Profiling Chromatin Accessibility Responses in Goat Bronchial Epithelial Cells Infected with Pasteurella multocida
Abstract
1. Introduction
2. Results
2.1. Changes in Cell Morphology
2.2. ATAC−Seq Quality Control of the Goat Bronchial Epithelial Cells
2.3. Identification of Chromatin Open Regions by ATAC-Seq
2.4. Peak−Related Gene Analysis and Annotation in Each Group
2.5. Peak-Related MOTIF Analysis and Transcriptional Factors Enrichment
2.6. Corresponding Genes Analysis of the Different Peaks between the Two Groups
2.7. Transcription Factor Motif Analysis of Different Peaks between the Two Groups
2.8. Differentially Expressed Genes Identified by RNA−Seq
2.9. Integrated Analysis of Specific Peak−Associated Genes and DEGs in Different Groups
3. Discussion
4. Materials and Methods
4.1. Bacterial Preparation
4.2. Cell Culture and Infection
4.3. ATAC−Seq and Bioinformatics Analysis
4.4. Differential Analysis of Multi-Samples
4.5. Motif analysis
4.6. RNA−Seq and qRT−PCR Validation
4.7. Integrated Analysis of ATAC−Seq and RNA−Seq
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Wilson, B.A.; Ho, M. Pasteurella multocida: From zoonosis to cellular microbiology. Clin. Microbiol. Rev. 2013, 26, 631–655. [Google Scholar] [CrossRef] [PubMed]
- Kristinsson, G. Pasteurella multocida infections. Pediatr. Rev. 2007, 28, 472–473. [Google Scholar] [CrossRef] [PubMed]
- Horiguchi, Y. Swine atrophic rhinitis caused by pasteurella multocida toxin and bordetella dermonecrotic toxin. Curr. Top. Microbiol. Immunol. 2012, 361, 113–129. [Google Scholar] [CrossRef]
- Harper, M.; Boyce, J.D.; Adler, B. Pasteurella multocida pathogenesis: 125 years after Pasteur. FEMS Microbiol. Lett. 2006, 265, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Invernizzi, R.; Lloyd, C.M.; Molyneaux, P.L. Respiratory microbiome and epithelial interactions shape immunity in the lungs. Immunology 2020, 160, 171–182. [Google Scholar] [CrossRef]
- Hiemstra, P.S.; McCray, P.B., Jr.; Bals, R. The innate immune function of airway epithelial cells in inflammatory lung disease. Eur. Respir. J. 2015, 45, 1150–1162. [Google Scholar] [CrossRef]
- Leiva-Juarez, M.M.; Kolls, J.K.; Evans, S.E. Lung epithelial cells: Therapeutically inducible effectors of antimicrobial defense. Mucosal. Immunol. 2018, 11, 21–34. [Google Scholar] [CrossRef]
- Gallego, C.; Romero, S.; Esquinas, P.; Patino, P.; Martinez, N.; Iregui, C. Assessment of Pasteurella multocida A Lipopolysaccharide, as an Adhesin in an In Vitro Model of Rabbit Respiratory Epithelium. Vet. Med. Int. 2017, 2017, 8967618. [Google Scholar] [CrossRef]
- An, Q.; Chen, S.; Zhang, L.; Zhang, Z.; Cheng, Y.; Wu, H.; Liu, A.; Chen, Z.; Li, B.; Chen, J.; et al. The mRNA and miRNA profiles of goat bronchial epithelial cells stimulated by Pasteurella multocida strains of serotype A and D. PeerJ 2022, 10, e13047. [Google Scholar] [CrossRef]
- Wang, X.; Wang, F.; Lin, L.; Liang, W.; Liu, S.; Hua, L.; Wang, X.; Chen, H.; Peng, Z.; Wu, B. Transcriptome Differences in Pig Tracheal Epithelial Cells in Response to Pasteurella Multocida Infection. Front. Vet. Sci. 2021, 8, 682514. [Google Scholar] [CrossRef]
- Tsompana, M.; Buck, M.J. Chromatin accessibility: A window into the genome. Epigenet. Chromatin 2014, 7, 33. [Google Scholar] [CrossRef]
- Buenrostro, J.D.; Giresi, P.G.; Zaba, L.C.; Chang, H.Y.; Greenleaf, W.J. Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position. Nat. Methods 2013, 10, 1213–1218. [Google Scholar] [CrossRef]
- Chen, M.; Zhang, Z.; Meng, Z.Y.; Zhang, X.J. ATAC-seq and its applications in complex disease. Yi Chuan 2020, 42, 347–353. [Google Scholar] [CrossRef]
- Monaco, A.; Ovryn, B.; Axis, J.; Amsler, K. The Epithelial Cell Leak Pathway. Int. J. Mol. Sci. 2021, 22, 7677. [Google Scholar] [CrossRef]
- Otani, T.; Furuse, M. Tight Junction Structure and Function Revisited. Trends Cell Biol. 2020, 30, 805–817. [Google Scholar] [CrossRef]
- Murphy, K.N.; Brinkworth, A.J. Manipulation of Focal Adhesion Signaling by Pathogenic Microbes. Int. J. Mol. Sci. 2021, 22, 1358. [Google Scholar] [CrossRef]
- Park, H.; Cox, D. Cdc42 regulates Fc gamma receptor-mediated phagocytosis through the activation and phosphorylation of Wiskott-Aldrich syndrome protein (WASP) and neural-WASP. Mol. Biol. Cell 2009, 20, 4500–4508. [Google Scholar] [CrossRef]
- Doherty, G.J.; McMahon, H.T. Mechanisms of endocytosis. Annu. Rev. Biochem. 2009, 78, 857–902. [Google Scholar] [CrossRef]
- Foerster, E.G.; Mukherjee, T.; Cabral-Fernandes, L.; Rocha, J.D.B.; Girardin, S.E.; Philpott, D.J. How autophagy controls the intestinal epithelial barrier. Autophagy 2022, 18, 86–103. [Google Scholar] [CrossRef]
- Xiao, Y.; Cai, W. Autophagy and Bacterial Infection. Adv. Exp. Med. Biol. 2020, 1207, 413–423. [Google Scholar] [CrossRef]
- Castrejon-Jimenez, N.S.; Leyva-Paredes, K.; Hernandez-Gonzalez, J.C.; Luna-Herrera, J.; Garcia-Perez, B.E. The role of autophagy in bacterial infections. Biosci. Trends 2015, 9, 149–159. [Google Scholar] [CrossRef] [PubMed]
- Bejjani, F.; Evanno, E.; Zibara, K.; Piechaczyk, M.; Jariel-Encontre, I. The AP-1 transcriptional complex: Local switch or remote command? Biochim. Biophys. Acta Rev. Cancer 2019, 1872, 11–23. [Google Scholar] [CrossRef] [PubMed]
- Almuttaqi, H.; Udalova, I.A. Advances and challenges in targeting IRF5, a key regulator of inflammation. FEBS J. 2019, 286, 1624–1637. [Google Scholar] [CrossRef] [PubMed]
- Dideberg, V.; Kristjansdottir, G.; Milani, L.; Libioulle, C.; Sigurdsson, S.; Louis, E.; Wiman, A.C.; Vermeire, S.; Rutgeerts, P.; Belaiche, J.; et al. An insertion-deletion polymorphism in the interferon regulatory Factor 5 (IRF5) gene confers risk of inflammatory bowel diseases. Hum. Mol. Genet. 2007, 16, 3008–3016. [Google Scholar] [CrossRef] [PubMed]
- Takaoka, A.; Yanai, H.; Kondo, S.; Duncan, G.; Negishi, H.; Mizutani, T.; Kano, S.; Honda, K.; Ohba, Y.; Mak, T.W.; et al. Integral role of IRF-5 in the gene induction programme activated by Toll-like receptors. Nature 2005, 434, 243–249. [Google Scholar] [CrossRef]
- Balkhi, M.Y.; Fitzgerald, K.A.; Pitha, P.M. Functional regulation of MyD88-activated interferon regulatory factor 5 by K63-linked polyubiquitination. Mol. Cell. Biol. 2008, 28, 7296–7308. [Google Scholar] [CrossRef]
- Boursalian, T.E.; McEarchern, J.A.; Law, C.L.; Grewal, I.S. Targeting CD70 for human therapeutic use. Adv. Exp. Med. Biol. 2009, 647, 108–119. [Google Scholar] [CrossRef]
- Jacobs, J.; Deschoolmeester, V.; Zwaenepoel, K.; Rolfo, C.; Silence, K.; Rottey, S.; Lardon, F.; Smits, E.; Pauwels, P. CD70: An emerging target in cancer immunotherapy. Pharmacol. Ther. 2015, 155, 1–10. [Google Scholar] [CrossRef]
- Nolte, M.A.; van Olffen, R.W.; van Gisbergen, K.P.; van Lier, R.A. Timing and tuning of CD27-CD70 interactions: The impact of signal strength in setting the balance between adaptive responses and immunopathology. Immunol. Rev. 2009, 229, 216–231. [Google Scholar] [CrossRef]
- Han, B.K.; White, A.M.; Dao, K.H.; Karp, D.R.; Wakeland, E.K.; Davis, L.S. Increased prevalence of activated CD70+CD4+ T cells in the periphery of patients with systemic lupus erythematosus. Lupus 2005, 14, 598–606. [Google Scholar] [CrossRef]
- Lee, W.W.; Yang, Z.Z.; Li, G.; Weyand, C.M.; Goronzy, J.J. Unchecked CD70 expression on T cells lowers threshold for T cell activation in rheumatoid arthritis. J. Immunol. 2007, 179, 2609–2615. [Google Scholar] [CrossRef]
- Bradley, J.R. TNF-mediated inflammatory disease. J. Pathol. 2008, 214, 149–160. [Google Scholar] [CrossRef]
- Aggarwal, B.B.; Gupta, S.C.; Kim, J.H. Historical perspectives on tumor necrosis factor and its superfamily: 25 years later, a golden journey. Blood 2012, 119, 651–665. [Google Scholar] [CrossRef]
- Oeckinghaus, A.; Ghosh, S. The NF-kappaB family of transcription factors and its regulation. Cold Spring Harb. Perspect. Biol. 2009, 1, a000034. [Google Scholar] [CrossRef]
- Cristobal, I.; Blanco, F.J.; Garcia-Orti, L.; Marcotegui, N.; Vicente, C.; Rifon, J.; Novo, F.J.; Bandres, E.; Calasanz, M.J.; Bernabeu, C.; et al. SETBP1 overexpression is a novel leukemogenic mechanism that predicts adverse outcome in elderly patients with acute myeloid leukemia. Blood 2010, 115, 615–625. [Google Scholar] [CrossRef]
- Ng, W.L.; Marinov, G.K.; Chin, Y.M.; Lim, Y.Y.; Ea, C.K. Transcriptomic analysis of the role of RasGEF1B circular RNA in the TLR4/LPS pathway. Sci. Rep. 2017, 7, 12227. [Google Scholar] [CrossRef]
- Leao, F.B.; Vaughn, L.S.; Bhatt, D.; Liao, W.; Maloney, D.; Carvalho, B.C.; Oliveira, L.; Ghosh, S.; Silva, A.M. Toll-like Receptor (TLR)-induced Rasgef1b expression in macrophages is regulated by NF-kappaB through its proximal promoter. Int. J. Biochem. Cell Biol. 2020, 127, 105840. [Google Scholar] [CrossRef]
- Wang, S.; Qiu, J.; Liu, L.; Su, C.; Qi, L.; Huang, C.; Chen, X.; Zhang, Y.; Ye, Y.; Ding, Y.; et al. CREB5 promotes invasiveness and metastasis in colorectal cancer by directly activating MET. J. Exp. Clin. Cancer Res. 2020, 39, 168. [Google Scholar] [CrossRef]
- Langmead, B.; Salzberg, S.L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 2012, 9, 357–359. [Google Scholar] [CrossRef]
- Zhang, Y.; Liu, T.; Meyer, C.A.; Eeckhoute, J.; Johnson, D.S.; Bernstein, B.E.; Nusbaum, C.; Myers, R.M.; Brown, M.; Li, W.; et al. Model-based analysis of ChIP-Seq (MACS). Genome Biol. 2008, 9, R137. [Google Scholar] [CrossRef]
- Yu, G.; Wang, L.G.; He, Q.Y. ChIPseeker: An R/Bioconductor package for ChIP peak annotation, comparison and visualization. Bioinformatics 2015, 31, 2382–2383. [Google Scholar] [CrossRef] [PubMed]
- Stark, R.; Brown, G. DiffBind Differential Binding Analysis of ChIP-Seq Peak Data. University of Cambridge/Cancer Research UK–Cambridge Institute. 2011. Available online: http://bioconductor.org/packages/release/bioc/vignettes/DiffBind/inst/doc/DiffBind.pdf (accessed on 29 November 2022).
Sample | Raw Reads | Clean Reads (%) | Mitochondria Mapped Reads (%) | Goat Mapped Reads (%) | Pasteurella Mapped Reads (%) |
---|---|---|---|---|---|
CK-1 | 43,714,258 | 42,997,192 (98.36%) | 3,504,534 (8.02%) | 39,163,518 (89.59%) | 4862 (0.01%) |
CK-2 | 28,669,772 | 27,967,118 (97.55%) | 2,324,160 (8.11%) | 24,433,370 (85.22%) | 3548 (0.01%) |
CK-3 | 28,947,450 | 28,242,082 (97.56%) | 2,603,258 (8.99%) | 24,526,906 (84.73%) | 4744 (0.02%) |
T-1 | 48,363,990 | 47,514,406 (98.24%) | 3,217,946 (6.65%) | 43,472,734 (89.89%) | 6566 (0.01%) |
T-2 | 41,106,300 | 40,322,350 (98.09%) | 2,538,132 (6.17%) | 36,377,884 (88.5%) | 6618 (0.02%) |
T-3 | 42,871,856 | 42,062,878 (98.11%) | 3,014,546 (7.03%) | 37,990,568 (88.61%) | 6436 (0.02%) |
Sample Id | Peak Number | Total Length | Average Length | Genome Ratio |
---|---|---|---|---|
T-1 | 33,333 | 11,792,578 | 353 | 0.40% |
T-2 | 39,685 | 15,043,263 | 379 | 0.51% |
T-3 | 26,048 | 9,125,900 | 350 | 0.31% |
T-common | 28,722 | 14,398,456 | 501 | 0.49% |
CK-1 | 16,622 | 5,357,070 | 322 | 0.18% |
CK-2 | 12,829 | 3,920,020 | 305 | 0.13% |
CK-3 | 16,500 | 5,291,746 | 320 | 0.18% |
CK-common | 13,079 | 5,496,690 | 420 | 0.19% |
Gene Names | Primer Sequence (5′-3′) | Product Size (bp) |
---|---|---|
CREB5 | F: AGCAGAACCACCCACATC R: ATCCTCATCCACCACCCT | 197 |
IL12RB2 | F: TGTTCACTGGCACTTACTT R: GCCTTGTTTGGGCTTCA | 153 |
IL6R | F: GGCAACATCTCAGTCAGCG R: CCACTCCAGGCATCACG | 197 |
DUSP4 | F: AGCACAGCGGAGTCTTTGGA R: CGAAGTGGTTTGGGCAGTCA | 190 |
TLR7 | F: CACGCCCATCTTTGACTTCG R: CACCAGGACCAGGCTCTTCT | 151 |
GAPDH | F: CTCTCTGCTCCTGCCCGTTC R: TGTGCCGTGGAACTTGCCAT | 241 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, Q.; Chen, Z.; Zhang, Z.; Pan, H.; Li, H.; Li, X.; An, Q.; Cheng, Y.; Chen, S.; Man, C.; et al. Profiling Chromatin Accessibility Responses in Goat Bronchial Epithelial Cells Infected with Pasteurella multocida. Int. J. Mol. Sci. 2023, 24, 1312. https://doi.org/10.3390/ijms24021312
Chen Q, Chen Z, Zhang Z, Pan H, Li H, Li X, An Q, Cheng Y, Chen S, Man C, et al. Profiling Chromatin Accessibility Responses in Goat Bronchial Epithelial Cells Infected with Pasteurella multocida. International Journal of Molecular Sciences. 2023; 24(2):1312. https://doi.org/10.3390/ijms24021312
Chicago/Turabian StyleChen, Qiaoling, Zhen Chen, Zhenxing Zhang, Haoju Pan, Hong Li, Xubo Li, Qi An, Yiwen Cheng, Si Chen, Churiga Man, and et al. 2023. "Profiling Chromatin Accessibility Responses in Goat Bronchial Epithelial Cells Infected with Pasteurella multocida" International Journal of Molecular Sciences 24, no. 2: 1312. https://doi.org/10.3390/ijms24021312
APA StyleChen, Q., Chen, Z., Zhang, Z., Pan, H., Li, H., Li, X., An, Q., Cheng, Y., Chen, S., Man, C., Du, L., & Wang, F. (2023). Profiling Chromatin Accessibility Responses in Goat Bronchial Epithelial Cells Infected with Pasteurella multocida. International Journal of Molecular Sciences, 24(2), 1312. https://doi.org/10.3390/ijms24021312