Early-Stage Application of Agomir-137 Promotes Locomotor Recovery in a Mouse Model of Motor Cortex Injury
Abstract
:1. Introduction
2. Results
2.1. Temporal Expression and Exogenous Intervention of miR-137 Following M1 Lesion
2.2. Early-Stage Delivery of Agomir-137 Improves Locomotor Function after M1 Lesion
2.3. Early-Stage Delivery of Agomir-137 Reduces Neural Apoptosis and Gliosis following M1 Lesion
2.4. Early-Stage Delivery of Agomir-137 Reduces the Expression of Pro-Inflammatory Genes
3. Materials and Methods
3.1. Mice
3.2. Motor Cortex Stab Injury
3.3. Intranasal Delivery of Agomir-137/Antagomir-137
3.4. qRT-PCR
3.5. Immunostaining
3.6. Fluoro-Jade C Staining
3.7. Behavioral Tests
3.8. Statistical Analysis
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ponsford, J.; Spitz, G.; Hicks, A.J. Highlights in traumatic brain injury research in 2021. Lancet Neurol. 2022, 21, 5–6. [Google Scholar] [CrossRef] [PubMed]
- Quaglio, G.; Gallucci, M.; Brand, H.; Dawood, A.; Cobello, F. Traumatic brain injury: A priority for public health policy. Lancet Neurol. 2017, 16, 951–952. [Google Scholar] [CrossRef] [PubMed]
- Shoemaker, L.D.; Arlotta, P. Untangling the cortex: Advances in understanding specification and differentiation of corticospinal motor neurons. BioEssays News Rev. Mol. Cell. Dev. Biol. 2010, 32, 197–206. [Google Scholar] [CrossRef] [PubMed]
- Vasudevan, E.V.; Glass, R.N.; Packel, A.T. Effects of traumatic brain injury on locomotor adaptation. J. Neurol. Phys. Ther. JNPT 2014, 38, 172–182. [Google Scholar] [CrossRef]
- Quillinan, N.; Herson, P.S.; Traystman, R.J. Neuropathophysiology of Brain Injury. Anesthesiol. Clin. 2016, 34, 453–464. [Google Scholar] [CrossRef] [PubMed]
- Brett, B.L.; Gardner, R.C.; Godbout, J.; Dams-O’Connor, K.; Keene, C.D. Traumatic Brain Injury and Risk of Neurodegenerative Disorder. Biol. Psychiatry 2022, 91, 498–507. [Google Scholar] [CrossRef] [PubMed]
- Rice, M.W.; Pandya, J.D.; Shear, D.A. Gut Microbiota as a Therapeutic Target to Ameliorate the Biochemical, Neuroanatomical, and Behavioral Effects of Traumatic Brain Injuries. Front. Neurol. 2019, 10, 875. [Google Scholar] [CrossRef]
- Saraiva, C.; Esteves, M.; Bernardino, L. MicroRNA: Basic concepts and implications for regeneration and repair of neurodegenerative diseases. Biochem. Pharmacol. 2017, 141, 118–131. [Google Scholar] [CrossRef]
- Gugliandolo, A.; Silvestro, S.; Sindona, C.; Bramanti, P.; Mazzon, E. MiRNA: Involvement of the MAPK Pathway in Ischemic Stroke. A Promising Therapeutic Target. Medicina 2021, 57, 1053. [Google Scholar] [CrossRef]
- Atif, H.; Hicks, S.D. A Review of MicroRNA Biomarkers in Traumatic Brain Injury. J. Exp. Neurosci. 2019, 13, 1179069519832286. [Google Scholar] [CrossRef]
- Pinchi, E.; Frati, P.; Arcangeli, M.; Volonnino, G.; Tomassi, R.; Santoro, P.; Cipolloni, L. MicroRNAs: The New Challenge for Traumatic Brain Injury Diagnosis. Curr. Neuropharmacol. 2020, 18, 319–331. [Google Scholar] [CrossRef]
- Martinez, B.; Peplow, P.V. MicroRNAs as diagnostic markers and therapeutic targets for traumatic brain injury. Neural Regen. Res. 2017, 12, 1749–1761. [Google Scholar] [CrossRef] [PubMed]
- Di Pietro, V.; Yakoub, K.M.; Scarpa, U.; Di Pietro, C.; Belli, A. MicroRNA Signature of Traumatic Brain Injury: From the Biomarker Discovery to the Point-of-Care. Front. Neurol. 2018, 9, 429. [Google Scholar] [CrossRef]
- Willemsen, M.H.; Vallès, A.; Kirkels, L.A.; Mastebroek, M.; Olde Loohuis, N.; Kos, A.; Wissink-Lindhout, W.M.; de Brouwer, A.P.; Nillesen, W.M.; Pfundt, R.; et al. Chromosome 1p21.3 microdeletions comprising DPYD and MIR137 are associated with intellectual disability. J. Med. Genet. 2011, 48, 810–818. [Google Scholar] [CrossRef] [PubMed]
- Lagos-Quintana, M.; Rauhut, R.; Yalcin, A.; Meyer, J.; Lendeckel, W.; Tuschl, T. Identification of tissue-specific microRNAs from mouse. Curr. Biol. 2002, 12, 735–739. [Google Scholar] [CrossRef]
- Guella, I.; Sequeira, A.; Rollins, B.; Morgan, L.; Torri, F.; van Erp, T.G.; Myers, R.M.; Barchas, J.D.; Schatzberg, A.F.; Watson, S.J.; et al. Analysis of miR-137 expression and rs1625579 in dorsolateral prefrontal cortex. J. Psychiatr. Res. 2013, 47, 1215–1221. [Google Scholar] [CrossRef]
- Sun, G.; Ye, P.; Murai, K.; Lang, M.F.; Li, S.; Zhang, H.; Li, W.; Fu, C.; Yin, J.; Wang, A.; et al. miR-137 forms a regulatory loop with nuclear receptor TLX and LSD1 in neural stem cells. Nat. Commun. 2011, 2, 529. [Google Scholar] [CrossRef] [PubMed]
- Tomasello, U.; Klingler, E.; Niquille, M.; Mule, N.; Santinha, A.J.; de Vevey, L.; Prados, J.; Platt, R.J.; Borrell, V.; Jabaudon, D.; et al. miR-137 and miR-122, two outer subventricular zone non-coding RNAs, regulate basal progenitor expansion and neuronal differentiation. Cell Rep. 2022, 38, 110381. [Google Scholar] [CrossRef]
- Tamim, S.; Vo, D.T.; Uren, P.J.; Qiao, M.; Bindewald, E.; Kasprzak, W.K.; Shapiro, B.A.; Nakaya, H.I.; Burns, S.C.; Araujo, P.R.; et al. Genomic analyses reveal broad impact of miR-137 on genes associated with malignant transformation and neuronal differentiation in glioblastoma cells. PLoS ONE 2014, 9, e85591. [Google Scholar] [CrossRef]
- Smrt, R.D.; Szulwach, K.E.; Pfeiffer, R.L.; Li, X.; Guo, W.; Pathania, M.; Teng, Z.Q.; Luo, Y.; Peng, J.; Bordey, A.; et al. MicroRNA miR-137 regulates neuronal maturation by targeting ubiquitin ligase mind bomb-1. Stem Cells 2010, 28, 1060–1070. [Google Scholar] [CrossRef]
- Channakkar, A.S.; Singh, T.; Pattnaik, B.; Gupta, K.; Seth, P.; Adlakha, Y.K. MiRNA-137-mediated modulation of mitochondrial dynamics regulates human neural stem cell fate. Stem Cells 2020, 38, 683–697. [Google Scholar] [CrossRef] [PubMed]
- Tian, R.; Wu, B.; Fu, C.; Guo, K. miR-137 prevents inflammatory response, oxidative stress, neuronal injury and cognitive impairment via blockade of Src-mediated MAPK signaling pathway in ischemic stroke. Aging 2020, 12, 10873–10895. [Google Scholar] [CrossRef] [PubMed]
- Chen, F.; Zhang, L.; Wang, E.; Zhang, C.; Li, X. LncRNA GAS5 regulates ischemic stroke as a competing endogenous RNA for miR-137 to regulate the Notch1 signaling pathway. Biochem. Biophys. Res. Commun. 2018, 496, 184–190. [Google Scholar] [CrossRef] [PubMed]
- Shi, F.; Dong, Z.; Li, H.; Liu, X.; Liu, H.; Dong, R. MicroRNA-137 protects neurons against ischemia/reperfusion injury through regulation of the Notch signaling pathway. Exp. Cell Res. 2017, 352, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Giotta Lucifero, A.; Luzzi, S. Brain AVMs-Related microRNAs: Machine Learning Algorithm for Expression Profiles of Target Genes. Brain Sci. 2022, 12, 1628. [Google Scholar] [CrossRef] [PubMed]
- Tian, H.; Zhao, Y.; Du, C.; Zong, X.; Zhang, X.; Qiao, X. Expression of miR-210, miR-137, and miR-153 in Patients with Acute Cerebral Infarction. BioMed Res. Int. 2021, 2021, 4464945. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.; Ge, D.J.; Su, Z.; Qi, B. miR-137 alleviates focal cerebral ischemic injury in rats by regulating JAK1/STAT1 signaling pathway. Hum. Exp. Toxicol. 2020, 39, 816–827. [Google Scholar] [CrossRef]
- Meissner, L.; Gallozzi, M.; Balbi, M.; Schwarzmaier, S.; Tiedt, S.; Terpolilli, N.A.; Plesnila, N. Temporal Profile of MicroRNA Expression in Contused Cortex after Traumatic Brain Injury in Mice. J. Neurotrauma 2016, 33, 713–720. [Google Scholar] [CrossRef]
- O’Connell, G.C.; Smothers, C.G.; Winkelman, C. Bioinformatic analysis of brain-specific miRNAs for identification of candidate traumatic brain injury blood biomarkers. Brain Inj. 2020, 34, 965–974. [Google Scholar] [CrossRef]
- Liu, X.T.; Liu, C.M.; Teng, Z.Q. Mouse model of voluntary movement deficits induced by needlestick injuries to the primary motor cortex. J. Neurosci. Methods 2022, 365, 109380. [Google Scholar] [CrossRef]
- Mai, H.; Fan, W.; Wang, Y.; Cai, Y.; Li, X.; Chen, F.; Chen, X.; Yang, J.; Tang, P.; Chen, H.; et al. Intranasal Administration of miR-146a Agomir Rescued the Pathological Process and Cognitive Impairment in an AD Mouse Model. Mol. Ther. Nucleic Acids 2019, 18, 681–695. [Google Scholar] [CrossRef] [PubMed]
- He, X.C.; Wang, J.; Du, H.Z.; Liu, C.M.; Teng, Z.Q. Intranasal Administration of Agomir-let-7i Improves Cognitive Function in Mice with Traumatic Brain Injury. Cells 2022, 11, 1348. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.X.; Xiao, X.; He, X.C.; He, B.D.; Liu, C.M.; Teng, Z.Q. Agomir-331 Suppresses Reactive Gliosis and Neuroinflammation after Traumatic Brain Injury. Cells 2023, 12, 2429. [Google Scholar] [CrossRef]
- Wright, D.K.; Liu, S.; van der Poel, C.; McDonald, S.J.; Brady, R.D.; Taylor, L.; Yang, L.; Gardner, A.J.; Ordidge, R.; O’Brien, T.J.; et al. Traumatic Brain Injury Results in Cellular, Structural and Functional Changes Resembling Motor Neuron Disease. Cereb. Cortex 2017, 27, 4503–4515. [Google Scholar] [CrossRef] [PubMed]
- Vaysse, L.; Conchou, F.; Demain, B.; Davoust, C.; Plas, B.; Ruggieri, C.; Benkaddour, M.; Simonetta-Moreau, M.; Loubinoux, I. Strength and fine dexterity recovery profiles after a primary motor cortex insult and effect of a neuronal cell graft. Behav. Neurosci. 2015, 129, 423–434. [Google Scholar] [CrossRef] [PubMed]
- Gao, J.; Yao, M.; Zhang, W.; Yang, B.; Yuan, G.; Liu, J.X.; Zhang, Y. Panax notoginseng saponins alleviates inflammation induced by microglial activation and protects against ischemic brain injury via inhibiting HIF-1α/PKM2/STAT3 signaling. Biomed. Pharmacother. 2022, 155, 113479. [Google Scholar] [CrossRef]
- Robinson, C.P. Moderate and Severe Traumatic Brain Injury. Continuum 2021, 27, 1278–1300. [Google Scholar] [CrossRef] [PubMed]
- Mostert, C.Q.B.; Singh, R.D.; Gerritsen, M.; Kompanje, E.J.O.; Ribbers, G.M.; Peul, W.C.; van Dijck, J. Long-term outcome after severe traumatic brain injury: A systematic literature review. Acta Neurochir. 2022, 164, 599–613. [Google Scholar] [CrossRef]
- Nasr, I.W.; Chun, Y.; Kannan, S. Neuroimmune responses in the developing brain following traumatic brain injury. Exp. Neurol. 2019, 320, 112957. [Google Scholar] [CrossRef] [PubMed]
- Simon, D.W.; McGeachy, M.J.; Bayir, H.; Clark, R.S.; Loane, D.J.; Kochanek, P.M. The far-reaching scope of neuroinflammation after traumatic brain injury. Nat. Rev. Neurol. 2017, 13, 171–191. [Google Scholar] [CrossRef]
- Juengst, S.B.; Kumar, R.G.; Arenth, P.M.; Wagner, A.K. Exploratory associations with tumor necrosis factor-α, disinhibition and suicidal endorsement after traumatic brain injury. Brain Behav. Immun. 2014, 41, 134–143. [Google Scholar] [CrossRef] [PubMed]
- Kumar, R.G.; Diamond, M.L.; Boles, J.A.; Berger, R.P.; Tisherman, S.A.; Kochanek, P.M.; Wagner, A.K. Acute CSF interleukin-6 trajectories after TBI: Associations with neuroinflammation, polytrauma, and outcome. Brain Behav. Immun. 2015, 45, 253–262. [Google Scholar] [CrossRef] [PubMed]
- de Rivero Vaccari, J.P.; Lotocki, G.; Alonso, O.F.; Bramlett, H.M.; Dietrich, W.D.; Keane, R.W. Therapeutic neutralization of the NLRP1 inflammasome reduces the innate immune response and improves histopathology after traumatic brain injury. J. Cereb. Blood Flow Metab. 2009, 29, 1251–1261. [Google Scholar] [CrossRef] [PubMed]
- Shi, K.; Zhang, J.; Dong, J.F.; Shi, F.D. Dissemination of brain inflammation in traumatic brain injury. Cell. Mol. Immunol. 2019, 16, 523–530. [Google Scholar] [CrossRef] [PubMed]
- Sun, W.; Zhang, Y.; Wang, G. MicroRNA-137-mediated inhibition of lysine-specific demethylase-1 prevents against rheumatoid arthritis in an association with the REST/mTOR axis. Mol. Pain 2021, 17, 17448069211041847. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Fang, L.; Ye, L.; Ma, S.; Huang, H.; Lan, X.; Ma, J. miR-137 targets the inhibition of TCF4 to reverse the progression of osteoarthritis through the AMPK/NF-κB signaling pathway. Biosci. Rep. 2020, 40, BSR20200466. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Song, Z.; Zou, H.; Chen, H.; Hu, Y.; Li, X.; Liu, J. CircRNA3616 knockdown attenuates inflammation and apoptosis in spinal cord injury by inhibiting TLR4/NF-κB activity via sponging miR-137. Mol. Cell Biochem. 2023, 478, 329–341. [Google Scholar] [CrossRef]
- Gao, F.; Lei, J.; Zhang, Z.; Yang, Y.; You, H. Curcumin alleviates LPS-induced inflammation and oxidative stress in mouse microglial BV2 cells by targeting miR-137-3p/NeuroD1. RSC Adv. 2019, 9, 38397–38406. [Google Scholar] [CrossRef]
- Shandra, O.; Robel, S. Inducing Post-Traumatic Epilepsy in a Mouse Model of Repetitive Diffuse Traumatic Brain Injury. J. Vis. Exp. 2020, 156, e60360. [Google Scholar] [CrossRef]
- Burda, J.E.; Bernstein, A.M.; Sofroniew, M.V. Astrocyte roles in traumatic brain injury. Exp. Neurol. 2016, 275 Pt 3, 305–315. [Google Scholar] [CrossRef]
- Yang, T.; Dai, Y.; Chen, G.; Cui, S. Dissecting the Dual Role of the Glial Scar and Scar-Forming Astrocytes in Spinal Cord Injury. Front. Cell. Neurosci. 2020, 14, 78. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez, J.P.; Coulter, M.; Miotke, J.; Meyer, R.L.; Takemaru, K.; Levine, J.M. Abrogation of β-catenin signaling in oligodendrocyte precursor cells reduces glial scarring and promotes axon regeneration after CNS injury. J. Neurosci. 2014, 34, 10285–10297. [Google Scholar] [CrossRef] [PubMed]
- Hesp, Z.C.; Yoseph, R.Y.; Suzuki, R.; Jukkola, P.; Wilson, C.; Nishiyama, A.; McTigue, D.M. Proliferating NG2-Cell-Dependent Angiogenesis and Scar Formation Alter Axon Growth and Functional Recovery After Spinal Cord Injury in Mice. J. Neurosci. 2018, 38, 1366–1382. [Google Scholar] [CrossRef]
- Wang, Y.; Chen, R.; Zhou, X.; Guo, R.; Yin, J.; Li, Y.; Ma, G. miR-137: A Novel Therapeutic Target for Human Glioma. Mol. Ther. Nucleic Acids 2020, 21, 614–622. [Google Scholar] [CrossRef] [PubMed]
- Mahmoudi, E.; Cairns, M.J. MiR-137: An important player in neural development and neoplastic transformation. Mol. Psychiatry 2017, 22, 44–55. [Google Scholar] [CrossRef] [PubMed]
- Cheng, Y.; Wang, Z.M.; Tan, W.; Wang, X.; Li, Y.; Bai, B.; Li, Y.; Zhang, S.F.; Yan, H.L.; Chen, Z.L.; et al. Partial loss of psychiatric risk gene Mir137 in mice causes repetitive behavior and impairs sociability and learning via increased Pde10a. Nat. Neurosci. 2018, 21, 1689–1703. [Google Scholar] [CrossRef] [PubMed]
- Dai, J.; Xu, L.J.; Han, G.D.; Sun, H.L.; Zhu, G.T.; Jiang, H.T.; Yu, G.Y.; Tang, X.M. MiR-137 attenuates spinal cord injury by modulating NEUROD4 through reducing inflammation and oxidative stress. Eur. Rev. Med. Pharmacol. Sci. 2018, 22, 1884–1890. [Google Scholar] [CrossRef]
- Crowe, T.P.; Greenlee, M.H.W.; Kanthasamy, A.G.; Hsu, W.H. Mechanism of intranasal drug delivery directly to the brain. Life Sci. 2018, 195, 44–52. [Google Scholar] [CrossRef] [PubMed]
- Keller, L.A.; Merkel, O.; Popp, A. Intranasal drug delivery: Opportunities and toxicologic challenges during drug development. Drug Deliv. Transl. Res. 2022, 12, 735–757. [Google Scholar] [CrossRef]
- Yan, H.L.; Sun, X.W.; Wang, Z.M.; Liu, P.P.; Mi, T.W.; Liu, C.; Wang, Y.Y.; He, X.C.; Du, H.Z.; Liu, C.M.; et al. MiR-137 Deficiency Causes Anxiety-Like Behaviors in Mice. Front. Mol. Neurosci. 2019, 12, 260. [Google Scholar] [CrossRef]
- Mi, T.W.; Sun, X.W.; Wang, Z.M.; Wang, Y.Y.; He, X.C.; Liu, C.; Zhang, S.F.; Du, H.Z.; Liu, C.M.; Teng, Z.Q. Loss of MicroRNA-137 Impairs the Homeostasis of Potassium in Neurons via KCC2. Exp. Neurobiol. 2020, 29, 138–149. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer Sequence (5′-3′) | |
---|---|---|
miR-137 | Forward | CGCGCGTTATTGCTTAAGAATAC |
Reverse | AGTGCAGGGTCCGAGGTATT | |
Actin | Forward | TGCACCACCAACTGCTTAG |
Reverse | GGATGCAGGGATGATGTTC | |
TNF-α | Forward | ACGGCATGGATCTCAAAGAC |
Reverse | GTGGGTGAGGAGCACGTAGT | |
IL-1β | Forward | CAGGCAGGCAGTATCACTCA |
Reverse | TGTCCTCATCCTGGAAGGTC | |
Caspase-3 | Forward | TGGTGATGAAGGGGTCATTTATG |
Reverse | TTCGGCTTTCCAGTCAGACTC | |
Bcl2 | Forward | GTCGCTACCGTCGTGACTTC |
Reverse | CAGACATGCACCTACCCAGC | |
Bax | Forward | TGAAGACAGGGGCCTTTTTG |
Reverse | AATTCGCCGGAGACACTCG | |
IL-6 | Forward | ATGGATGCTACCAAACTGGAT |
Reverse | TGAAGGACTCTGGCTTTGTCT | |
Iap | Forward | TGGGCACAGCTTATCTGGC |
Reverse | TGACTATGGTCAGAGTGTCGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, X.-T.; Teng, Z.-Q. Early-Stage Application of Agomir-137 Promotes Locomotor Recovery in a Mouse Model of Motor Cortex Injury. Int. J. Mol. Sci. 2023, 24, 17156. https://doi.org/10.3390/ijms242417156
Liu X-T, Teng Z-Q. Early-Stage Application of Agomir-137 Promotes Locomotor Recovery in a Mouse Model of Motor Cortex Injury. International Journal of Molecular Sciences. 2023; 24(24):17156. https://doi.org/10.3390/ijms242417156
Chicago/Turabian StyleLiu, Xiao-Tian, and Zhao-Qian Teng. 2023. "Early-Stage Application of Agomir-137 Promotes Locomotor Recovery in a Mouse Model of Motor Cortex Injury" International Journal of Molecular Sciences 24, no. 24: 17156. https://doi.org/10.3390/ijms242417156
APA StyleLiu, X.-T., & Teng, Z.-Q. (2023). Early-Stage Application of Agomir-137 Promotes Locomotor Recovery in a Mouse Model of Motor Cortex Injury. International Journal of Molecular Sciences, 24(24), 17156. https://doi.org/10.3390/ijms242417156