Transcriptomic Analyses Reveal the Role of Cytokinin and the Nodal Stem in Microtuber Sprouting in Potato (Solanum tuberosum L.)
Abstract
:1. Introduction
2. Results
2.1. Microtuber Sprouting in Response to Phytohormone Treatment
2.2. Transcriptome Sequencing and De Novo Assembly
2.3. Differential Transcriptome Response to Exogenous Hormone Treatments
2.4. Cytokinin- and Auxin-Activated Signaling Are Involved in Microtuber Sprouting
2.5. The Effect of GA on Microtuber Sprouting in the Absence of the Nodal Stem
2.6. The Effect of the Nodal Stem on GA-Induced Microtuber Sprouting
2.7. The Effect of CK on Microtuber Sprouting
2.8. Weighted Gene Co-Expressed Gene Network Analysis (WGCNA)
2.9. Correlations of RT-qPCR and RNA-Seq Datasets
3. Discussion
3.1. Microtuber Sprouting in Response to Phytohormone Treatment
3.2. Regulation of the Phytohormone Signaling Response to Microtuber Sprouting
3.3. Regulation of the Cytokinin Homeostasis Response to Sprouting Growth
4. Materials and Methods
4.1. Plant Materials and Culture Conditions
4.2. Sample Preparation for RNA Extraction and Sequencing
4.3. TPM Value Calculation and Differential Expression
4.4. Module Construction Using WGCNA
4.5. Quantitative Analysis of Candidate Genes Involved in Potato Microtuber Sprouting
4.6. Quantification and Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
References
- Jefferies, R.A.; Mackerron, D.K.L. Effect of second growth on the quality of tubers as seed in the cultivar Record. Potato Res. 1987, 30, 337–340. [Google Scholar] [CrossRef]
- Hemberg, T. Potato rest. In Potato Physiology; Elsevier: Amsterdam, The Netherlands, 1985; pp. 353–388. [Google Scholar]
- Suttle, J.C. Dormancy and sprouting. In Potato Biology and Biotechnology; Elsevier: Amsterdam, The Netherlands, 2007; pp. 287–309. [Google Scholar]
- Rappaport, L. Growth regulating metabolites: Gibberellin compounds derived from rice disease-producing fungus exhibit powerful plant growth regulating properties. Calif. Agric. 1956, 10, 4–11. [Google Scholar]
- Destefano-Beltrán, L.; Knauber, D.; Huckle, L.; Suttle, J.C. Effects of postharvest storage and dormancy status on ABA content, metabolism, and expression of genes involved in ABA biosynthesis and metabolism in potato tuber tissues. Plant Mol. Biol. 2006, 61, 687–697. [Google Scholar] [CrossRef]
- Haider, M.W.; Nafeesa, M.; Amina, M.; Asadb, H.U.; Ahmad, I. Physiology of tuber dormancy and its mechanism of release in potato. J. Hortic. Sci. Technol. 2021, 4, 13–21. [Google Scholar] [CrossRef]
- Suttle, J.C. Physiological regulation of potato tuber dormancy. Am. J. Potato Res. 2004, 81, 253–262. [Google Scholar] [CrossRef]
- Turnbull, C.G.N.; Hanke, D.E. The control of bud dormancy in potato tubers. Planta 1985, 165, 359–365. [Google Scholar] [CrossRef]
- Burton, W.G. The Potato, 3rd ed.; Longman Scientific & Technical: New York, NY, USA, 1989. [Google Scholar]
- Sonnewald, S.; Sonnewald, U. Regulation of potato tuber sprouting. Planta 2014, 239, 27–38. [Google Scholar] [CrossRef] [PubMed]
- Dai, H.; Fu, M.; Yang, X.; Chen, Q. Ethylene inhibited sprouting of potato tubers by influencing the carbohydrate metabolism pathway. J. Food Sci. Technol. 2016, 53, 3166–3174. [Google Scholar] [CrossRef] [PubMed]
- Claassens, M.M.; Vreugdenhil, D. Is dormancy breaking of potato tubers the reverse of tuber initiation? Potato Res. 2000, 43, 347–369. [Google Scholar] [CrossRef]
- Wang, K.; Zhang, N.; Fu, X.; Zhang, H.; Liu, S.; Pu, X.; Wang, X.; Si, H. StTCP15 regulates potato tuber sprouting by modulating the dynamic balance between abscisic acid and gibberellic acid. Front. Plant Sci. 2022, 13, 1009552. [Google Scholar] [CrossRef] [PubMed]
- Kumar, G.N.M.; Knowles, N.R. Involvement of auxin in the loss of apical dominance and plant growth potential accompanying aging of potato seed tubers. Can. J. Bot. 1993, 71, 541–550. [Google Scholar] [CrossRef]
- Suttle, J.C. Auxin-induced sprout growth inhibition: Role of endogenous ethylene. Am. J. Potato Res. 2003, 80, 303–309. [Google Scholar] [CrossRef]
- Sorce, C.; Lombardi, L.; Giorgetti, L.; Parisi, B.; Ranalli, P.; Lorenzi, R. Indoleacetic acid concentration and metabolism changes during bud development in tubers of two potato (Solanum tuberosum) cultivars. J. Plant Physiol. 2009, 166, 1023–1033. [Google Scholar] [CrossRef]
- Sachs, T.; Thimann, K.V. The Role of Auxins and Cytokinins in the Release of Buds from Dominance. Am. J. Bot. 1967, 54, 136–144. [Google Scholar] [CrossRef]
- Dun, E.A.; de Saint Germain, A.; Rameau, C.; Beveridge, C.A. Antagonistic action of strigolactone and cytokinin in bud outgrowth control. Plant Physiol. 2012, 158, 487–498. [Google Scholar] [CrossRef] [PubMed]
- Alamar, M.C.; Tosetti, R.; Landahl, S.; Bermejo, A.; Terry, L.A. Assuring Potato Tuber Quality during Storage: A Future Perspective. Front. Plant Sci. 2017, 8, 2034. [Google Scholar] [CrossRef] [PubMed]
- Francis, D.; Sorrell, D.A. The interface between the cell cycle and plant growth regulators: A mini review. Plant Growth Regul. 2001, 33, 1–12. [Google Scholar] [CrossRef]
- Suttle, J.C. Involvement of endogenous gibberellins in potato tuber dormancy and early sprout growth: A critical assessment. J. Plant Physiol. 2004, 161, 157–164. [Google Scholar] [CrossRef] [PubMed]
- Hemberg, T. The action of some cytokinins on the rest-period and the content of acid growth-inhibiting substances in potato. Physiol. Plant. 1970, 23, 850–858. [Google Scholar] [CrossRef]
- Siregar, L.A.M.; Turnip, L.; Damanik, I.R. Immersion in 6-Benzylaminopurine for Dormancy Release and Initiation of Potato Sprouts at Various Tuber Weight and Storage Duration. Indones. J. Agron. 2021, 49, 60–67. [Google Scholar] [CrossRef]
- Kolachevskaya, O.O.; Lomin, S.N.; Arkhipov, D.V.; Romanov, G.A. Auxins in potato: Molecular aspects and emerging roles in tuber formation and stress resistance. Plant Cell Rep. 2019, 38, 681–698. [Google Scholar] [CrossRef]
- Hartmann, A.; Senning, M.; Hedden, P.; Sonnewald, U.; Sonnewald, S. Reactivation of meristem activity and sprout growth in potato tubers require both cytokinin and gibberellin. Plant Physiol. 2011, 155, 776–796. [Google Scholar] [CrossRef] [PubMed]
- Ramawat, K.G.; Merillon, J.-M. Hormonal regulation of tuber formation in potato. In Bulbous Plants: Biotechnology; CRC Press: Boca Raton, FL, USA, 2013. [Google Scholar]
- Gixhari, B. In vitro micropropagation of potato (Solanum tuberosum L.). cultivars. Poljopr. Sumar. 2018, 64, 105. [Google Scholar]
- Ewing, E.E. Cuttings as simplified models of the potato plant. Potato Physiol. 1985, 33, 153–207. [Google Scholar]
- Tovar, P. Induction and use of in vitro potato tubers. CIP Circ. 1985, 13, 1–5. [Google Scholar]
- Nuraini, A.; Mubarok, S.; Hamdani, J. Effects of application time and concentration of paclobutrazol on the growth and yield of potato seed of G2 cultivar medians at medium altitude. J. Agron. 2018, 17, 169–173. [Google Scholar] [CrossRef]
- Kolachevskaya, O.; Lomin, S.N.; Kojima, M.; Getman, I.A.; Sergeeva, L.; Sakakibara, H.; Romanov, G. Tuber-specific expression of two gibberellin oxidase transgenes from Arabidopsis regulates over wide ranges the potato tuber formation. Russ. J. Plant Physiol. 2019, 66, 984–991. [Google Scholar] [CrossRef]
- Stark, R.; Grzelak, M.; Hadfield, J. RNA sequencing: The teenage years. Nat. Rev. Genet. 2019, 20, 631–656. [Google Scholar] [CrossRef]
- Sharma, S.K.; Bolser, D.; de Boer, J.; Sønderkær, M.; Amoros, W.; Carboni, M.F.; D’Ambrosio, J.M.; de la Cruz, G.; Di Genova, A.; Douches, D.S.; et al. Construction of Reference Chromosome-Scale Pseudomolecules for Potato: Integrating the Potato Ge-nome with Genetic and Physical Maps. G3 Genes Genomes Genet. 2013, 3, 2031–2047. [Google Scholar] [CrossRef]
- Xu, X.; Pan, S.; Cheng, S.; Zhang, B.; Mu, D.; Ni, P.; Zhang, G.; Yang, S.; Li, R.; Wang, J.; et al. Genome sequence and analysis of the tuber crop potato. Nature 2011, 475, 189–195. [Google Scholar]
- Woolley, D.; Wareing, P. The interaction between growth promoters in apical dominance. New Phytol. 1972, 71, 781–793. [Google Scholar] [CrossRef]
- Natarajan, B.; Kalsi, H.S.; Godbole, P.; Malankar, N.; Thiagarayaselvam, A.; Siddappa, S.; Thulasiram, H.V.; Chakrabarti, S.K.; Banerjee, A.K. MiRNA160 is associated with local defense and systemic acquired resistance against Phytophthora infestans infection in potato. J. Exp. Bot. 2018, 69, 2023–2036. [Google Scholar] [CrossRef]
- Tanaka, M.; Takei, K.; Kojima, M.; Sakakibara, H.; Mori, H. Auxin controls local cytokinin biosynthesis in the nodal stem in apical dominance. Plant J. 2006, 45, 1028–1036. [Google Scholar] [CrossRef] [PubMed]
- Barbier, F.; Péron, T.; Lecerf, M.; Perez-Garcia, M.D.; Barrière, Q.; Rolčík, J.; Boutet-Mercey, S.; Citerne, S.; Lemoine, R.; Porcheron, B.; et al. Sucrose is an early modulator of the key hormonal mechanisms controlling bud outgrowth in Rosa hybrida. J. Exp. Bot. 2015, 66, 2569–2582. [Google Scholar] [CrossRef]
- Salam, B.B.; Barbier, F.; Danieli, R.; Teper-Bamnolker, P.; Ziv, C.; Spíchal, L.; Aruchamy, K.; Shnaider, Y.; Leibman, D.; Shaya, F.; et al. Sucrose promotes stem branching through cytokinin. Plant Physiol. 2021, 185, 1708–1721. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.; Vreugdenhil, D.; Lammeren, A.A.M.v. Cell division and cell enlargement during potato tuber formation. J. Exp. Bot. 1998, 49, 573–582. [Google Scholar] [CrossRef]
- Suttle, J.C. Effects of Synthetic Phenylurea and Nitroguanidine Cytokinins on Dormancy Break and Sprout Growth in Russet Burbank Minitubers. Am. J. Potato Res. 2008, 85, 121–128. [Google Scholar] [CrossRef]
- Zhuang, L.; Ge, Y.; Wang, J.; Yu, J.; Yang, Z.; Huang, B. Gibberellic acid inhibition of tillering in tall fescue involving crosstalks with cytokinins and transcriptional regulation of genes controlling axillary bud outgrowth. Plant Sci. 2019, 287, 110168. [Google Scholar] [CrossRef]
- Kolachevskaya, O.O.; Sergeeva, L.I.; Floková, K.; Getman, I.A.; Lomin, S.N.; Alekseeva, V.V.; Rukavtsova, E.B.; Buryanov, Y.I.; Romanov, G.A. Auxin synthesis gene tms1 driven by tuber-specific promoter alters hormonal status of transgenic potato plants and their responses to exogenous phytohormones. Plant Cell Rep. 2017, 36, 419–435. [Google Scholar] [CrossRef]
- Takei, K.; Sakakibara, H.; Sugiyama, T. Identification of genes encoding adenylate isopentenyltransferase, a cytokinin biosynthesis enzyme, in Arabidopsis thaliana. J. Biol. Chem. 2001, 276, 26405–26410. [Google Scholar] [CrossRef]
- Gao, J.; Cao, X.; Shi, S.; Ma, Y.; Wang, K.; Liu, S.; Chen, D.; Chen, Q.; Ma, H. Genome-wide survey of Aux/IAA gene family members in potato (Solanum tuberosum): Identification, expression analysis, and evaluation of their roles in tuber development. Biochem. Biophys. Res. Commun. 2016, 471, 320–327. [Google Scholar] [CrossRef] [PubMed]
- Buskila, Y.; Sela, N.; Teper-Bamnolker, P.; Tal, I.; Shani, E.; Weinstain, R.; Gaba, V.; Tam, Y.; Lers, A.; Eshel, D. Stronger sink demand for metabolites supports dominance of the apical bud in etiolated growth. J. Exp. Bot. 2016, 67, 5495–5508. [Google Scholar] [CrossRef] [PubMed]
- Zhao, H.; Nie, K.; Zhou, H.; Yan, X.; Zhan, Q.; Zheng, Y.; Song, C.P. ABI5 modulates seed germination via feedback regulation of the expression of the PYR/PYL/RCAR ABA receptor genes. New Phytol. 2020, 228, 596–608. [Google Scholar] [CrossRef] [PubMed]
- Tuan, P.A.; Kumar, R.; Rehal, P.K.; Toora, P.K.; Ayele, B.T. Molecular Mechanisms Underlying Abscisic Acid/Gibberellin Balance in the Control of Seed Dormancy and Germination in Cereals. Front. Plant Sci. 2018, 9, 668. [Google Scholar] [CrossRef] [PubMed]
- Née, G.; Kramer, K.; Nakabayashi, K.; Yuan, B.; Xiang, Y.; Miatton, E.; Finkemeier, I.; Soppe, W.J.J. Delay of germination1 requires PP2C phosphatases of the ABA signalling pathway to control seed dormancy. Nat. Commun. 2017, 8, 72. [Google Scholar] [CrossRef] [PubMed]
- Soma, F.; Takahashi, F.; Suzuki, T.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Plant Raf-like kinases regulate the mRNA population upstream of ABA-unresponsive SnRK2 kinases under drought stress. Nat. Commun. 2020, 11, 1373. [Google Scholar] [CrossRef] [PubMed]
- Park, S.Y.; Fung, P.; Nishimura, N.; Jensen, D.R.; Fujii, H.; Zhao, Y.; Lumba, S.; Santiago, J.; Rodrigues, A.; Chow, T.F.; et al. Abscisic acid inhibits type 2C protein phosphatases via the PYR/PYL family of START proteins. Science 2009, 324, 1068–1071. [Google Scholar] [CrossRef]
- Biemelt, S.; Hajirezaei, M.; Hentschel, E.; Sonnewald, U. Comparative analysis of abscisic acid content and starch degradation during storage of tubers harvested from different potato varieties. Potato Res. 2000, 43, 371–382. [Google Scholar] [CrossRef]
- Finch-Savage, W.E.; Leubner-Metzger, G. Seed dormancy and the control of germination. New Phytol. 2006, 171, 501–523. [Google Scholar] [CrossRef]
- Nishimura, N.; Yoshida, T.; Kitahata, N.; Asami, T.; Shinozaki, K.; Hirayama, T. ABA-Hypersensitive Germination1 encodes a protein phosphatase 2C, an essential component of abscisic acid signaling in Arabidopsis seed. Plant J. 2007, 50, 935–949. [Google Scholar] [CrossRef]
- Skalický, V.; Kubeš, M.; Napier, R.; Novák, O. Auxins and Cytokinins-The Role of Subcellular Organization on Homeostasis. Int. J. Mol. Sci. 2018, 19, 3115. [Google Scholar] [CrossRef] [PubMed]
- Takei, K.; Yamaya, T.; Sakakibara, H. Arabidopsis CYP735A1 and CYP735A2 encode cytokinin hydroxylases that catalyze the biosynthesis of trans-Zeatin. J. Biol. Chem. 2004, 279, 41866–41872. [Google Scholar] [CrossRef]
- Lomin, S.N.; Myakushina, Y.A.; Kolachevskaya, O.O.; Getman, I.A.; Savelieva, E.M.; Arkhipov, D.V.; Deigraf, S.V.; Romanov, G.A. Global View on the Cytokinin Regulatory System in Potato. Front. Plant Sci. 2020, 11, 613624. [Google Scholar] [CrossRef]
- Gajdosová, S.; Spíchal, L.; Kamínek, M.; Hoyerová, K.; Novák, O.; Dobrev, P.I.; Galuszka, P.; Klíma, P.; Gaudinová, A.; Zizková, E.; et al. Distribution, biological activities, metabolism, and the conceivable function of cis-zeatin-type cytokinins in plants. J. Exp. Bot. 2011, 62, 2827–2840. [Google Scholar] [CrossRef]
- Wang, X.; Lin, S.; Liu, D.; Gan, L.; McAvoy, R.; Ding, J.; Li, Y. Evolution and roles of cytokinin genes in angiosperms 1: Do ancient IPTs play housekeeping while non-ancient IPTs play regulatory roles? Hortic. Res. 2020, 7, 28. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Ma, X.M.; Kojima, M.; Sakakibara, H.; Hou, B.K. N-glucosyltransferase UGT76C2 is involved in cytokinin homeostasis and cytokinin response in Arabidopsis thaliana. Plant Cell Physiol. 2011, 52, 2200–2213. [Google Scholar] [CrossRef] [PubMed]
- Šmehilová, M.; Dobrůšková, J.; Novák, O.; Takáč, T.; Galuszka, P. Cytokinin-Specific Glycosyltransferases Possess Different Roles in Cytokinin Homeostasis Maintenance. Front. Plant Sci. 2016, 7, 1264. [Google Scholar] [CrossRef]
- Martin, R.C.; Mok, M.C.; Habben, J.E.; Mok, D.W. A maize cytokinin gene encoding an O-glucosyltransferase specific to cis-zeatin. Proc. Natl. Acad. Sci. USA 2001, 98, 5922–5926. [Google Scholar] [CrossRef] [PubMed]
- Suttle, J.C.; Banowetz, G. Changes in cis-zeatin and cis-zeatin riboside levels and biological activity during potato tuber dormancy. Physiol. Plant. 2000, 109, 68–74. [Google Scholar] [CrossRef]
- Werner, T.; Köllmer, I.; Bartrina, I.; Holst, K.; Schmülling, T. New insights into the biology of cytokinin degradation. Plant Biol. 2006, 8, 371–381. [Google Scholar] [CrossRef] [PubMed]
- Murashige, T.; Skoog, F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol. Plant. 1962, 15, 473–497. [Google Scholar] [CrossRef]
- Vennapusa, A.R.; Somayanda, I.M.; Doherty, C.J.; Jagadish, S.V.K. A universal method for high-quality RNA extraction from plant tissues rich in starch, proteins and fiber. Sci. Rep. 2020, 10, 16887. [Google Scholar] [CrossRef] [PubMed]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef]
- Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet J. 2011, 17, 10–12. [Google Scholar] [CrossRef]
- Kim, D.; Paggi, J.M.; Park, C.; Bennett, C.; Salzberg, S.L. Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat. Biotechnol. 2019, 37, 907–915. [Google Scholar] [CrossRef] [PubMed]
- Shumate, A.; Wong, B.; Pertea, G.; Pertea, M. Improved transcriptome assembly using a hybrid of long and short reads with StringTie. PLoS Comput. Biol. 2022, 18, e1009730. [Google Scholar] [CrossRef] [PubMed]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
- Raudvere, U.; Kolberg, L.; Kuzmin, I.; Arak, T.; Adler, P.; Peterson, H.; Vilo, J. g:Profiler: A web server for functional enrichment analysis and conversions of gene lists (2019 update). Nucleic Acids Res. 2019, 47, W191–W198. [Google Scholar] [CrossRef]
- Sherman, B.T.; Hao, M.; Qiu, J.; Jiao, X.; Baseler, M.W.; Lane, H.C.; Imamichi, T.; Chang, W. DAVID: A web server for functional enrichment analysis and functional annotation of gene lists (2021 update). Nucleic Acids Res. 2022, 50, W216–W221. [Google Scholar] [CrossRef] [PubMed]
- Wu, T.; Hu, E.; Xu, S.; Chen, M.; Guo, P.; Dai, Z.; Feng, T.; Zhou, L.; Tang, W.; Zhan, L. clusterProfiler 4.0: A universal enrichment tool for interpreting omics data. Innovation 2021, 2, 100141. [Google Scholar] [CrossRef]
- Langfelder, P.; Horvath, S. WGCNA: An R package for weighted correlation network analysis. BMC Bioinform. 2008, 9, 559. [Google Scholar] [CrossRef] [PubMed]
- Bindea, G.; Galon, J.; Mlecnik, B. CluePedia Cytoscape plugin: Pathway insights using integrated experimental and in silico data. Bioinformatics 2013, 29, 661–663. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Sample Name * | Clean Reads | Mapped Reads (%) | GC Content (%) | Q30 Bases Rate (%) |
---|---|---|---|---|
3-stMT-bd-Con_1 | 43,681,568 | 86.01 | 43.23 | 92.36 |
3-stMT-bd-Con_2 | 41,043,396 | 84.96 | 42.71 | 92.84 |
3-stMT-bd-Con_3 | 42,184,662 | 86.44 | 42.60 | 92.70 |
3-stMT-bd-GA_1 | 48,289,086 | 86.39 | 43.16 | 92.62 |
3-stMT-bd-GA_2 | 53,701,594 | 87.57 | 43.57 | 92.29 |
3-stMT-bd-GA_3 | 48,581,534 | 86.63 | 43.00 | 92.91 |
3-stMT-bd-CK_1 | 39,696,672 | 86.79 | 42.60 | 93.58 |
3-stMT-bd-CK_2 | 55,057,060 | 86.93 | 42.78 | 93.03 |
3-stMT-bd-CK_3 | 48,249,408 | 86.56 | 42.73 | 93.34 |
3-stMT-bd-GACK_1 | 54,286,264 | 86.61 | 43.15 | 92.98 |
3-stMT-bd-GACK_2 | 45,950,936 | 87.25 | 43.07 | 92.92 |
3-stMT-bd-GACK_3 | 45,743,028 | 87.76 | 43.44 | 93.39 |
3-stMT-st-Con_1 | 45,423,060 | 86.01 | 42.85 | 92.27 |
3-stMT-st-Con_2 | 53,654,956 | 84.96 | 42.91 | 93.00 |
3-stMT-st-Con_3 | 59,954,606 | 86.44 | 43.64 | 92.27 |
3-stMT-st-GA_1 | 53,629,136 | 86.39 | 43.25 | 92.78 |
3-stMT-st-GA_2 | 55,193,846 | 87.57 | 43.38 | 92.85 |
3-stMT-st-GA_3 | 49,795,808 | 86.63 | 43.49 | 92.97 |
3-stMT-st-CK_1 | 53,347,826 | 86.79 | 43.45 | 93.14 |
3-stMT-st-CK_2 | 54,308,396 | 86.93 | 43.13 | 93.25 |
3-stMT-st-CK_3 | 46,884,960 | 86.56 | 43.44 | 92.96 |
3-stMT-st-GACK_1 | 48,972,376 | 86.61 | 43.51 | 93.15 |
3-stMT-st-GACK_2 | 40,544,512 | 87.25 | 43.62 | 93.36 |
3-stMT-st-GACK_3 | 49,480,050 | 87.76 | 42.75 | 92.91 |
3-hMT-bd-Con_1 | 43,157,574 | 85.59 | 42.17 | 92.56 |
3-hMT-bd-Con_2 | 56,598,482 | 85.63 | 42.18 | 92.53 |
3-hMT-bd-Con_3 | 47,043,018 | 85.65 | 43.27 | 92.74 |
3-hMT-bd-GA_1 | 55,008,322 | 86.01 | 42.75 | 92.95 |
3-hMT-bd-GA_2 | 52,098,892 | 84.96 | 42.16 | 92.83 |
3-hMT-bd-GA_3 | 40,728,744 | 86.44 | 42.85 | 92.77 |
3-hMT-bd-CK_1 | 43,493,506 | 86.39 | 42.91 | 93.17 |
3-hMT-bd-CK_2 | 54,588,608 | 87.57 | 42.61 | 93.49 |
3-hMT-bd-CK_3 | 49,590,678 | 86.63 | 42.75 | 93.62 |
3-hMT-bd-GACK_1 | 44,376,982 | 86.79 | 42.82 | 93.23 |
3-hMT-bd-GACK_2 | 50,462,110 | 86.93 | 43.24 | 93.33 |
3-hMT-bd-GACK_3 | 46,772,868 | 86.56 | 43.83 | 93.27 |
Gene ID PGSC0003DMG- | Primer | Primer Sequence (5′ → 3′) | Length of Oligonucleotides/bp |
---|---|---|---|
α-tubulin | α-Tub-rt-Fd1 | CAACAAGTGTTGCTGAGGTCT | 21 |
α-Tub-rt-Rv1 | CAGCCTACATCATTGCTCAGT | 21 | |
402022640 | RR4-Fd2 | CCAACTCTTTCACCTTCACCA | 21 |
RR4-Rv1 | TGGCTGATCATTTTGAGTCG | 20 | |
400003084 | RR9c-Fd2 | TGTTTGGAAGAAGGAGCTGAA | 21 |
RR9c-Rv1 | CAAATGTTCTGCAAAAAGATGC | 22 | |
400028331 | CISZOG-Fd2 | TTCGGGATGGAACTCTTTTCT | 21 |
CISZOG-Rv2 | TCCATCAATGTTCTCACACCA | 21 | |
400012669 | CYP735A-Fd1 | ATGAAACCACTGCCCTTTTG | 20 |
CYP735A-Rv2 | CCTCAAATGCCATTCTTGGT | 20 | |
400001614 | SAUR50-Fd1 | TTGGCTATACCTTGCGATGA | 20 |
SAUR50-Rv1 | CCCAGTAACGCTCGAGATTC | 20 | |
400001655 | SAUR71-Fd2 | TCACAATCTCCTGTTTTGAAGC | 22 |
SAUR71-Rv1 | GCCCATATCATGATCGAACC | 20 | |
400020139 | IAA15-Fd1 | ACCTGGAACAGAGCCATCAT | 20 |
IAA15-Rv1 | TTAAATAAGCCGCACCATCC | 20 | |
400011033 | PYL4-Fd1 | GACGGTGACGTCGGTACTTT | 20 |
PYL4-Rv2 | ATTCCACAACGATCGTCTCC | 20 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, X.; Fujino, K.; Shimura, H. Transcriptomic Analyses Reveal the Role of Cytokinin and the Nodal Stem in Microtuber Sprouting in Potato (Solanum tuberosum L.). Int. J. Mol. Sci. 2023, 24, 17534. https://doi.org/10.3390/ijms242417534
Zhang X, Fujino K, Shimura H. Transcriptomic Analyses Reveal the Role of Cytokinin and the Nodal Stem in Microtuber Sprouting in Potato (Solanum tuberosum L.). International Journal of Molecular Sciences. 2023; 24(24):17534. https://doi.org/10.3390/ijms242417534
Chicago/Turabian StyleZhang, Xia, Kaien Fujino, and Hanako Shimura. 2023. "Transcriptomic Analyses Reveal the Role of Cytokinin and the Nodal Stem in Microtuber Sprouting in Potato (Solanum tuberosum L.)" International Journal of Molecular Sciences 24, no. 24: 17534. https://doi.org/10.3390/ijms242417534
APA StyleZhang, X., Fujino, K., & Shimura, H. (2023). Transcriptomic Analyses Reveal the Role of Cytokinin and the Nodal Stem in Microtuber Sprouting in Potato (Solanum tuberosum L.). International Journal of Molecular Sciences, 24(24), 17534. https://doi.org/10.3390/ijms242417534