Identification of Differential Circular RNA Expression Profiles and Functional Networks in Human Macrophages Induced by Virulent and Avirulent Mycobacterium tuberculosis Strains
Abstract
:1. Introduction
2. Results
2.1. CircRNA Profiling in All THP-1 Cells
2.2. Analysis of Differentially Expressed circRNAs
2.3. KEGG and Reactome Pathway Analysis of Differentially Expressed circRNA Parental Genes
2.4. Detection of Differentially Expressed circRNAs
2.5. Construction of M.tb Infection-Related circRNA-miRNA-mRNA Competing Endogenous Interaction Network
3. Discussion
3.1. CircRNAs Expression in Macrophages
3.2. Differential circRNAs Associated with Virulent and Avirulent M.tb
3.3. Predicted Interaction Network of Novel Identified circRNAs in M.tb-Infected Cells
3.4. Limitation
4. Materials and Methods
4.1. Bacterial Strains and Cell Culture
4.2. Cell Infection with Bacteria
4.3. CircRNA Sequencing and Differential Expression Profile Analysis
4.4. RNase R Digestion Analyses
4.5. Reverse Transcription Polymerase Chain Reaction (RT-PCR)
4.6. Quantitative Real-Time PCR (qPCR)
4.7. Nucleocytoplasmic Isolation
4.8. KEGG and Reactome Enrichment Analyses
4.9. Prediction of miRNA-circRNA and circRNA-miRNA-circRNA ceRNA Network
4.10. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- WHO. Global Tuberculosis Report 2023 Licence: CC BY-NC-SA 3.0 IGO; WHO: Geneva, Switzerland, 2023. [Google Scholar]
- Amanda, G. Peran aerosol M. tuberculosis pada penyebaran infeksi tuberkulosis. Cermin Dunia Kedokt. 2018, 45, 62–65. [Google Scholar]
- Torrelles, J.B.; Schlesinger, L.S. Integrating lung physiology, immunology, and tuberculosis. Trends Microbiol. 2017, 25, 688–697. [Google Scholar] [CrossRef] [PubMed]
- Vanden Driessche, K.; Persson, A.; Marais, B.J.; Fink, P.J.; Urdahl, K.B. Immune vulnerability of infants to tuberculosis. Clin. Dev. Immunol. 2013, 2013, 781320. [Google Scholar] [CrossRef] [PubMed]
- O’Garra, A.; Redford, P.S.; McNab, F.W.; Bloom, C.I.; Wilkinson, R.J.; Berry, M.P. The immune response in tuberculosis. Annu. Rev. Immunol. 2013, 31, 475–527. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.H.; Liu, H.; Ge, B. Innate immunity in tuberculosis: Host defense vs pathogen evasion. Cell. Mol. Immunol. 2017, 14, 963–975. [Google Scholar] [CrossRef]
- Stanley, S.A.; Cox, J.S. Host–pathogen interactions during Mycobacterium tuberculosis infections. Pathog. Mycobacterium Tuberc. Its Interact. Host Org. 2013, 374, 211–241. [Google Scholar]
- Li, J.; Sun, D.; Pu, W.; Wang, J.; Peng, Y. Circular RNAs in cancer: Biogenesis, function, and clinical significance. Trends Cancer 2020, 6, 319–336. [Google Scholar] [CrossRef]
- Chen, L.-L.; Yang, L. Regulation of circRNA biogenesis. RNA Biol. 2015, 12, 381–388. [Google Scholar] [CrossRef]
- Sanger, H.L.; Klotz, G.; Riesner, D.; Gross, H.J.; Kleinschmidt, A.K. Viroids are single-stranded covalently closed circular RNA molecules existing as highly base-paired rod-like structures. Proc. Natl. Acad. Sci. USA 1976, 73, 3852–3856. [Google Scholar] [CrossRef]
- Patop, I.L.; Wüst, S.; Kadener, S. Past, present, and future of circ RNA s. EMBO J. 2019, 38, e100836. [Google Scholar] [CrossRef]
- Ashwal-Fluss, R.; Meyer, M.; Pamudurti, N.R.; Ivanov, A.; Bartok, O.; Hanan, M.; Evantal, N.; Memczak, S.; Rajewsky, N.; Kadener, S. circRNA biogenesis competes with pre-mRNA splicing. Mol. Cell 2014, 56, 55–66. [Google Scholar] [CrossRef] [PubMed]
- Salzman, J.; Gawad, C.; Wang, P.L.; Lacayo, N.; Brown, P.O. Circular RNAs are the predominant transcript isoform from hundreds of human genes in diverse cell types. PLoS ONE 2012, 7, e30733. [Google Scholar] [CrossRef] [PubMed]
- Du, W.W.; Yang, W.; Liu, E.; Yang, Z.; Dhaliwal, P.; Yang, B.B. Foxo3 circular RNA retards cell cycle progression via forming ternary complexes with p21 and CDK2. Nucleic Acids Res. 2016, 44, 2846–2858. [Google Scholar] [CrossRef] [PubMed]
- Holdt, L.M.; Kohlmaier, A.; Teupser, D. Molecular roles and function of circular RNAs in eukaryotic cells. Cell. Mol. Life Sci. 2018, 75, 1071–1098. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Huang, C.; Bao, C.; Chen, L.; Lin, M.; Wang, X.; Zhong, G.; Yu, B.; Hu, W.; Dai, L. Exon-intron circular RNAs regulate transcription in the nucleus. Nat. Struct. Mol. Biol. 2015, 22, 256–264. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Zhang, X.-O.; Chen, T.; Xiang, J.-F.; Yin, Q.-F.; Xing, Y.-H.; Zhu, S.; Yang, L.; Chen, L.-L. Circular intronic long noncoding RNAs. Mol. Cell 2013, 51, 792–806. [Google Scholar] [CrossRef] [PubMed]
- Hemati, Z.; Neamati, F.; Khaledi, M.; Gheibihayat, S.M.; Jafarzadeh, L.; Momen-Heravi, M.; Haddadi, M.H.; Sameni, F.; Fathizadeh, H. Circular RNAs and tuberculosis infection. Int. J. Biol. Macromol. 2022, 226, 1218–1225. [Google Scholar] [CrossRef]
- Ma, J.; Chen, X.-l.; Sun, Q. microRNA-579 upregulation mediates death of human macrophages with mycobacterium tuberculosis infection. Biochem. Biophys. Res. Commun. 2019, 518, 219–226. [Google Scholar] [CrossRef]
- Wu, M.; Liu, Z.; Zhang, S. Down-regulation of hsa_circ_0045474 induces macrophage autophagy in tuberculosis via miR-582-5p/TNKS2 axis. Innate Immun. 2021, 28, 11–18. [Google Scholar] [CrossRef]
- Huang, Z.; Yao, F.; Liu, J.; Xu, J.; Guo, Y.; Su, R.; Luo, Q.; Li, J. Up-regulation of circRNA-0003528 promotes mycobacterium tuberculosis associated macrophage polarization via down-regulating miR-224-5p, miR-324-5p and miR-488-5p and up-regulating CTLA4. Aging 2020, 12, 25658–25672. [Google Scholar] [CrossRef]
- Luo, H.L.; Pi, J.; Zhang, J.A.; Yang, E.Z.; Xu, H.; Luo, H.; Shen, L.; Peng, Y.; Liu, G.B.; Song, C.M.; et al. Circular RNA TRAPPC6B inhibits intracellular Mycobacterium tuberculosis growth while inducing autophagy in macrophages by targeting microRNA-874-3p. Clin Transl. Immunol. 2021, 10, e1254. [Google Scholar] [CrossRef] [PubMed]
- Beermann, J.; Piccoli, M.-T.; Viereck, J.; Thum, T. Non-coding RNAs in development and disease: Background, mechanisms, and therapeutic approaches. Physiol. Rev. 2016, 9, 1297–1325. [Google Scholar] [CrossRef] [PubMed]
- Thomson, D.W.; Dinger, M.E. Endogenous microRNA sponges: Evidence and controversy. Nat. Rev. Genet. 2016, 17, 272–283. [Google Scholar] [CrossRef] [PubMed]
- Li, B.; Ren, Q.; Li, Y.; Tian, S.; Chong, Y.; Sun, S.; Feng, F. Screening differential circular RNA expression profiles reveals the regulatory role of circMARS in anti-tuberculosis drug-induced liver injury. J. Cell. Mol. Med. 2022, 26, 1050–1059. [Google Scholar] [CrossRef] [PubMed]
- Almatroudi, A. Non-coding RNAs in tuberculosis epidemiology: Platforms and approaches for investigating the genome’s dark matter. Int. J. Mol. Sci. 2022, 23, 4430. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Yang, D.; Zuo, Y.; Wang, D.; Li, W. Emerging roles of circular RNAs in tuberculosis. Front. Immunol. 2022, 13, 995701. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Liu, T.; Wang, X.; He, A. Circles reshaping the RNA world: From waste to treasure. Mol. Cancer 2017, 16, 58. [Google Scholar] [CrossRef]
- Yang, X.; Ye, T.; Liu, H.; Lv, P.; Duan, C.; Wu, X.; Jiang, K.; Lu, H.; Xia, D.; Peng, E. Expression profiles, biological functions and clinical significance of circRNAs in bladder cancer. Mol. Cancer 2021, 20, 4. [Google Scholar] [CrossRef]
- Ostolaza, A.; Blanco-Luquin, I.; Urdánoz-Casado, A.; Rubio, I.; Labarga, A.; Zandio, B.; Roldán, M.; Martínez-Cascales, J.; Mayor, S.; Herrera, M. Circular RNA expression profile in blood according to ischemic stroke etiology. Cell Biosci. 2020, 10, 34. [Google Scholar] [CrossRef]
- Dong, R.; Ma, X.-K.; Chen, L.-L.; Yang, L. Increased complexity of circRNA expression during species evolution. RNA Biol. 2017, 14, 1064–1074. [Google Scholar] [CrossRef]
- Nicolet, B.P.; Engels, S.; Aglialoro, F.; van den Akker, E.; von Lindern, M.; Wolkers, M.C. Circular RNA expression in human hematopoietic cells is widespread and cell-type specific. Nucleic Acids Res. 2018, 46, 8168–8180. [Google Scholar] [CrossRef] [PubMed]
- Salzman, J. Circular RNA expression: Its potential regulation and function. Trends Genet. 2016, 32, 309–316. [Google Scholar] [CrossRef] [PubMed]
- Memczak, S.; Jens, M.; Elefsinioti, A.; Torti, F.; Krueger, J.; Rybak, A.; Maier, L.; Mackowiak, S.D.; Gregersen, L.H.; Munschauer, M. Circular RNAs are a large class of animal RNAs with regulatory potency. Nature 2013, 495, 333–338. [Google Scholar] [CrossRef] [PubMed]
- Pamudurti, N.R.; Bartok, O.; Jens, M.; Ashwal-Fluss, R.; Stottmeister, C.; Ruhe, L.; Hanan, M.; Wyler, E.; Perez-Hernandez, D.; Ramberger, E. Translation of circRNAs. Mol. Cell 2017, 66, 9–21.e27. [Google Scholar] [CrossRef] [PubMed]
- Fu, L.; Jiang, Z.; Li, T.; Hu, Y.; Guo, J. Circular RNA s in hepatocellular carcinoma: Functions and implications. Cancer Med. 2018, 7, 3101–3109. [Google Scholar] [CrossRef] [PubMed]
- Kroesen, V.M.; Madacki, J.; Frigui, W.; Sayes, F.; Brosch, R. Mycobacterial virulence: Impact on immunogenicity and vaccine research. F1000Research 2019, 8. [Google Scholar] [CrossRef] [PubMed]
- Coscolla, M.; Gagneux, S. Consequences of genomic diversity in Mycobacterium tuberculosis. In Proceedings of Seminars in Immunology; Academic Press: Cambridge, MA, USA, 2014; pp. 431–444. [Google Scholar]
- Gagneux, S.; Small, P.M. Global phylogeography of Mycobacterium tuberculosis and implications for tuberculosis product development. Lancet Infect. Dis. 2007, 7, 328–337. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Xu, H.; Wei, Z.; Jia, Y.; Wu, Y.; Qi, X.; Li, Y.; Gao, X. The role of non-coding RNA on macrophage modification in tuberculosis infection. Microb. Pathog. 2020, 149, 104592. [Google Scholar] [CrossRef]
- Zhao, Z.; Song, J.; Tang, B.; Fang, S.; Zhang, D.; Zheng, L.; Wu, F.; Gao, Y.; Chen, C.; Hu, X.; et al. CircSOD2 induced epigenetic alteration drives hepatocellular carcinoma progression through activating JAK2/STAT3 signaling pathway. J. Exp. Clin. Cancer Res. 2020, 39, 259. [Google Scholar] [CrossRef]
- Liu, Y.; Chang, Y.; Cai, Y. circTNFRSF21, a newly identified circular RNA promotes endometrial carcinoma pathogenesis through regulating miR-1227-MAPK13/ATF2 axis. Aging 2020, 12, 6774. [Google Scholar] [CrossRef]
- Lu, Q.; Yin, H.; Deng, Y.; Chen, W.; Diao, W.; Ding, M.; Cao, W.; Fu, Y.; Mo, W.; Chen, X. circDHTKD1 promotes lymphatic metastasis of bladder cancer by upregulating CXCL5. Cell Death Discov. 2022, 8, 243. [Google Scholar] [CrossRef] [PubMed]
- Lin, M.; Liu, M.; Han, X.; Tao, X.; Tang, Z.; Ma, Q. The role of differentially expressed miR-660 in peripheral blood lymphocytes of patients with pulmonary tuberculosis. Biomarkers 2023, 28, 409–415. [Google Scholar] [CrossRef] [PubMed]
- Martínez-Barricarte, R.; Markle, J.G.; Ma, C.S.; Deenick, E.K.; Ramírez-Alejo, N.; Mele, F.; Latorre, D.; Mahdaviani, S.A.; Aytekin, C.; Mansouri, D. Human IFN-γ immunity to mycobacteria is governed by both IL-12 and IL-23. Sci. Immunol. 2018, 3, eaau6759. [Google Scholar] [CrossRef] [PubMed]
- Cervantes, J.L. MyD88 in Mycobacterium tuberculosis infection. Med. Microbiol. Immunol. 2017, 206, 187–193. [Google Scholar] [CrossRef] [PubMed]
- Tateosian, N.L.; Pellegrini, J.M.; Amiano, N.O.; Rolandelli, A.; Casco, N.; Palmero, D.J.; Colombo, M.I.; García, V.E. IL17A augments autophagy in Mycobacterium tuberculosis-infected monocytes from patients with active tuberculosis in association with the severity of the disease. Autophagy 2017, 13, 1191–1204. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Chao, Y.; Deng, Q.; Liu, T.; Xiang, J.; Chen, J.; Zhou, J.; Zhan, Z.; Kuang, Y.; Cai, H. Potential challenges to the Stop TB Plan for humans in China; cattle maintain M. bovis and M. tuberculosis. Tuberculosis 2009, 89, 95–100. [Google Scholar] [CrossRef] [PubMed]
- Xiong, X.; Wang, R.; Deng, D.; Chen, Y.; Liu, H.; Wang, T.; Wang, J.; Zhu, X.; Zhu, X.; Zhu, Y.; et al. Comparative Genomics of a Bovine Mycobacterium tuberculosis Isolate and Other Strains Reveals Its Potential Mechanism of Bovine Adaptation. Front. Microbiol. 2017, 8, 2500. [Google Scholar] [CrossRef]
- Zhu, Y.; Xiao, Y.; Kong, D.; Liu, H.; Chen, X.; Chen, Y.; Zhu, T.; Peng, Y.; Zhai, W.; Hu, C. Down-regulation of miR-378d increased Rab10 expression to help clearance of Mycobacterium tuberculosis in macrophages. Front. Cell. Infect. Microbiol. 2020, 10, 108. [Google Scholar] [CrossRef]
- Langmead, B.; Salzberg, S.L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 2012, 9, 357–359. [Google Scholar] [CrossRef]
- Li, B.; Dewey, C.N. RSEM: Accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinform. 2011, 12, 323. [Google Scholar] [CrossRef]
- Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef] [PubMed]
- Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 2013, 29, 15–21. [Google Scholar] [CrossRef]
- Cheng, J.; Metge, F.; Dieterich, C. Specific identification and quantification of circular RNAs from sequencing data. Bioinformatics 2015, 32, 1094–1096. [Google Scholar] [CrossRef] [PubMed]
- Yu, G.; Wang, L.-G.; Han, Y.; He, Q.-Y. clusterProfiler: An R package for comparing biological themes among gene clusters. Omics A J. Integr. Biol. 2012, 16, 284–287. [Google Scholar] [CrossRef] [PubMed]
- Gu, Z.; Gu, L.; Eils, R.; Schlesner, M.; Brors, B. Circlize implements and enhances circular visualization in R. Bioinformatics 2014, 30, 2811–2812. [Google Scholar] [CrossRef]
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing; R Core Team: Vienna, Austria, 2021. [Google Scholar]
- Ren, Y.; Qiu, L.; Lü, F.; Ru, X.; Li, S.; Xiang, Y.; Yu, S.; Zhang, Y. TALENs-directed knockout of the full-length transcription factor Nrf1α that represses malignant behaviour of human hepatocellular carcinoma (HepG2) cells. Sci. Rep. 2016, 6, 23775. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- De Hoon, M.J.; Imoto, S.; Nolan, J.; Miyano, S. Open source clustering software. Bioinformatics 2004, 20, 1453–1454. [Google Scholar] [CrossRef]
- Allaire, J.; Ellis, P.; Gandrud, C.; Kuo, K.; Lewis, B.; Owen, J.; Russell, K.; Rogers, J.; Sese, C.; Yetman, C. Package ‘networkD3’. D3 JavaScript Network Graphs from R. 2017. Available online: https://cran.r-project.org/package=networkD3 (accessed on 20 April 2022).
Primer Names | Sequences (5′–3′) | Products (bp) |
---|---|---|
hsa-β-actin | F: CATGTACGTTGCTATCCAGGC R: CTCCTTAATGTCACGCACGAT | 250 |
hsa-NEAT1 | F: AAACGCTGGGAGGGTACAAG R: ATGCCCAAACTAGACCTGCC | 71 |
hsa-GAPDH | F: AATGGGCAGCCGTTAGGAAA R: GCCCAATACGACCAAATCAGAG | 166 |
hsa-circCHSY1- Divergent | F: AAGGTGTGTCCGGAGGTTTG R: TGGCACTACTGGAATTGGTACA | 134 |
hsa-circCHSY1- Convergent | F: TGCACGACCACTACTTGGAC R: GCCTGTCTGCCCAAGAAAGA | 134 |
hsa-circSOD2- Divergent | F: AATGTAATCAACTGGGAGAATG R: GGCTGTAACATCTCTCAGCATA | 87 |
hsa-circSOD2- Convergent | F: CTGGAAGCCATCAAACGTGAC R: AACCTGAGCCTTGGACACC | 88 |
hsa-circTNFRSF21- Divergent | F: TACTGCAATGGCCATGCTTG R: TTCCTGCTGGACACTTGTCA | 140 |
hsa-circTNFRSF21- Convergent | F: CTGCCTTGACTGACCGAGAA R: ACACTGCTTACACCGCACAT | 143 |
hsa-circDHTKD1- Divergent | F: CGTGGTCGTTTGTTTCTCCA R: TGGCAGCTTTATGACCATGC | 107 |
hsa-circDHTKD1- Convergent | F: TGCTTACAGGTCCATGGTGA R: ATGCACACTCCCACCAATTC | 105 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhu, Y.; Kong, D.; Wang, Z.; Li, T.; Tang, T.; Peng, Y.; Hu, C.; Chao, J.; Chen, H.; Chen, Y.; et al. Identification of Differential Circular RNA Expression Profiles and Functional Networks in Human Macrophages Induced by Virulent and Avirulent Mycobacterium tuberculosis Strains. Int. J. Mol. Sci. 2023, 24, 17561. https://doi.org/10.3390/ijms242417561
Zhu Y, Kong D, Wang Z, Li T, Tang T, Peng Y, Hu C, Chao J, Chen H, Chen Y, et al. Identification of Differential Circular RNA Expression Profiles and Functional Networks in Human Macrophages Induced by Virulent and Avirulent Mycobacterium tuberculosis Strains. International Journal of Molecular Sciences. 2023; 24(24):17561. https://doi.org/10.3390/ijms242417561
Chicago/Turabian StyleZhu, Yifan, Delai Kong, Zijian Wang, Ting Li, Tian Tang, Yongchong Peng, Changmin Hu, Jin Chao, Huanchun Chen, Yingyu Chen, and et al. 2023. "Identification of Differential Circular RNA Expression Profiles and Functional Networks in Human Macrophages Induced by Virulent and Avirulent Mycobacterium tuberculosis Strains" International Journal of Molecular Sciences 24, no. 24: 17561. https://doi.org/10.3390/ijms242417561
APA StyleZhu, Y., Kong, D., Wang, Z., Li, T., Tang, T., Peng, Y., Hu, C., Chao, J., Chen, H., Chen, Y., & Guo, A. (2023). Identification of Differential Circular RNA Expression Profiles and Functional Networks in Human Macrophages Induced by Virulent and Avirulent Mycobacterium tuberculosis Strains. International Journal of Molecular Sciences, 24(24), 17561. https://doi.org/10.3390/ijms242417561