M6A Demethylase Inhibits Osteogenesis of Dental Follicle Stem Cells via Regulating miR-7974/FKBP15 Pathway
Abstract
:1. Introduction
2. Results
2.1. Overexpression of FTO and ALKBH5 Inhibited the Osteogenic Capacity of DFSCs
2.2. Downregulation of miR-7974 Was Involved in Decreased Osteogenic Capacity of FTO-OE or ALKBH5-OE
2.3. FKBP15 Is Increased in FTO-Overexpressing DFSCs and Targeted by miR-7974
2.4. FKBP15 Inhibits Osteogenic Capacity of DFSCs by Interacting with Actin Cytoskeleton
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Cell Transfection
4.3. Osteogenesis Induction
4.4. High Throughput Sequencing of mRNA and microRNA
4.5. Real-Time Quantitative PCR
4.6. MiRNA Stability Assay
4.7. Western Blot Analysis
4.8. Immunofluorescence
4.9. MiRNA Target Prediction
4.10. Data and Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wang, H.T.; Wang, J.N.; Li, Z.Z.; Xia, H.F.; Wang, C.F.; Cai, Y.; Zhao, Y.F.; Ren, J.G.; Zhao, J.H. Effects of bleomycin on tooth eruption: A novel potential application. Eur. J. Pharm. Sci. 2020, 144, 105214. [Google Scholar] [CrossRef]
- Li, Z.Z.; Wang, H.T.; Lee, G.Y.; Yang, Y.; Zou, Y.P.; Wang, B.; Gong, C.J.; Cai, Y.; Ren, J.G.; Zhao, J.H. Bleomycin: A novel osteogenesis inhibitor of dental follicle cells via a TGF-β1/SMAD7/RUNX2 pathway. Br. J. Pharmacol. 2021, 178, 312–327. [Google Scholar] [CrossRef] [PubMed]
- Desrosiers, R.C.; Friderici, K.H.; Rottman, F.M. Characterization of Novikoff hepatoma mRNA methylation and heterogeneity in the methylated 5′ terminus. Biochemistry 1975, 14, 4367–4374. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Yue, Y.; Han, D.; Wang, X.; Fu, Y.; Zhang, L.; Jia, G.; Yu, M.; Lu, Z.; Deng, X.; et al. A METTL3-METTL14 complex mediates mammalian nuclear RNA N6-adenosine methylation. Nat. Chem. Biol. 2014, 10, 93–95. [Google Scholar] [CrossRef]
- Ping, X.L.; Sun, B.F.; Wang, L.; Xiao, W.; Yang, X.; Wang, W.J.; Adhikari, S.; Shi, Y.; Lv, Y.; Chen, Y.S.; et al. Mammalian WTAP is a regulatory subunit of the RNA N6-methyladenosine methyltransferase. Cell Res. 2014, 24, 177–189. [Google Scholar] [CrossRef]
- Jia, G.; Fu, Y.; Zhao, X.; Dai, Q.; Zheng, G.; Yang, Y.; Yi, C.; Lindahl, T.; Pan, T.; Yang, Y.G.; et al. N6-methyladenosine in nuclear RNA is a major substrate of the obesity-associated FTO. Nat. Chem. Biol. 2011, 7, 885–887. [Google Scholar] [CrossRef] [PubMed]
- Zheng, G.; Dahl, J.A.; Niu, Y.; Fedorcsak, P.; Huang, C.M.; Li, C.J.; Vågbø, C.B.; Shi, Y.; Wang, W.L.; Song, S.H.; et al. ALKBH5 is a mammalian RNA demethylase that impacts RNA metabolism and mouse fertility. Mol. Cell. 2013, 49, 18–29. [Google Scholar] [CrossRef] [PubMed]
- Wei, J.; Liu, F.; Lu, Z.; Fei, Q.; Ai, Y.; He, P.C.; Shi, H.; Cui, X.; Su, R.; Klungland, A.; et al. Differential m6A, m6Am, and m1A demethylation mediated by FTO in the cell nucleus and cytoplasm. Mol. Cell. 2018, 71, 973–985.e975. [Google Scholar] [CrossRef]
- Zhang, M.; Zhai, Y.; Zhang, S.; Dai, X.; Li, Z. Roles of N6-methyladenosine (m6A) in stem cell fate decisions and early embryonic development in mammals. Front. Cell Dev. Biol. 2020, 8, 782. [Google Scholar] [CrossRef]
- Tian, C.; Huang, Y.; Li, Q.; Feng, Z.; Xu, Q. Mettl3 regulates osteogenic differentiation and alternative splicing of Vegfa in bone marrow mesenchymal stem cells. Int. J. Mol. Sci. 2019, 20, 551. [Google Scholar] [CrossRef]
- Li, Y.; Yang, F.; Gao, M.; Gong, R.; Jin, M.; Liu, T.; Sun, Y.; Fu, Y.; Huang, Q.; Zhang, W.; et al. miR-149-3p regulates the switch between adipogenic and osteogenic differentiation of BMSCs by targeting FTO. Mol. Ther. Nucleic Acids 2019, 17, 590–600. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Wang, Y.; Zhao, H.; Han, X.; Zhao, T.; Qu, P.; Li, G.; Wang, W. Extracellular vesicle-encapsulated miR-22-3p from bone marrow mesenchymal stem cell promotes osteogenic differentiation via FTO inhibition. Stem Cell Res. Ther. 2020, 11, 227. [Google Scholar] [CrossRef]
- Huang, H.; Weng, H.; Chen, J. m6A modification in coding and non-coding RNAs: Roles and therapeutic implications in cancer. Cancer Cell 2020, 37, 270–288. [Google Scholar] [CrossRef]
- Iaquinta, M.R.; Lanzillotti, C.; Mazziotta, C.; Bononi, I.; Frontini, F.; Mazzoni, E.; Oton-Gonzalez, L.; Rotondo, J.C.; Torreggiani, E.; Tognon, M.; et al. The role of microRNAs in the osteogenic and chondrogenic differentiation of mesenchymal stem cells and bone pathologies. Theranostics 2021, 11, 6573–6591. [Google Scholar] [CrossRef] [PubMed]
- McBeath, R.; Pirone, D.M.; Nelson, C.M.; Bhadriraju, K.; Chen, C.S. Cell shape, cytoskeletal tension, and RhoA regulate stem cell lineage commitment. Dev. Cell. 2004, 6, 483–495. [Google Scholar] [CrossRef] [PubMed]
- Viklund, I.M.; Aspenström, P.; Meas-Yedid, V.; Zhang, B.; Kopec, J.; Agren, D.; Schneider, G.; D’Amato, M.; Olivo-Marin, J.C.; Sansonetti, P.; et al. WAFL, a new protein involved in regulation of early endocytic transport at the intersection of actin and microtubule dynamics. Exp. Cell Res. 2009, 315, 1040–1052. [Google Scholar] [CrossRef]
- Cahill, D.R.; Marks, S.C., Jr. Tooth eruption: Evidence for the central role of the dental follicle. J. Oral. Pathol. 1980, 9, 189–200. [Google Scholar] [CrossRef]
- Zhou, T.; Pan, J.; Wu, P.; Huang, R.; Du, W.; Zhou, Y.; Wan, M.; Fan, Y.; Xu, X.; Zhou, X.; et al. Dental follicle cells: Roles in development and beyond. Stem Cells Int. 2019, 2019, 9159605. [Google Scholar] [CrossRef] [PubMed]
- Mori, G.; Ballini, A.; Carbone, C.; Oranger, A.; Brunetti, G.; Di Benedetto, A.; Rapone, B.; Cantore, S.; Di Comite, M.; Colucci, S.; et al. Osteogenic differentiation of dental follicle stem cells. Int. J. Med. Sci. 2012, 9, 480–487. [Google Scholar] [CrossRef]
- Shoi, K.; Aoki, K.; Ohya, K.; Takagi, Y.; Shimokawa, H. Characterization of pulp and follicle stem cells from impacted supernumerary maxillary incisors. Pediatr. Dent. 2014, 36, 79–84. [Google Scholar]
- Zhao, Y.; Sun, Q.; Wang, S.; Huo, B. Spreading shape and area regulate the osteogenesis of mesenchymal stem cells. Tissue Eng. Regen. Med. 2019, 16, 573–583. [Google Scholar] [CrossRef]
- Sikavitsas, V.I.; Temenoff, J.S.; Mikos, A.G. Biomaterials and bone mechanotransduction. Biomaterials. 2001, 22, 2581–2593. [Google Scholar] [CrossRef] [PubMed]
- Ingber, D. How cells (might) sense microgravity. FASEB J. 1999, 13, S3–S15. [Google Scholar] [CrossRef] [PubMed]
- Toma, C.D.; Ashkar, S.; Gray, M.L.; Schaffer, J.L.; Gerstenfeld, L.C. Signal transduction of mechanical stimuli is dependent on microfilament integrity: Identification of osteopontin as a mechanically induced gene in osteoblasts. J. Bone Miner. Res. 1997, 12, 1626–1636. [Google Scholar] [CrossRef]
- Grigoriadis, A.E.; Heersche, J.N.; Aubin, J.E. Differentiation of muscle, fat, cartilage, and bone from progenitor cells present in a bone-derived clonal cell population: Effect of dexamethasone. J. Cell Biol. 1988, 106, 2139–2151. [Google Scholar] [CrossRef]
- Kang, C.B.; Hong, Y.; Dhe-Paganon, S.; Yoon, H.S. FKBP family proteins: Immunophilins with versatile biological functions. Neurosignals 2008, 16, 318–325. [Google Scholar] [CrossRef] [PubMed]
- Nakajima, O.; Nakamura, F.; Yamashita, N.; Tomita, Y.; Suto, F.; Okada, T.; Iwamatsu, A.; Kondo, E.; Fujisawa, H.; Takei, K.; et al. FKBP133: A novel mouse FK506-binding protein homolog alters growth cone morphology. Biochem. Biophys. Res. Commun. 2006, 346, 140–149. [Google Scholar] [CrossRef]
- Ghafouri-Fard, S.; Abak, A.; Tavakkoli Avval, S.; Rahmani, S.; Shoorei, H.; Taheri, M.; Samadian, M. Contribution of miRNAs and lncRNAs in osteogenesis and related disorders. Biomed. Pharmacother. 2021, 142, 111942. [Google Scholar] [CrossRef]
- Hensley, A.P.; McAlinden, A. The role of microRNAs in bone development. Bone 2021, 143, 115760. [Google Scholar] [CrossRef]
- Chen, P.; Wei, D.; Xie, B.; Ni, J.; Xuan, D.; Zhang, J. Effect and possible mechanism of network between microRNAs and RUNX2 gene on human dental follicle cells. J. Cell Biochem. 2014, 115, 340–348. [Google Scholar] [CrossRef]
- Ge, J.; Guo, S.; Fu, Y.; Zhou, P.; Zhang, P.; Du, Y.; Li, M.; Cheng, J.; Jiang, H. Dental follicle cells participate in tooth eruption via the RUNX2-MiR-31-SATB2 loop. J. Dent. Res. 2015, 94, 936–944. [Google Scholar] [CrossRef] [PubMed]
- Felthaus, O.; Gosau, M.; Morsczeck, C. ZBTB16 induces osteogenic differentiation marker genes in dental follicle cells independent from RUNX2. J. Periodontol. 2014, 85, e144–e151. [Google Scholar] [CrossRef] [PubMed]
- Kato, M.; Patel, M.S.; Levasseur, R.; Lobov, I.; Chang, B.H.; Glass, D.A., 2nd; Hartmann, C.; Li, L.; Hwang, T.H.; Brayton, C.F.; et al. Cbfa1-independent decrease in osteoblast proliferation, osteopenia, and persistent embryonic eye vascularization in mice deficient in Lrp5, a Wnt coreceptor. J. Cell Biol. 2002, 157, 303–314. [Google Scholar] [CrossRef] [PubMed]
- Cheng, S.L.; Shao, J.S.; Charlton-Kachigian, N.; Loewy, A.P.; Towler, D.A. MSX2 promotes osteogenesis and suppresses adipogenic differentiation of multipotent mesenchymal progenitors. J. Biol. Chem. 2003, 278, 45969–45977. [Google Scholar] [CrossRef] [PubMed]
- Ikeda, R.; Yoshida, K.; Tsukahara, S.; Sakamoto, Y.; Tanaka, H.; Furukawa, K.; Inoue, I. The promyelotic leukemia zinc finger promotes osteoblastic differentiation of human mesenchymal stem cells as an upstream regulator of CBFA1. J. Biol. Chem. 2005, 280, 8523–8530. [Google Scholar] [CrossRef]
- Felthaus, O.; Gosau, M.; Klein, S.; Prantl, L.; Reichert, T.E.; Schmalz, G.; Morsczeck, C. Dexamethasone-related osteogenic differentiation of dental follicle cells depends on ZBTB16 but not Runx2. Cell Tissue Res. 2014, 357, 695–705. [Google Scholar] [CrossRef]
- Lee, M.H.; Kwon, T.G.; Park, H.S.; Wozney, J.M.; Ryoo, H.M. BMP-2-induced Osterix expression is mediated by Dlx5 but is independent of Runx2. Biochem. Biophys. Res. Commun. 2003, 309, 689–694. [Google Scholar] [CrossRef]
- Shi, H.; Wei, J.; He, C. Where, when, and how: Context-dependent functions of RNA methylation writers, readers, and erasers. Mol. Cell. 2019, 74, 640–650. [Google Scholar] [CrossRef]
- Zaccara, S.; Ries, R.J.; Jaffrey, S.R. Reading, writing and erasing mRNA methylation. Nat. Rev. Mol. Cell Biol. 2019, 20, 608–624. [Google Scholar] [CrossRef]
- Chen, L.S.; Zhang, M.; Chen, P.; Xiong, X.F.; Liu, P.Q.; Wang, H.B.; Wang, J.J.; Shen, J. The m6A demethylase FTO promotes the osteogenesis of mesenchymal stem cells by downregulating PPARG. Acta Pharmacol. Sin. 2022, 43, 1311–1323. [Google Scholar] [CrossRef]
- Mauer, J.; Luo, X.; Blanjoie, A.; Jiao, X.; Grozhik, A.V.; Patil, D.P.; Linder, B.; Pickering, B.F.; Vasseur, J.J.; Chen, Q.; et al. Reversible methylation of m6Am in the 5′ cap controls mRNA stability. Nature 2017, 541, 371–375. [Google Scholar] [CrossRef] [PubMed]





| Gene | Forward (5′-3′) | Reverse (5′-3′) |
|---|---|---|
| FTO | AGCATGGCTGCTTATTTCGG | GAGCCTGGTGTTCAGGTACT |
| ALKBH5 | AGATCGCCTGTCAGGAAACA | GACTTGCGCCAGTAGTTCTC |
| METTL14 | AATCGCCTCCTCCCAAATCT | CCACCTCTTTCTCCTCGGAA |
| FKBP15 | ACCACAGATGACCTCACAGG | AGCTGAGTGGGAATCGAGAG |
| OCN | ATGAGAGCCCTCACACTCCT | CTTGGACACAAAGGCTGCAC |
| OPN | ACACATATGATGGCCGAGGT | CTCGCTTTCCATGTGTGAGG |
| RUNX2 | CCTCGGAGAGGTACCAGATG | GGTGAAACTCTTGCCTCGTC |
| Osterix | CATCTGCCTGGCTCCTTG | CAGGGGACTGGAGCCATA |
| GAPDH | TGCCCAGAACATCATCCCTG | GATACATTGGGGGTGGGGAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zheng, L.; Li, Z.; Wang, B.; Sun, R.; Sun, Y.; Ren, J.; Zhao, J. M6A Demethylase Inhibits Osteogenesis of Dental Follicle Stem Cells via Regulating miR-7974/FKBP15 Pathway. Int. J. Mol. Sci. 2023, 24, 16121. https://doi.org/10.3390/ijms242216121
Zheng L, Li Z, Wang B, Sun R, Sun Y, Ren J, Zhao J. M6A Demethylase Inhibits Osteogenesis of Dental Follicle Stem Cells via Regulating miR-7974/FKBP15 Pathway. International Journal of Molecular Sciences. 2023; 24(22):16121. https://doi.org/10.3390/ijms242216121
Chicago/Turabian StyleZheng, Linwei, Zhizheng Li, Bing Wang, Rui Sun, Yuqi Sun, Jiangang Ren, and Jihong Zhao. 2023. "M6A Demethylase Inhibits Osteogenesis of Dental Follicle Stem Cells via Regulating miR-7974/FKBP15 Pathway" International Journal of Molecular Sciences 24, no. 22: 16121. https://doi.org/10.3390/ijms242216121
APA StyleZheng, L., Li, Z., Wang, B., Sun, R., Sun, Y., Ren, J., & Zhao, J. (2023). M6A Demethylase Inhibits Osteogenesis of Dental Follicle Stem Cells via Regulating miR-7974/FKBP15 Pathway. International Journal of Molecular Sciences, 24(22), 16121. https://doi.org/10.3390/ijms242216121

