 Promotes Oral Squamous Cell Carcinoma Tumorigenesis. International Journal of Molecular Sciences. 2023; 24(5):4756. https://doi.org/10.3390/ijms24054756
Chicago/Turabian StyleXu, Mingyan, Junling Zhang, Xuemei Lu, Fan Liu, Songlin Shi, and Xiaoling Deng. 2023. "MiR-199a-5p-Regulated SMARCA4 Promotes Oral Squamous Cell Carcinoma Tumorigenesis" International Journal of Molecular Sciences 24, no. 5: 4756. https://doi.org/10.3390/ijms24054756
APA StyleXu, M., Zhang, J., Lu, X., Liu, F., Shi, S., & Deng, X. (2023). MiR-199a-5p-Regulated SMARCA4 Promotes Oral Squamous Cell Carcinoma Tumorigenesis. International Journal of Molecular Sciences, 24(5), 4756. https://doi.org/10.3390/ijms24054756

