Screening and Validation of Appropriate Reference Genes for Real-Time Quantitative PCR under PEG, NaCl and ZnSO4 Treatments in Broussonetia papyrifera
Abstract
:1. Introduction
2. Results
2.1. Determination of Primer Specificity and Amplification Efficiency
2.2. Ct Values of the Internal Reference Genes
2.3. geNorm Analysis
2.4. NormFinder Analysis
2.5. BestKeeper Analysis
2.6. RefFinder Analysis
2.7. Verification of the Expression Stability of the Internal Reference Genes
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Extraction and Detection of RNA
4.3. Synthesis of cDNA
4.4. Screening of Candidate Internal Reference Genes and Designing of Primers
4.5. RT-qPCR Reaction Conditions
4.6. Detection of Primer Specificity and Amplification Efficiency
4.7. The Stability of Candidate Internal Reference Genes
4.8. Verification of the Expression Stability of the Internal Reference Genes
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Peng, X.J.; Shen, S.H. The Paper Mulberry: A Novel Model System for Woody Plant Research. Chin. Bull. Bot. 2018, 53, 372–381. [Google Scholar] [CrossRef]
 - Wang, G.W.; Huang, B.K.; Qin, L.P. The Genus Broussonetia: A Review of its Phytochemistry and Pharmacology. Phytother. Res. 2012, 26, 1–10. [Google Scholar] [CrossRef] [PubMed]
 - Si, B.W.; Tao, H.; Zhang, X.L.; Guo, J.P.; Cui, K.; Tu, Y.; Diao, Q.Y. Effect of Broussonetia papyrifera L. (Paper Mulberry) Silage on Dry Matter Intake, Milk Composition, Antioxidant Capacity and Milk Fatty Acid Profile in Dairy Cows. Asian. Austral. J. Anim. 2018, 31, 1259–1266. [Google Scholar] [CrossRef] [PubMed]
 - Han, Q.H.; Wu, Z.l.; Huang, B.; Sun, L.Q.; Ding, C.B.; Yuan, S.; Zhang, Z.W.; Chen, Y.E.; Hu, C.; Zhou, L.J.; et al. Extraction, Antioxidant and Antibacterial Activities of Broussonetia papyrifera Fruits Polysaccharides. Int. J. Biol. Macromol. 2016, 92, 116–124. [Google Scholar] [CrossRef] [PubMed]
 - Guo, F.J.; Feng, L.; Huang, C.; Ding, H.X.; Zhang, X.T.; Wang, Z.Y.; Li, Y.M. Prenylflavone Derivatives from Broussonetia papyrifera, Inhibit the Growth of Breast Cancer Cells in Vitro and in Vivo. Phytochem. Lett. 2013, 6, 331–336. [Google Scholar] [CrossRef]
 - Park, J.Y.; Yuk, H.J.; Ryu, H.W.; Lim, S.H.; Kim, K.S.; Park, K.H.; Ryu, Y.B.; Lee, W.S. Evaluation of Polyphenols from Broussonetia papyrifera as Coronavirus Protease Inhibitors. J. Enzyme Inhib. Med. Chem. 2017, 32, 504–515. [Google Scholar] [CrossRef] [PubMed]
 - Zeng, P.; Guo, Z.H.; Xiao, X.Y.; Zhou, H.; Gu, J.; Liao, B. Tolerance capacities of Broussonetia papyrifera to heavy metal(loid)s and its phytoremediation potential of the contaminated soil. Int. J. Phytorem. 2022, 24, 580–589. [Google Scholar] [CrossRef] [PubMed]
 - Zhang, M.; Fang, Y.M.; Ji, Y.H.; Jiang, Z.P.; Wang, L. Effects of salt stress on ion content, antioxidant enzymes and protein profile in different tissues of Broussonetia papyrifera. S. Afr. J. Bot. 2013, 85, 1–9. [Google Scholar] [CrossRef]
 - Ding, F.; Yang, F.; Li, D.L.; Du, T.Z. Studies on the anatomical structure characteristic and drought resistance of Broussonetia papyrifera. J. Anhui Agric. Sci. 2010, 38, 20949–20952. [Google Scholar] [CrossRef]
 - Jin, Q.; Wu, L.; Zhao, Y.L.; Yang, G.Y.; Tang, T.C.; Ma, Y.Z.; Xu, Z.G. Methods for Rapid Seed Germination of Broussonetia papyrifera. Pak. J. Bot. 2023, 55, 941–948. [Google Scholar] [CrossRef]
 - Zhang, W.; Zhao, Y.L.; Xu, Z.G.; Huang, H.M.; Zhou, J.K.; Yang, G.Y. Morphological and Physiological Changes of Broussonetia papyrifera Seedlings in Cadmium Contaminated Soil. Plants 2020, 9, 1698. [Google Scholar] [CrossRef] [PubMed]
 - Xu, B.C.; Hao, K.Y.; Chen, X.G.; Wu, E.Y.; Nie, D.Y.; Zhang, G.Y.; Si, H.B. Broussonetia papyrifera Polysaccharide Alleviated Acetaminophen-Induced Liver Injury by Regulating the Intestinal Flora. Nutrients 2022, 14, 2636. [Google Scholar] [CrossRef] [PubMed]
 - Zhao, M.J.; Lv, D.L.; Hu, J.C.; He, Y.L.; Wang, Z.; Liu, X.Y.; Ran, B.K.; Hu, J.H. Hybrid Broussonetia papyrifera Fermented Feed Can Play a Role Through Flavonoid Extracts to Increase Milk Production and Milk Fatty Acid Synthesis in Dairy Goats. Front. Vet. Sci. 2022, 9, 794443. [Google Scholar] [CrossRef] [PubMed]
 - Huang, H.M.; Zhao, Y.L.; Xu, Z.G.; Zhang, W.; Jiang, K.K. Physiological Responses of Broussonetia papyrifera to Manganese Stress, a Candidate Plant for Phytoremediation. Ecotox. Environ. Saf. 2019, 181, 18–25. [Google Scholar] [CrossRef] [PubMed]
 - Abdallah, H.B.; Bauer, P. Quantitative Reverse Transcription-qPCR-Based Gene Expression Analysis in Plants. Methods Mol. Biol. 2016, 1363, 9–24. [Google Scholar] [CrossRef] [PubMed]
 - Die, J.V.; Román, B. RNA Quality Assessment: A View from Plant qPCR Studies. J. Exp. Bot. 2012, 63, 6069–6077. [Google Scholar] [CrossRef] [PubMed]
 - Zhan, X.Y.; Cui, H.L.; Ji, X.J.; Xue, J.A.; Jia, X.Y.; Li, R.Z. Selection of the optimal reference genes for transcript expression analysis of lipid biosynthesis-related genes in Okra (Abelmoschus esculentus). Sci. Hortic. 2021, 282, 110044. [Google Scholar] [CrossRef]
 - Soni, P.; Shivhare, R.; Kaur, A.; Bansal, S.; Ram, H. Reference Gene Identification for Gene Expression Analysis in Rice under Different Metal Stress. J. Biotechnol. 2021, 332, 83–93. [Google Scholar] [CrossRef]
 - Wei, T.L.; Wang, H.; Pei, M.S.; Liu, H.N.; Yu, Y.H.; Jiang, J.F.; Guo, D.L. Identification of Optimal and Novel Reference Genes for Quantitative Real-Time Polymerase Chain Reaction Analysis in Grapevine. Aust. J. Grape Wine Res. 2021, 27, 325–333. [Google Scholar] [CrossRef]
 - Lin, S.k.; Xu, S.c.; Huang, L.y.; Qiu, F.x.; Zheng, Y.h.; Liu, Q.h.; Ma, S.w.; Wu, B.; Wu, J.c. Selection and Validation of Reference Genes for Normalization of RT-qPCR Analysis in Developing or Abiotic-Stressed Tissues of Loquat (Eriobotrya japonica). Phyton-Int. J. Exp. Bot. 2023, 92, 1185–1201. [Google Scholar] [CrossRef]
 - Chauhan, A.S.; Tiwari, M.; Indoliya, Y.; Mishra, S.K.; Lavania, U.C.; Chauhan, P.S.; Chakrabarty, D.; Tripathi, R.D. Identification and Validation of Reference Genes in Vetiver (Chrysopogon zizanioides) Root Transcriptome. Physiol. Mol. Biol. Plants. 2023, 29, 613–627. [Google Scholar] [CrossRef]
 - Škiljaica, A.; Jagić, M.; Vuk, T.; Leljak Levanić, D.; Bauer, N.; Markulin, L. Evaluation of Reference Genes for RT-qPCR Gene Expression Analysis in Arabidopsis thaliana Exposed to Elevated Temperatures. Plant Biol. 2022, 24, 367–379. [Google Scholar] [CrossRef] [PubMed]
 - Zhao, G.J.; Wang, M.; Gan, Y.Q.; Gong, H.; Li, J.X.; Zheng, X.M.; Liu, X.X.; Zhao, S.Y.; Luo, J.N.; Wu, H.B. Identification of suitable reference genes for quantitative reverse transcription PCR in Luffa (Luffa cylindrica). Physiol. Mol. Biol. Plants 2022, 28, 737–747. [Google Scholar] [CrossRef] [PubMed]
 - Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate Normalization of Real-Time Quantitative RT-PCR Data by Geometric Averaging of Multiple Internal Control Genes. Genome Biol. 2002, 3, research0034.1. [Google Scholar] [CrossRef] [PubMed]
 - Andersen, C.L.; Jensen, J.L.; Orntoft, T.F. Normalization of Real-Time Quantitative Reverse Transcription-PCR Data: A Model-Based Variance Estimation Approach to Identify Genes Suited for Normalization, Applied to Bladder and Colon Cancer Data Sets. Cancer Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef] [PubMed]
 - Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of Stable Housekeeping Genes, Differentially Regulated Target Genes and Sample Integrity: Bestkeeper-Excel-Based Tool Using Pair-Wise Correlations. Biotechnol. Lett. 2004, 26, 509–515. [Google Scholar] [CrossRef] [PubMed]
 - Xie, F.; Wang, J.; Zhang, B. RefFinder: A Web-Based Tool for Comprehensively Analyzing and Identifying Reference Genes. Funct. Integr. Genomics. 2023, 23, 125. [Google Scholar] [CrossRef]
 - Zandalinas, S.I.; Fichman, Y.; Devireddy, A.R.; Sengupta, S.; Azad, R.K.; Mittler, R. Systemic Signaling During Abiotic Stress Combination in Plants. Proc. Natl. Acad. Sci. USA 2020, 117, 13810–13820. [Google Scholar] [CrossRef]
 - Bustin, S.A.; Benes, V.; Nolan, T.; Pfaffl, M.W. Quantitative Real-Time RT-PCR - a Perspective. J. Mol. Endocrinol. 2005, 34, 597–601. [Google Scholar] [CrossRef]
 - Kozera, B.; Rapacz, M. Reference genes in real-time PCR. J. Appl. Genet. 2013, 54, 391–406. [Google Scholar] [CrossRef]
 - Ahmed, U.; Xie, Q.; Shi, X.P.; Zheng, B. Development of Reference Genes for Horticultural Plants. Crit. Rev. Plant Sci. 2022, 41, 190–208. [Google Scholar] [CrossRef]
 - dos Santos, C.P.; da Cruz Saraiva, K.D.; Batista, M.C.; Germano, T.A.; Costa, J.H. Identification and Evaluation of Reference Genes for Reliable Normalization of Real-Time Quantitative PCR Data in Acerola Fruit, Leaf, and Flower. Mol. Biol. Rep. 2020, 47, 953–965. [Google Scholar] [CrossRef] [PubMed]
 - Zhang, C.; Jiang, Q.N.; Wang, Y.G.; Fu, J.X.; Dong, B.; Zhou, L.H.; Zhao, H.B. Transcriptome-Based Validation of Proper Reference Genes for Reverse Transcription Quantitative PCR Analysis of Sinocalycanthus chinensis. Biol. Plant. 2020, 64, 253–257. [Google Scholar] [CrossRef]
 - Zhao, Z.; Zhang, Z.; Ding, Z.; Meng, H.; Shen, R.; Tang, H.; Liu, Y.G.; Chen, L. Public-Transcriptome-Database-Assisted Selection and Validation of Reliable Reference Genes for qRT-PCR in Rice. Sci. China-Life Sci. 2020, 63, 92–101. [Google Scholar] [CrossRef] [PubMed]
 - Mo, Z.H.; Chen, Y.Q.; Lou, W.R.; Jia, X.D.; Zhai, M.; Xuan, J.P.; Guo, Z.R.; Li, Y.R. Identification of Suitable Reference Genes for Normalization of Real-Time Quantitative PCR Data in Pecan (Carya illinoinensis). Trees 2020, 34, 1233–1241. [Google Scholar] [CrossRef]
 - Zhao, M.Q.; Fan, H.; Tu, Z.H.; Cai, G.J.; Zhang, L.M.; Li, A.D.; Xu, M. Stable Reference Gene Selection for Quantitative Real-Time PCR Normalization in Passion Fruit (Passiflora edulis Sims.). Mol. Biol. Rep. 2022, 49, 5985–5995. [Google Scholar] [CrossRef] [PubMed]
 - Shen, J.S.; Wu, Y.T.; Jiang, Z.Y.; Xu, Y.; Zheng, T.C.; Wang, J.; Cheng, T.R.; Zhang, Q.X.; Pan, H.T. Selection and Validation of Appropriate Reference Genes for Gene Expression Studies in Forsythia. Physiol. Mol. Biol. Plants 2020, 26, 173–188. [Google Scholar] [CrossRef]
 - Zhu, X.L.; Wang, B.Q.; Wang, X.; Wei, X.H. Screening of Stable Internal Reference Gene of Quinoa under Hormone Treatment and Abiotic Stress. Physiol. Mol. Biol. Plants 2021, 27, 2459–2470. [Google Scholar] [CrossRef]
 - Amiruddin, N.; Chan, P.L.; Chan, K.L.; Ong, P.W.; Morris, P.E.; Ong-Abdullaw, M.; Masura, S.S.; Low, E.T.L. Determination of Reliable Reference Genes for Reverse Transcription Quantitative Real-Time PCR from Oil Palm Transcriptomes. J. Oil Palm Res. 2022, 34, 439–452. [Google Scholar] [CrossRef]
 - Agarwal, P.K.; Gupta, K.; Lopato, S.; Agarwal, P. Dehydration Responsive Element Binding Transcription Factors and Their Applications for the Engineering of Stress Tolerance. J. Exp. Bot. 2017, 68, 2135–2148. [Google Scholar] [CrossRef]
 - Erpen, L.; Devi, H.S.; Grosser, J.W.; Dutt, M. Potential Use of the DREB/ERF, MYB, NAC and WRKY Transcription Factors to Improve Abiotic and Biotic Stress in Transgenic Plants. Plant Cell Tissue Organ Cult. 2018, 132, 1–25. [Google Scholar] [CrossRef]
 - Jangale, B.L.; Chaudhari, R.S.; Azeez, A.; Sane, P.V.; Sane, A.P.; Krishna, B. Independent and Combined Abiotic Stresses Affect the Physiology and Expression Patterns of Dreb Genes Differently in Stress-Susceptible and Resistant Genotypes of Banana. Physiol. Plant. 2019, 165, 303–318. [Google Scholar] [CrossRef] [PubMed]
 - Zhou, Y.X.; Zhou, W.; Liu, H.; Liu, P.; Li, Z.G. Genome-Wide Analysis of the Soybean DREB Gene Family: Identification, Genomic Organization and Expression Profiles in Response to Drought Stress. Plant Breed. 2020, 139, 1158–1167. [Google Scholar] [CrossRef]
 - Ali, N.; Hadi, F. CBF/DREB Transcription Factor Genes Play Role in Cadmium Tolerance and Phytoaccumulation in Ricinus communis under Molybdenum Treatments. Chemosphere 2018, 208, 425–432. [Google Scholar] [CrossRef] [PubMed]
 - Onele, A.; Mazina, A.; Leksin, I.; Chasov, A.; Minibayeva, F.; Beckett, R. Class III Peroxidase Genes in the Moss Dicranum scoparium: Identification and Abiotic Stress Induced Expression Analysis. S. Afr. J. Bot. 2023, 159, 72–84. [Google Scholar] [CrossRef]
 - Wang, J.E.; Liu, K.K.; Li, D.W.; Zhang, Y.L.; Zhao, Q.; He, Y.M.; Gong, Z.H. A Novel Peroxidase CanPOD Gene of Pepper Is Involved in Defense Responses to Phytophthora capsici Infection as Well as Abiotic Stress Tolerance. Int. J. Mol. Sci. 2013, 14, 3158–3177. [Google Scholar] [CrossRef]
 - Lee, C.J.; Park, S.U.; Kim, S.E.; Lim, Y.H.; Ji, C.Y.; Kim, Y.H.; Kim, H.S.; Kwak, S.S. Overexpression of IbLfp in Sweetpotato Enhances the Low-Temperature Storage Ability of Tuberous Roots. Plant Physiol. Biochem. 2021, 167, 577–585. [Google Scholar] [CrossRef]
 - Gao, C.Q.; Wang, Y.C.; Liu, G.F.; Wang, C.; Jiang, J.; Yang, C.P. Cloning of Ten Peroxidase (POD) Genes from Tamarix hispida and Characterization of Their Responses to Abiotic Stress. Plant Mol. Biol. Rep. 2010, 28, 77–89. [Google Scholar] [CrossRef]
 






| Gene | Primer ID | Primer sequence (5′-3′) | Amplicon Size (Bp) | Efficiency (%) | R2 | 
|---|---|---|---|---|---|
| NADH | NADH-F | GGACAGGTGGAAGATCGTCTG | 111 | 97.18 | 0.987 | 
| NADH-R | GGAATCTTCAGAACCCCGGAA | ||||
| L13 | L13-F | TGCCAGCCCTAACTTTCATGT | 126 | 92.17 | 0.999 | 
| L13-R | AGACCCGGAGAAGAATTGCTC | ||||
| EIF3 | EIF3-F | GTCCACATCATTCGAAGCAGC | 130 | 106.31 | 0.997 | 
| EIF3-R | GATCTATGAAGTGCCTGCGGA | ||||
| HIS | HIS-F | TGGCCTTGCATTCTCCAGTAG | 118 | 98.87 | 0.996 | 
| HIS-R | GACAAGCTGCGAGAGTGGTAT | ||||
| Actin | Actin-F | TACGCATTGAAGACCCTCCAC | 148 | 90.26 | 0.998 | 
| Actin-R | TGGCCACACTTGCTTAGACAA | ||||
| PP2A | PP2A-F | TCCTTTTGCGAGTCGATGGAA | 119 | 117.99 | 0.988 | 
| PP2A-R | CTTTGACGTTTGAAGCGAGCA | ||||
| DOUB | DOUB-F | CCTGATCTTCGCCGGAAAACA | 194 | 97.48 | 0.999 | 
| DOUB-R | TGGAGAGGGTTGAAGAGAGCT | ||||
| UBE2 | UBE2-F | TCTCTGCTTACGGACCCAAAC | 144 | 92.29 | 0.998 | 
| UBE2-R | GAGGAGGAGCTATTGGGCCTA | ||||
| UBC | UBC-F | AGCATTACTTTCCGCTCCACA | 119 | 91.44 | 0.995 | 
| UBC-R | TGGCGAAAGTTTCTGTCCAGT | ||||
| PTB | PTB-F | CTGGAAACCTGCTGCCTTTTC | 151 | 96.29 | 0.999 | 
| PTB-R | ATTGAGGGTGTAGAAGCTGGC | ||||
| rRNA | rRNA-F | CAGGTTTCGATGTTGGGGAGA | 196 | 95.56 | 0.999 | 
| rRNA-R | CCAGCTTCCGAGAACATTCCT | ||||
| GAPDH | GAPDH-F | CCATGGAAGGACTTGGGGATC | 156 | 90.43 | 0.995 | 
| GAPDH-R | GTTCACTCCCACCACGTATGT | ||||
| HSP | HSP-F | CCAGCGCTGATGTTAGATTGC | 174 | 92.66 | 0.993 | 
| HSP-R | TTGCCATCAGAGCCTTTTCCT | ||||
| RPL8 | RPL8-F | TGATCACCGACATCATCCACG | 185 | 90.55 | 0.992 | 
| RPL8-R | TCTGATCGGAAGGACATTGCC | ||||
| TUA | TUA-F | TCGAAAGGCCAACATACACCA | 175 | 96.59 | 0.997 | 
| TUA-R | GAGATGACAGGGGCATACGAG | ||||
| POD | POD-F | CTCCTGTGACCTCAACTGCAA | 136 | 91.71 | 0.987 | 
| POD-R | GAGTTGAACCATGGCGCAAAT | ||||
| DREB | DREB-F | TAAACCAGCTCACCCAATCCC | 274 | 90.99 | 0.989 | 
| DREB-R | CGGTTCTTGGGGAGTCTGATC | 
| Rank | Drought Stress | Salt Stress | Heavy Metal Stress | Different Tissues | All Samples | |||||
|---|---|---|---|---|---|---|---|---|---|---|
| Gene | Stability | Gene | Stability | Gene | Stability | Gene | Stability | Gene | Stability | |
| 1 | DOUB | 0.152 | DOUB | 0.172 | HSP | 0.359 | rRNA | 0.051 | rRNA | 0.338 | 
| 2 | rRNA | 0.162 | HSP | 0.396 | rRNA | 0.362 | Actin | 0.222 | HSP | 0.383 | 
| 3 | Actin | 0.394 | NADH | 0.540 | NADH | 0.401 | EIF3 | 0.229 | NADH | 0.495 | 
| 4 | HSP | 0.429 | rRNA | 0.569 | UBC | 0.513 | TUA | 0.343 | PP2A | 0.691 | 
| 5 | UBC | 0.436 | PP2A | 0.630 | DOUB | 0.707 | DOUB | 0.346 | UBC | 0.738 | 
| 6 | PTB | 0.520 | HIS | 0.635 | HIS | 0.745 | PP2A | 0.383 | Actin | 0.751 | 
| 7 | EIF3 | 0.547 | UBC | 0.654 | Actin | 0.805 | PTB | 0.383 | DOUB | 0.753 | 
| 8 | TUA | 0.586 | L13 | 0.720 | PP2A | 0.907 | HIS | 0.456 | PTB | 0.792 | 
| 9 | PP2A | 0.596 | Actin | 0.742 | PTB | 0.969 | NADH | 0.484 | HIS | 0.966 | 
| 10 | NADH | 0.616 | PTB | 0.817 | L13 | 0.992 | HSP | 0.493 | L13 | 1.028 | 
| 11 | RPL8 | 0.729 | TUA | 1.133 | RPL8 | 1.265 | UBC | 0.503 | TUA | 1.090 | 
| 12 | HIS | 0.917 | EIF3 | 1.461 | TUA | 1.400 | L13 | 0.557 | EIF3 | 1.277 | 
| 13 | L13 | 0.998 | UBE2 | 1.791 | GAPDH | 1.511 | RPL8 | 0.836 | RPL8 | 1.598 | 
| 14 | UBE2 | 1.090 | RPL8 | 1.924 | EIF3 | 1.672 | GAPDH | 1.178 | UBE2 | 1.652 | 
| 15 | GAPDH | 4.183 | GAPDH | 2.216 | UBE2 | 1.921 | UBE2 | 1.727 | GAPDH | 2.786 | 
| Rank | Drought Stress | Salt Stress | Heavy Metal Stress | Different Tissues | All Samples | |||||
|---|---|---|---|---|---|---|---|---|---|---|
| Gene | Stability | Gene | Stability | Gene | Stability | Gene | Stability | Gene | Stability | |
| 1 | UBC | 0.398 | HSP | 0.453 | UBC | 0.382 | HSP | 0.215 | HSP | 0.518 | 
| 2 | rRNA | 0.465 | NADH | 0.49 | NADH | 0.416 | RPL8 | 0.216 | UBC | 0.535 | 
| 3 | HSP | 0.481 | DOUB | 0.521 | HSP | 0.439 | DOUB | 0.256 | NADH | 0.607 | 
| 4 | DOUB | 0.513 | UBC | 0.561 | rRNA | 0.493 | UBC | 0.475 | DOUB | 0.615 | 
| 5 | PP2A | 0.515 | HIS | 0.596 | DOUB | 0.524 | NADH | 0.489 | Actin | 0.643 | 
| 6 | Actin | 0.530 | PP2A | 0.609 | Actin | 0.607 | Actin | 0.514 | PP2A | 0.647 | 
| 7 | EIF3 | 0.557 | rRNA | 0.723 | PP2A | 0.645 | PP2A | 0.566 | rRNA | 0.672 | 
| 8 | PTB | 0.634 | L13 | 0.729 | HIS | 0.741 | L13 | 0.588 | TUA | 0.886 | 
| 9 | RPL8 | 0.639 | Actin | 0.772 | L13 | 0.768 | EIF3 | 0.622 | L13 | 0.913 | 
| 10 | TUA | 0.671 | TUA | 0.784 | PTB | 0.866 | TUA | 0.641 | PTB | 0.917 | 
| 11 | NADH | 0.727 | PTB | 0.871 | RPL8 | 0.972 | rRNA | 0.650 | HIS | 1.018 | 
| 12 | UBE2 | 0.844 | EIF3 | 1.336 | TUA | 1.088 | HIS | 0.651 | EIF3 | 1.023 | 
| 13 | L13 | 0.928 | UBE2 | 1.356 | GAPDH | 1.137 | PTB | 0.819 | RPL8 | 1.353 | 
| 14 | HIS | 0.982 | RPL8 | 1.551 | EIF3 | 1.303 | GAPDH | 1.213 | UBE2 | 1.477 | 
| 15 | GAPDH | 3.496 | GAPDH | 1.554 | UBE2 | 1.593 | UBE2 | 1.619 | GAPDH | 2.123 | 
| Rank | Drought Stress | Salt Stress | Heavy Metal Stress | Different Tissues | All Samples | |||||
|---|---|---|---|---|---|---|---|---|---|---|
| Gene | Stability | Gene | Stability | Gene | Stability | Gene | Stability | Gene | Stability | |
| 1 | rRNA | 2.115 | DOUB | 1.316 | HSP | 1.316 | EIF3 | 2.28 | HSP | 1.414 | 
| 2 | Actin | 2.449 | HSP | 1.414 | NADH | 2.06 | Actin | 3.13 | rRNA | 1.627 | 
| 3 | UBC | 2.590 | NADH | 3.31 | rRNA | 2.632 | PP2A | 3.742 | NADH | 3 | 
| 4 | DOUB | 3.130 | rRNA | 3.984 | UBC | 2.828 | rRNA | 4.031 | UBC | 3.761 | 
| 5 | EIF3 | 3.956 | HIS | 4.949 | DOUB | 5.477 | DOUB | 4.787 | PP2A | 5.091 | 
| 6 | HSP | 4.899 | PP2A | 5.733 | HIS | 5.886 | HSP | 5.477 | Actin | 5.477 | 
| 7 | PP2A | 6.160 | UBC | 6.293 | Actin | 6.735 | NADH | 6.344 | DOUB | 5.856 | 
| 8 | PTB | 7.416 | L13 | 7.737 | PP2A | 7.737 | UBC | 6.477 | PTB | 8.459 | 
| 9 | NADH | 9.124 | Actin | 9 | PTB | 9.487 | L13 | 7.502 | L13 | 9.24 | 
| 10 | TUA | 9.685 | PTB | 10.241 | L13 | 9.487 | TUA | 7.933 | HIS | 9.975 | 
| 11 | RPL8 | 10.215 | TUA | 10.741 | RPL8 | 11 | RPL8 | 8.142 | TUA | 10.158 | 
| 12 | HIS | 12.471 | EIF3 | 12 | TUA | 12.243 | PTB | 8.596 | EIF3 | 12 | 
| 13 | L13 | 13 | UBE2 | 13 | GAPDH | 13.243 | HIS | 10.843 | RPL8 | 13 | 
| 14 | UBE2 | 13.471 | RPL8 | 14 | EIF3 | 13.741 | GAPDH | 14 | UBE2 | 14 | 
| 15 | GAPDH | 15 | GAPDH | 15 | UBE2 | 15 | UBE2 | 15 | GAPDH | 15 | 
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.  | 
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, M.; Wang, Z.; Hao, Z.; Li, H.; Feng, Q.; Yang, X.; Han, X.; Zhao, X. Screening and Validation of Appropriate Reference Genes for Real-Time Quantitative PCR under PEG, NaCl and ZnSO4 Treatments in Broussonetia papyrifera. Int. J. Mol. Sci. 2023, 24, 15087. https://doi.org/10.3390/ijms242015087
Chen M, Wang Z, Hao Z, Li H, Feng Q, Yang X, Han X, Zhao X. Screening and Validation of Appropriate Reference Genes for Real-Time Quantitative PCR under PEG, NaCl and ZnSO4 Treatments in Broussonetia papyrifera. International Journal of Molecular Sciences. 2023; 24(20):15087. https://doi.org/10.3390/ijms242015087
Chicago/Turabian StyleChen, Mengdi, Zhengbo Wang, Ziyuan Hao, Hongying Li, Qi Feng, Xue Yang, Xiaojiao Han, and Xiping Zhao. 2023. "Screening and Validation of Appropriate Reference Genes for Real-Time Quantitative PCR under PEG, NaCl and ZnSO4 Treatments in Broussonetia papyrifera" International Journal of Molecular Sciences 24, no. 20: 15087. https://doi.org/10.3390/ijms242015087
APA StyleChen, M., Wang, Z., Hao, Z., Li, H., Feng, Q., Yang, X., Han, X., & Zhao, X. (2023). Screening and Validation of Appropriate Reference Genes for Real-Time Quantitative PCR under PEG, NaCl and ZnSO4 Treatments in Broussonetia papyrifera. International Journal of Molecular Sciences, 24(20), 15087. https://doi.org/10.3390/ijms242015087
        
