Genome-Wide Analysis of Sweet Potato Ammonium Transporter (AMT): Influence on Nitrogen Utilization, Storage Root Development and Yield
Abstract
1. Introduction
2. Results
2.1. Yield and Agronomic Traits at Harvest
2.2. Agronomic Traits at Canopy Closure
2.3. N Content
2.4. N Use Efficiencies
2.5. Genome-Wide Identification
2.6. Phylogenetic Analysis
2.7. Gene Structure and Motif Composition
2.8. Synteny Analysis
2.9. Analysis of Cis-Regulatory Elements
2.10. qRT-PCR Expression Analysis
2.11. Relationship between N Content and IbAMT1 Gene Expression
3. Discussion
3.1. Effect of N Uptake and Utilization on Growth, Development, and Yield
3.2. Relationship between AMT Gene Family and N Uptake and Utilization
4. Materials and Methods
4.1. Experimental Site and Plant Material
4.2. Field Experiments
4.3. Plant Sampling and Analysis
4.4. Total N Content
4.5. Calculations
4.6. Sweet Potato AMT Family Genes’ Identification and Analysis
4.7. Phylogenetic Analysis
4.8. Conserved Motifs, Gene Structures, and Chromosomal Distribution Analysis
4.9. Ka/Ks Analyses and Gene Collinearity
4.10. Cis-Regulatory Elements
4.11. qRT-PCR Analysis
4.12. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Ravi, V.; Saravanan, R. Fruit, Vegetable and Cereal Science and Biotechnology Crop Physiology of Sweetpotato. Fruit Veg. Cereal Sci. Biotechnol. 2012, 6, 17–29. [Google Scholar]
- Darko, C.; Yeboah, S.; Amoah, A.; Opoku, A.; Berchie, J.N. Productivity of sweet potato (Ipomoea batatas (L) Lam) as influenced by fertilizer application in different agro-ecologies in Ghana. Sci. Afr. 2020, 10, e00560. [Google Scholar] [CrossRef]
- Wu, C.-H.; Liu, Q.; Kong, F.-M.; Li, H.; Shi, Y.-X. Effects of Nitrogen Application Rates on Root Yield and Nitrogen Utilization in Different Purple Sweetpotato Varieties. Acta Agron. Sin. 2016, 42, 113–122. [Google Scholar] [CrossRef]
- Njoku, J.C.; Okpara, D.A.; Asiegbu, J.E. Growth and yield responses of sweet potato to inorganic nitrogen and potassium in a tropical ultisol. Niger. Agric. J. 2001, 32, 295–310. [Google Scholar] [CrossRef]
- Ning, Y.-W.; Ma, H.-B.; Zhang, H.; Wang, J.-D.; Xu, X.-J.; Zhang, Y.-C. Response of sweetpotato in source-sink relationship establishment, expanding, and balance to nitrogen application rates. Acta Agron. Sin. 2015, 41, 432–439. [Google Scholar] [CrossRef]
- Njiti, V.N.; Xia, Q.; Tyler, L.S.; Stewart, L.D.; Tenner, A.T.; Zhang, C.; Alipoe, D.; Chukwuma, F.; Gao, M. Influence of Prohexadione Calcium on Sweetpotato Growth and Storage Root Yield. HortScience Horts 2013, 48, 73–76. [Google Scholar] [CrossRef]
- Duan, W.; Zhang, H.; Xie, B.; Wang, B.; Hou, F.; Li, A.; Dong, S.; Qin, Z.; Wang, Q.; Zhang, L. Nitrogen utilization characteristics and early storage root development in nitrogen-tolerant and nitrogen-susceptible sweet potato. Physiol. Plant. 2021, 173, 1090–1104. [Google Scholar] [CrossRef]
- Sawicka, B.; Pszczółkowski, P.; Krochmal-Marczak, B.; Barbaś, P.; Özdemir, F.A. The effects of variable nitrogen fertilization on amino acid content in sweet potato tubers (Ipomoea batatas L. [Lam.]) cultivated in central and eastern Europe. J. Sci. Food Agric. 2020, 100, 4132–4138. [Google Scholar] [CrossRef]
- Taranet, P.; Harper, S.; Kirchhof, G.; Fujinuma, R.; Menzies, N. Growth and yield response of glasshouse- and field-grown sweetpotato to nitrogen supply. Nutr. Cycl. Agroecosyst. 2017, 108, 309–321. [Google Scholar] [CrossRef]
- Du, X.; Xi, M.; Kong, L. Split application of reduced nitrogen rate improves nitrogen uptake and use efficiency in sweetpotato. Sci. Rep. 2019, 9, 14058. [Google Scholar] [CrossRef]
- Xiaoguang, C.; Meng, K.; Zhonghou, T.; Aijun, Z.; Hongmin, L. The use of humic acid urea fertilizer for increasing yield and utilization of nitrogen in sweet potato. Plant Soil Environ. 2017, 63, 201–206. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Alves, A.; Oliveira, A.; Alves, E.; Oliveira, A.; Cardoso, E.; Matos, B. Management of nitrogen fertilization for sweet potato: Sources and application parceling. Ciência E Agrotecnol. 2009, 33, 1554–1559. [Google Scholar] [CrossRef]
- Bloom, A.J.; Sukrapanna, S.S.; Warner, R.L. Root Respiration Associated with Ammonium and Nitrate Absorption and Assimilation by Barley. Plant Physiol. 1992, 99, 1294–1301. [Google Scholar] [CrossRef] [PubMed]
- Masumoto, C.; Miyazawa, S.; Ohkawa, H.; Fukuda, T.; Taniguchi, Y.; Murayama, S.; Kusano, M.; Saito, K.; Fukayama, H.; Miyao, M. Phosphoenolpyruvate Carboxylase Intrinsically Located in the Chloroplast of Rice Plays a Crucial Role in Ammonium Assimilation. Proc. Natl. Acad. Sci. USA 2010, 107, 5226–5231. [Google Scholar] [CrossRef] [PubMed]
- Cheng, W.; Sudo, S.; Tsuruta, H.; Yagi, K.; Hartley, A. Temporal and Spatial Variations in N2O Emissions from a Chinese Cabbage Field as a Function of Type of Fertilizer and Application. Nutr. Cycl. Agroecosyst. 2006, 74, 147–155. [Google Scholar] [CrossRef]
- Qiqige, S.; Liguo, J.; Qin, Y.; Chen, Y.; Fan, M. Effects of Different Nitrogen Forms on Potato Growth and Development. J. Plant Nutr. 2017, 40, 1651–1659. [Google Scholar] [CrossRef]
- Ninnemann, O.; Jauniaux, J.; Frommer, W. Identification of a high affinity NH4+ transporter from plants. EMBO J. 1994, 13, 3464–3471. [Google Scholar] [CrossRef]
- Li, B.-Z.; Merrick, M.; Li, S.-M.; Li, H.-Y.; Zhu, S.-W.; Shi, W.-M.; Su, Y.-H. Molecular Basis and Regulation of Ammonium Transporter in Rice. Rice Sci. 2009, 16, 314–322. [Google Scholar] [CrossRef]
- Loqué, D.; Wirén, N. Regulatory levels for the transport of ammonium in plant roots. J. Exp. Bot. 2004, 55, 1293–1305. [Google Scholar] [CrossRef]
- Hao, D.L.; Zhou, J.Y.; Yang, S.Y.; Qi, W.; Yang, K.J.; Su, Y.H. Function and Regulation of Ammonium Transporters in Plants. Int. J. Mol. Sci. 2020, 21, 3557. [Google Scholar] [CrossRef]
- Li, H.; Han, J.L.; Chang, Y.H.; Lin, J.; Yang, Q.S. Gene characterization and transcription analysis of two new ammonium transporters in pear rootstock (Pyrus betulaefolia). J. Plant Res. 2016, 129, 737–748. [Google Scholar] [CrossRef] [PubMed]
- Sun, L.; Di, D.W.; Li, G.; Li, Y.; Kronzucker, H.J.; Shi, W. Transcriptome analysis of rice (Oryza sativa L.) in response to ammonium resupply reveals the involvement of phytohormone signaling and the transcription factor OsJAZ9 in reprogramming of nitrogen uptake and metabolism. J. Plant Physiol. 2020, 246–247, 153137. [Google Scholar] [CrossRef] [PubMed]
- Xia, J.; Wang, Y.; Zhang, T.; Pan, C.; Ji, Y.; Zhou, Y.; Jiang, X. Genome-wide identification, expression profiling, and functional analysis of ammonium transporter 2 (AMT2) gene family in cassava (Manihot esculenta crantz). Front. Genet. 2023, 14, 1145735. [Google Scholar] [CrossRef]
- Gazzarrini, S.; Lejay, L.; Gojon, A.; Ninnemann, O.; Frommer, W.B.; von Wirén, N. Three functional transporters for constitutive, diurnally regulated, and starvation-induced uptake of ammonium into Arabidopsis roots. Plant Cell 1999, 11, 937–948. [Google Scholar] [CrossRef] [PubMed]
- Loqué, D.; Yuan, L.; Kojima, S.; Gojon, A.; Wirth, J.; Gazzarrini, S.; Ishiyama, K.; Takahashi, H.; Wirén, N. A nitrogen-dependent additive contribution of AtAMT1;1 and AtAMT1;3 to ammonium uptake across the plasma membrane of Arabidopsis roots. Plant J. Cell Mol. Biol. 2006, 48, 522–534. [Google Scholar] [CrossRef] [PubMed]
- Yuan, L.; Loqué, D.; Kojima, S.; Rauch, S.; Ishiyama, K.; Inoue, E.; Takahashi, H.; von Wirén, N. The organization of high-affinity ammonium uptake in Arabidopsis roots depends on the spatial arrangement and biochemical properties of AMT1-type transporters. Plant Cell 2007, 19, 2636–2652. [Google Scholar] [CrossRef] [PubMed]
- Filiz, E.; Akbudak, M.A. Ammonium transporter 1 (AMT1) gene family in tomato (Solanum lycopersicum L.): Bioinformatics, physiological and expression analyses under drought and salt stresses. Genomics 2020, 112, 3773–3782. [Google Scholar] [CrossRef]
- Xia, Y.; Liu, Y.; Zhang, T.; Wang, Y.; Jiang, X.; Zhou, Y. Genome-wide identification and expression analysis of ammonium transporter 1 (AMT1) gene family in cassava (Manihot esculenta Crantz) and functional analysis of MeAMT1;1 in transgenic Arabidopsis. 3 Biotech 2021, 12, 4. [Google Scholar] [CrossRef]
- Dai, J.; Han, P.; Walk, T.C.; Yang, L.; Chen, L.; Li, Y.; Gu, C.; Liao, X.; Qin, L. Genome-Wide Identification and Characterization of Ammonium Transporter (AMT) Genes in Rapeseed (Brassica napus L.). Genes 2023, 14, 658. [Google Scholar] [CrossRef]
- Kumar, A.; Silim, S.N.; Okamoto, M.; Siddiqi, M.Y.; Glass, A.D.M. Differential expression of three members of the AMT1 gene family encoding putative high-affinity NH4+ transporters in roots of Oryza sativa subspecies indica. Plant Cell Environ. 2003, 26, 907–914. [Google Scholar] [CrossRef]
- Yan, Y.; Zhang, Z.; Sun, H.; Liu, X.; Xie, J.; Qiu, Y.; Chai, T.; Chu, C.; Hu, B. Nitrate confers rice adaptation to high ammonium by suppressing its uptake but promoting its assimilation. Mol. Plant 2023, 23, 363–365. [Google Scholar] [CrossRef] [PubMed]
- Mérigout, P.; Lelandais, M.; Bitton, F.; Renou, J.P.; Briand, X.; Meyer, C.; Daniel-Vedele, F. Physiological and transcriptomic aspects of urea uptake and assimilation in Arabidopsis plants. Plant Physiol. 2008, 147, 1225–1238. [Google Scholar] [CrossRef] [PubMed]
- Vision, T.J.; Brown, D.G.; Tanksley, S.D. The origins of genomic duplications in Arabidopsis. Science 2000, 290, 2114–2117. [Google Scholar] [CrossRef] [PubMed]
- Kent, W.J.; Baertsch, R.; Hinrichs, A.; Miller, W.; Haussler, D. Evolution’s cauldron: Duplication, deletion, and rearrangement in the mouse and human genomes. Proc. Natl. Acad. Sci. USA 2003, 100, 11484–11489. [Google Scholar] [CrossRef]
- Zhao, T.; Schranz, M.E. Network approaches for plant phylogenomic synteny analysis. Curr. Opin. Plant Biol. 2017, 36, 129–134. [Google Scholar] [CrossRef] [PubMed]
- Phillips, S.; Warren, J.G.; Mullins, G.L. Nitrogen Rate and Application Timing Affect ‘Beauregard’ Sweetpotato Yield and Quality. HortSci. A Publ. Am. Soc. Hortic. Sci. 2005, 40, 214–217. [Google Scholar] [CrossRef]
- Fernandes, A.M.; Campos, L.G.; Senna, M.S.; da Silva, C.L.; Assunção, N.S. Yield and Nitrogen Use Efficiency of Sweet Potato in Response to Cover Crop and Nitrogen Management. Agron. J. 2018, 110, 2004–2015. [Google Scholar] [CrossRef]
- Lihui, B.; Minjian, R.; Xianxiang, Z. Research Progress on absorption and Utilization of nitrogen, phosphorus and potassium by Sweet Potato. Agric. Technol. 2023, 43, 1–3. [Google Scholar] [CrossRef]
- Zheng, W.; Liu, Z.; Zhang, M.; Shi, Y.; Zhu, Q.; Sun, Y.; Zhou, H.; Li, C.; Yang, Y.; Geng, J. Improving crop yields, nitrogen use efficiencies, and profits by using mixtures of coated controlled-released and uncoated urea in a wheat-maize system. Field Crops Res. 2017, 205, 106–115. [Google Scholar] [CrossRef]
- Zhang, L.; Liang, Z.-Y.; He, X.-M.; Meng, Q.-F.; Hu, Y.; Schmidhalter, U.; Zhang, W.; Zou, C.-Q.; Chen, X.-P. Improving grain yield and protein concentration of maize (Zea mays L.) simultaneously by appropriate hybrid selection and nitrogen management. Field Crops Res. 2020, 249, 107754. [Google Scholar] [CrossRef]
- Osaki, M.; Ueda, H.; Shinano, T.; Matsui, H.; Tadano, T. Accumulation of carbon and nitrogen compounds in sweet potato plants grown under deficiency of N, P, or K nutrients. Soil Sci. Plant Nutr. 1995, 41, 557–566. [Google Scholar] [CrossRef]
- Yu, X.; Keitel, C.; Zhang, Y.; Wangeci, A.N.; Dijkstra, F.A. Global meta-analysis of nitrogen fertilizer use efficiency in rice, wheat and maize. Agric. Ecosyst. Environ. 2022, 338, 108089. [Google Scholar] [CrossRef]
- Zhang, G.; Liu, S.; Dong, Y.; Liao, Y.; Han, J. A nitrogen fertilizer strategy for simultaneously increasing wheat grain yield and protein content: Mixed application of controlled-release urea and normal urea. Field Crops Res. 2022, 277, 108405. [Google Scholar] [CrossRef]
- Chunyu, S.; Xiaodong, Z.; Chao, Z.; Xiaoguang, C.J.P.N.; Science, F. Absorption and utilization of different nitrogen forms by sweet potato. Plant Nutr. Fertil. Sci. 2010, 16, 389–394. [Google Scholar] [CrossRef]
- Dawa, K.; Abdel-Fattah, A.; El-Gamiely, E.; El-Din, U. Studies on bio and chemical fertilization on sweet potato (ipomea batatas, l) 1-effect of some chemical nitrogen sources, rates and biofertilizer (nitrobien) on plant growth, yield and quality of tuber roots. J. Plant Prod. 2000, 25, 5397–5411. [Google Scholar] [CrossRef]
- Glass, A.D.M.; Britto, D.T.; Kaiser, B.N.; Kinghorn, J.R.; Kronzucker, H.J.; Kumar, A.; Okamoto, M.; Rawat, S.; Siddiqi, M.Y.; Unkles, S.E.; et al. The regulation of nitrate and ammonium transport systems in plants. J. Exp. Bot. 2002, 53, 855–864. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; von Wirén, N. Ammonium as a signal for physiological and morphological responses in plants. J. Exp. Bot. 2017, 68, 2581–2592. [Google Scholar] [CrossRef]
- Chen, M.; Zhu, K.; Xie, J.; Liu, J.; Tan, P.; Peng, F. Genome-Wide Identification and Expression Analysis of AMT and NRT Gene Family in Pecan (Carya illinoinensis) Seedlings Revealed a Preference for NH(4)(+)-N. Int. J. Mol. Sci. 2022, 23, 13314. [Google Scholar] [CrossRef] [PubMed]
- Gansel, X.; Muños, S.; Tillard, P.; Gojon, A. Differential regulation of the NO3− and NH4+ transporter genes AtNrt2.1 and AtAmt1.1 in Arabidopsis: Relation with long-distance and local controls by N status of the plant. Plant J. 2001, 26, 143–155. [Google Scholar] [CrossRef]
- Huggins, D.R.; Pan, W.L. Nitrogen Efficiency Component Analysis: An Evaluation of Cropping System Differences in Productivity. Agron. J. 1993, 85, 898–905. [Google Scholar] [CrossRef]
- Hao, X.; Sun, L.; Zhou, B.; Ma, X.; Wang, S.; Liu, S.; Ji, J.; Kuang, E.; Qiu, S. Change in maize yield, N use efficiencies and climatic warming potential after urea combined with Nitrapyrin and NBPT during the growing season in a black soil. Soil Tillage Res. 2023, 231, 105721. [Google Scholar] [CrossRef]
- Li, H.; Wang, H.; Fang, Q.; Jia, B.; Li, D.; He, J.; Li, R. Effects of irrigation and nitrogen application on NO3--N distribution in soil, nitrogen absorption, utilization and translocation by winter wheat. Agric. Water Manag. 2023, 276, 108058. [Google Scholar] [CrossRef]
- Congreves, K.A.; Otchere, O.; Ferland, D.; Farzadfar, S.; Williams, S.; Arcand, M.M. Nitrogen Use Efficiency Definitions of Today and Tomorrow. Front. Plant Sci. 2021, 12, 637180. [Google Scholar] [CrossRef]
- Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef]
- Yang, W.; Dong, X.; Yuan, Z.; Zhang, Y.; Li, X.; Wang, Y. Genome-Wide Identification and Expression Analysis of the Ammonium Transporter Family Genes in Soybean. Int. J. Mol. Sci. 2023, 24, 3991. [Google Scholar] [CrossRef]
- Xu, Y.; Liu, F.; Rehman, S.; Dong, H.; Hu, Q.; Tu, Z.; Li, X. Genome-Wide Analysis of AMT Gene Family and its Response to Mycorrhizal Symbiosis in Maize. J. Plant Growth Regul. 2023, 42, 1134–1143. [Google Scholar] [CrossRef]
- Thompson, J.D.; Higgins, D.G.; Gibson, T.J. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22, 4673–4680. [Google Scholar] [CrossRef]
- Yao, Y.; Sun, L.; Wu, W.; Wang, S.; Xiao, X.; Hu, M.; Li, C.; Zhao, H.; Chen, H.; Wu, Q. Genome-Wide Investigation of Major Enzyme-Encoding Genes in the Flavonoid Metabolic Pathway in Tartary Buckwheat (Fagopyrum tataricum). J. Mol. Evol. 2021, 89, 269–286. [Google Scholar] [CrossRef]
- Mo, C.; Wan, S.; Xia, Y.; Ren, N.; Zhou, Y.; Jiang, X. Expression Patterns and Identified Protein-Protein Interactions Suggest that Cassava CBL-CIPK Signal Networks Function in Responses to Abiotic Stresses. Front. Plant Sci. 2018, 9, 269. [Google Scholar] [CrossRef]
- R Core Team. R: A Language and Environment for Statistical Computing. Available online: https://www.r-project.org (accessed on 18 May 2023).











| Year | Treatment | Storage Root Number per Plant | Storage Root Weight (g) | Yield (kg ha−1) | 
|---|---|---|---|---|
| 2021 | NN | 3.00 ± 0.53 b | 68.07 ± 2.87 b | 10,035.58 ± 1717.58 c | 
| LN | 3.50 ± 0.53 ab | 87.81 ± 4.76 a | 15,335.75 ± 2230.94 ab | |
| MN | 3.88 ± 0.64 a | 90.00 ± 6.08 a | 17,356.83 ± 2501.77 a | |
| HN | 3.25 ± 0.46 b | 86.09 ± 2.85 a | 13,975.53 ± 1901.70 b | |
| 2022 | NN | 2.75 ± 0.46 b | 73.43 ± 4.18 b | 10,108.88 ± 1867.65 c | 
| LN | 3.25 ± 0.71 ab | 84.83 ± 7.11 a | 13,653.75 ± 2601.93 ab | |
| MN | 3.50 ± 0.76 a | 86.95 ± 4.69 a | 15,179.02 ± 3123.49 a | |
| HN | 2.88 ± 0.64 ab | 81.99 ± 5.90 a | 11,854.79 ± 3036.84 bc | |
| ANOVA | ||||
| Year | 1.56 * | 22.80 | 34,895,725.64 * | |
| Treatment | 2.04 ** | 1017.34 ** | 110,543,895.31 ** | |
| Year × Treatment | 0.02 | 77.42 | 4,467,957.23 | |
| Year | Treatment | Leaf Weight per Plant (g) | Petiole Weight per Plant (g) | Stem Weight per Plant (g) | Storage Root Weight per Plant (g) | 
|---|---|---|---|---|---|
| 2021 | NN | 41.87 ± 2.55 d | 56.33 ± 3.31 d | 74.43 ± 5.33 d | 200.71 ± 34.35 c | 
| LN | 76.66 ± 3.03 c | 107.36 ± 5.16 c | 123.61 ± 5.61 c | 306.72 ± 44.62 ab | |
| MN | 90.97 ± 5.38 b | 126.88 ± 5.96 b | 153.89 ± 3.73 b | 347.14 ± 50.04 a | |
| HN | 97.50 ± 2.09 a | 150.07 ± 5.77 a | 207.27 ± 5.64 a | 279.51 ± 38.03 b | |
| 2022 | NN | 46.92 ± 1.69 c | 43.23 ± 1.91 d | 105.42 ± 5.69 d | 202.18 ± 37.35 c | 
| LN | 63.36 ± 5.03 b | 74.53 ± 1.71 c | 145.92 ± 4.49 c | 273.08 ± 52.04 ab | |
| MN | 88.81 ± 4.40 a | 95.75 ± 2.50 b | 185.98 ± 3.50 b | 303.58 ± 62.47 a | |
| HN | 90.78 ± 7.00 a | 123.20 ± 5.22 a | 204.81 ± 8.05 a | 237.10 ± 34.54 bc | |
| ANOVA | |||||
| Year | 293.99 ** | 10,799.89 ** | 6880.54 ** | 13,958.29 * | |
| Treatment | 8260.67 ** | 21,558.12 ** | 39,354.79 ** | 44,217.56 ** | |
| Year × Treatment | 238.19 ** | 320.08 ** | 1033.28 ** | 1787.18 | |
| Year | N Application Rate (kg ha−1) | Storage Root Number per Plant | Storage Root Weight per Plant (g) | Storage Root Weight per Plant (g) | 
|---|---|---|---|---|
| 2021 | NN | - | - | - | 
| LN | 3.50 ± 0.53 ab | 9.22 ± 0.50 b | 32.09 ± 3.90 b | |
| MN | 4.13 ± 0.64 a | 11.43 ± 1.65 a | 46.36 ± 3.86 a | |
| HN | 3.25 ± 0.71 b | 9.12 ± 0.68 b | 29.75 ± 6.99 b | |
| 2022 | NN | 2.63 ± 0.84 c | 8.84 ± 2.02 b | 22.60 ± 6.28 c | 
| LN | 3.30 ± 0.64 ab | 9.76 ± 1.64 b | 31.79 ± 5.58 b | |
| MN | 3.55 ± 0.50 a | 12.07 ± 2.08 a | 42.71 ± 9.14 a | |
| HN | 2.98 ± 0.49 bc | 10.20 ± 1.07 b | 29.96 ± 2.74 b | |
| ANOVA analysis | ||||
| Year | 1.47 | 6.81 | 18.77 | |
| Treatment | 2.27 ** | 23.70 ** | 971.80 ** | |
| Year × Treatment | 0.16 | 0.33 | 17.53 | |
| Period | Year | Treatment | N Uptake Efficiency (kg kg−1) | N Use Efficiency (kg kg−1) | N Fertilization Contribution Rates | 
|---|---|---|---|---|---|
| Canopy Closure Period | 2021 | NN | - | - | - | 
| LN | 19.49 ± 0.27 b | 0.30 ± 0.01 a | - | ||
| MN | 25.42 ± 0.16 a | 0.17 ± 0.01 b | - | ||
| HN | 9.54 ± 0.09 c | 0.18 ± 0.01 b | - | ||
| 2022 | NN | - | 0.58 ± 0.05 a | - | |
| LN | 22.72 ± 1.19 b | 0.27 ± 0.02 b | - | ||
| MN | 27.66 ± 0.67 a | 0.17 ± 0.01 c | - | ||
| HN | 11.86 ± 0.23 c | 0.15 ± 0.01 c | - | ||
| Harvest Time | 2021 | NN | - | 0.78 ± 0.09 a | - | 
| LN | 107.04 ± 8.45 a | 0.55 ± 0.05 b | 0.35 ± 0.02 b | ||
| MN | 73.96 ± 3.86 b | 0.45 ± 0.02 c | 0.42 ± 0.01 | ||
| HN | 44.01 ± 2.58 c | 0.39 ± 0.02 c | 0.28 ± 0.01 | ||
| 2022 | NN | - | 1.17 ± 0.22 a | - | |
| LN | 68.49 ± 8.43 a | 0.77 ± 0.10 b | 0.26 ± 0.01 | ||
| MN | 47.29 ± 5.04 b | 0.62 ± 0.07 bc | 0.33 ± 0.02 | ||
| HN | 32.72 ± 3.04 c | 0.44 ± 0.05 c | 0.15 ± 0.01 | ||
| ANOVA | |||||
| Canopy Closure Period | Year | 30.42 ** | 0 | - | |
| Treatment | 388.74 ** | 0.13 ** | - | ||
| Year × Treatment | 0.45 | 0 | - | ||
| Harvest Time | Year | 2926.28 ** | 0.26 ** | 0.05 ** | |
| Treatment | 3672.63 ** | 0.35 ** | 0.04 ** | ||
| Year × Treatment | 280.17 ** | 0.03 | 0.00 ** | ||
| Gene ID | Rename | Chromosome | +/− | From | To | Protein (aa) a | MW (Da) b | PI c | Instability Index | Subcellular Localization | 
|---|---|---|---|---|---|---|---|---|---|---|
| g5252.t1 | IbAMT1.1 | LG2 | − | 6,966,130 | 6,967,728 | 474 | 50,364.83 | 5.94 | 26.04 | Plasma membrane | 
| g8186.t1 | IbAMT1.2 | LG2 | − | 29,455,175 | 29,457,130 | 500 | 53,162.08 | 6.49 | 25.23 | Plasma membrane | 
| g8219.t1 | IbAMT1.3 | LG2 | + | 29,703,630 | 29,707,688 | 718 | 76,762.85 | 8.54 | 45.62 | Plasma membrane | 
| g9593.t1 | IbAMT2.1 | LG3 | + | 1,155,199 | 1,157,128 | 461 | 50,746.34 | 8.49 | 42.93 | Plasma membrane | 
| g14003.t1 | IbAMT1.4 | LG4 | + | 8,704,965 | 8,706,760 | 495 | 52,496.55 | 7.11 | 23.74 | Cytosol | 
| g17995.t1 | IbAMT2.2 | LG5 | + | 9,624,603 | 9,630,151 | 450 | 48,335.51 | 8.77 | 28.96 | Plasma membrane | 
| g23921.t1 | IbAMT2.3 | LG6 | − | 22,757,713 | 22,760,447 | 404 | 44,089.46 | 6.22 | 32.83 | Plasma membrane | 
| g27616.t1 | IbAMT2.4 | LG7 | + | 17,584,800 | 17,610,979 | 480 | 52,074.74 | 8.34 | 35.08 | Plasma membrane | 
| g29440.t1 | IbAMT2.5 | LG7 | − | 30,456,113 | 30,458,239 | 410 | 44,766.8 | 6.34 | 37.27 | Plasma membrane | 
| g37079.t1 | IbAMT2.6 | LG9 | − | 22,670,108 | 22,674,025 | 327 | 35,229.26 | 8.74 | 34.14 | Plasma membrane | 
| g44418.t1 | IbAMT2.7 | LG11 | − | 22,000,413 | 22,003,757 | 449 | 48,838.24 | 6.30 | 31.50 | Plasma membrane | 
| g54923.t1 | IbAMT1.5 | LG13 | + | 26,814,002 | 26,816,033 | 510 | 54,360.35 | 6.85 | 27.43 | Plasma membrane | 
| City | Year | Month | Total Rainfall (mm) | Maximum Temperature (°C) | Minimum Temperature (°C) | Average Temperature (°C) | 
|---|---|---|---|---|---|---|
| Haikou | 2021 | 10 | 505.30 | 32.00 | 18.00 | 24.90 | 
| 11 | 26.30 | 30.00 | 17.00 | 22.70 | ||
| 12 | 57.90 | 25.00 | 14.00 | 19.00 | ||
| 2022 | 1 | 16.70 | 26.00 | 14.00 | 19.70 | |
| 2 | 140.60 | 26.00 | 8.00 | 16.80 | ||
| Sanya | 10 | 45.00 | 31.00 | 20.00 | 25.70 | |
| 11 | 2.10 | 31.00 | 20.00 | 25.60 | ||
| 12 | 0.20 | 29.00 | 15.00 | 21.70 | ||
| 2023 | 1 | 3.00 | 28.00 | 14.00 | 21.30 | |
| 2 | 9.00 | 31.00 | 18.00 | 23.40 | 
| Gene Name | Forward Primer Sequence (5′-3′) | Reverse Primer Sequence (5′-3′) | 
|---|---|---|
| Actin | TATGGTTGGGATGGGACAGAA | CGGTAAGAAGGACAGGGTGCT | 
| IbAMT1.1 | CAACGGCGTGGAAGACAAATTCG | GAAGACTAGGTAGGCGGAGAAGAGG | 
| IbAMT1.2 | GGAAGACGAAATGGCGGGTATGG | TGCGGGTTCAATCCTTCTCATTTGG | 
| IbAMT1.3 | CATATCCATACCGACGCCCATGTAC | CTCCTCCCTCCCATCTCTCATCAAG | 
| IbAMT1.4 | TGTCGGGGCATTGGAAAGTTACG | ATTAAGACCAGAGCCGCCACAAAC | 
| IbAMT1.5 | CGGAAGATGAGACCTGCGGAATG | GTGTGGGAGTATTGGACGGTTCG | 
| Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. | 
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Meng, Y.-Y.; Wang, N.; Zhang, H.-Y.; Xu, R.; Si, C.-C. Genome-Wide Analysis of Sweet Potato Ammonium Transporter (AMT): Influence on Nitrogen Utilization, Storage Root Development and Yield. Int. J. Mol. Sci. 2023, 24, 17424. https://doi.org/10.3390/ijms242417424
Meng Y-Y, Wang N, Zhang H-Y, Xu R, Si C-C. Genome-Wide Analysis of Sweet Potato Ammonium Transporter (AMT): Influence on Nitrogen Utilization, Storage Root Development and Yield. International Journal of Molecular Sciences. 2023; 24(24):17424. https://doi.org/10.3390/ijms242417424
Chicago/Turabian StyleMeng, Ya-Yi, Ning Wang, Hai-Yan Zhang, Ran Xu, and Cheng-Cheng Si. 2023. "Genome-Wide Analysis of Sweet Potato Ammonium Transporter (AMT): Influence on Nitrogen Utilization, Storage Root Development and Yield" International Journal of Molecular Sciences 24, no. 24: 17424. https://doi.org/10.3390/ijms242417424
APA StyleMeng, Y.-Y., Wang, N., Zhang, H.-Y., Xu, R., & Si, C.-C. (2023). Genome-Wide Analysis of Sweet Potato Ammonium Transporter (AMT): Influence on Nitrogen Utilization, Storage Root Development and Yield. International Journal of Molecular Sciences, 24(24), 17424. https://doi.org/10.3390/ijms242417424
 
        

 
       