Comparison of Virulence-Factor-Encoding Genes and Genotype Distribution amongst Clinical Pseudomonas aeruginosa Strains
Abstract
:1. Introduction
2. Results
2.1. The Origin and Prevalence of Virulence-Factor-Encoding Genes among MDR and MDS P. aeruginosa Strains
2.2. Prevalence of the Observed Genotypes
3. Discussion
4. Materials and Methods
4.1. The Examined Strains
4.2. Antimicrobial Susceptibility Testing and Strain Selection Criteria
4.3. Bacterial DNA Isolation
4.4. Virulence Factors Genes Detection
4.5. Statistical Methods
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Myles, I.A.; Moore, I.N.; Castillo, C.R.; Datta, S.K. Differing Virulence of Healthy Skin Commensals in Mouse Models of Infection. Front. Cell. Infect. Microbiol. 2019, 8, 451. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Crone, S.; Vives-Flórez, M.; Kvich, L.; Saunders, A.M.; Malone, M.; Nicolaisen, M.H.; Martínez-García, E.; Rojas-Acosta, C.; Catalina Gomez-Puerto, M.; Calum, H.; et al. The Environmental Occurrence of Pseudomonas aeruginosa. APMIS 2020, 128, 220–231. [Google Scholar] [CrossRef] [PubMed]
- Thi, M.T.T.; Wibowo, D.; Rehm, B.H.A. Pseudomonas aeruginosa Biofilms. Int. J. Mol. Sci. 2020, 21, 8671. [Google Scholar] [CrossRef] [PubMed]
- Laborda, P.; Hernando-Amado, S.; Martínez, J.L.; Sanz-García, F. Antibiotic Resistance in Pseudomonas. Adv. Exp. Med. Biol. 2022, 1386, 117–143. [Google Scholar] [CrossRef]
- Qin, S.; Xiao, W.; Zhou, C.; Pu, Q.; Deng, X.; Lan, L.; Liang, H.; Song, X.; Wu, M. Pseudomonas aeruginosa: Pathogenesis, Virulence Factors, Antibiotic Resistance, Interaction with Host, Technology Advances and Emerging Therapeutics. Signal Transduct. Target. Ther. 2022, 7, 199. [Google Scholar] [CrossRef]
- Botelho, J.; Grosso, F.; Peixe, L. Antibiotic Resistance in Pseudomonas aeruginosa—Mechanisms, Epidemiology and Evolution. Drug Resist. Updat. 2019, 44, 100640. [Google Scholar] [CrossRef]
- Tuon, F.F.; Dantas, L.R.; Suss, P.H.; Tasca Ribeiro, V.S. Pathogenesis of the Pseudomonas aeruginosa Biofilm: A Review. Pathogens 2022, 11, 300. [Google Scholar] [CrossRef]
- De Oliveira, D.M.P.; Forde, B.M.; Kidd, T.J.; Harris, P.N.A.; Schembri, M.A.; Beatson, S.A.; Paterson, D.L.; Walker, M.J. Antimicrobial Resistance in ESKAPE Pathogens. Clin. Microbiol. Rev. 2020, 33, e00181-19. [Google Scholar] [CrossRef]
- Miyoshi-Akiyama, T.; Tada, T.; Ohmagari, N.; Viet Hung, N.; Tharavichitkul, P.; Pokhrel, B.M.; Gniadkowski, M.; Shimojima, M.; Kirikae, T. Emergence and Spread of Epidemic Multidrug-Resistant Pseudomonas aeruginosa. Genome Biol. Evol. 2017, 9, 3238–3245. [Google Scholar] [CrossRef]
- Pachori, P.; Gothalwal, R.; Gandhi, P. Emergence of Antibiotic Resistance Pseudomonas aeruginosa in Intensive Care Unit; a Critical Review. Genes Dis. 2019, 6, 109–119. [Google Scholar] [CrossRef]
- Urbanowicz, P.; Gniadkowski, M. “Ciężkozbrojny” Pseudomonas aeruginosa: Mechanizmy lekooporności i ich tło genetyczne. Kosmos 2017, 66, 11–29. [Google Scholar]
- De Sousa, T.; Hébraud, M.; Dapkevicius, M.L.N.E.; Maltez, L.; Pereira, J.E.; Capita, R.; Alonso-Calleja, C.; Igrejas, G.; Poeta, P. Genomic and Metabolic Characteristics of the Pathogenicity in Pseudomonas aeruginosa. Int. J. Mol. Sci. 2021, 22, 12892. [Google Scholar] [CrossRef] [PubMed]
- Prioritization of Pathogens to Guide Discovery, Research and Development of New Antibiotics for Drug-Resistant Bacterial Infections, Including Tuberculosis. Available online: https://www.who.int/publications-detail-redirect/WHO-EMP-IAU-2017.12 (accessed on 19 November 2022).
- Litwin, A.; Rojek, S.; Gozdzik, W.; Duszynska, W. Pseudomonas aeruginosa Device Associated—Healthcare Associated Infections and Its Multidrug Resistance at Intensive Care Unit of University Hospital: Polish, 8.5-Year, Prospective, Single-Centre Study. BMC Infect. Dis. 2021, 21, 180. [Google Scholar] [CrossRef]
- Galdino, A.C.M.; de Oliveira, M.P.; Ramalho, T.C.; de Castro, A.A.; Branquinha, M.H.; Santos, A.L.S. Anti-Virulence Strategy against the Multidrug-Resistant Bacterial Pathogen Pseudomonas aeruginosa: Pseudolysin (Elastase B) as a Potential Druggable Target. Curr. Protein Pept. Sci. 2019, 20, 471–487. [Google Scholar] [CrossRef] [PubMed]
- Elmouaden, C.; Laglaoui, A.; Ennanei, L.; Bakkali, M.; Abid, M. Virulence Genes and Antibiotic Resistance of Pseudomonas aeruginosa Isolated from Patients in the Northwestern of Morocco. J. Infect. Dev. Ctries. 2019, 13, 892–898. [Google Scholar] [CrossRef]
- Ratajczak, M.; Kamińska, D.; Nowak-Malczewska, D.M.; Schneider, A.; Dlugaszewska, J. Relationship between Antibiotic Resistance, Biofilm Formation, Genes Coding Virulence Factors and Source of Origin of Pseudomonas aeruginosa Clinical Strains. Ann. Agric. Environ. Med. AAEM 2021, 28, 306–313. [Google Scholar] [CrossRef]
- Al Dawodeyah, H.Y.; Obeidat, N.; Abu-Qatouseh, L.F.; Shehabi, A.A. Antimicrobial Resistance and Putative Virulence Genes of Pseudomonas aeruginosa Isolates from Patients with Respiratory Tract Infection. Germs 2018, 8, 31–40. [Google Scholar] [CrossRef]
- Benie, C.K.D.; Dadié, A.; Guessennd, N.; N’gbesso-Kouadio, N.A.; Kouame, N.D.; N’golo, D.C.; Aka, S.; Dako, E.; Dje, K.M.; Dosso, M. Characterization of Virulence Potential of Pseudomonas aeruginosa Isolated from Bovine Meat, Fresh Fish, and Smoked Fish. Eur. J. Microbiol. Immunol. 2017, 7, 55–64. [Google Scholar] [CrossRef] [Green Version]
- Kaszab, E.; Radó, J.; Kriszt, B.; Pászti, J.; Lesinszki, V.; Szabó, A.; Tóth, G.; Khaledi, A.; Szoboszlay, S. Groundwater, Soil and Compost, as Possible Sources of Virulent and Antibiotic-Resistant Pseudomonas aeruginosa. Int. J. Environ. Health Res. 2021, 31, 848–860. [Google Scholar] [CrossRef] [Green Version]
- Monturiol-Gross, L.; Villalta-Romero, F.; Flores-Díaz, M.; Alape-Girón, A. Bacterial Phospholipases C with Dual Activity: Phosphatidylcholinesterase and Sphingomyelinase. FEBS Open Bio. 2021, 11, 3262–3275. [Google Scholar] [CrossRef]
- Bogiel, T.; Depka, D.; Rzepka, M.; Mikucka, A. Decoding Genetic Features and Antimicrobial Susceptibility of Pseudomonas aeruginosa Strains Isolated from Bloodstream Infections. Int. J. Mol. Sci. 2022, 23, 9208. [Google Scholar] [CrossRef] [PubMed]
- Rossi Gonçalves, I.; Dantas, R.C.C.; Ferreira, M.L.; Batistão, D.W.F.; Gontijo-Filho, P.P.; Ribas, R.M. Carbapenem-Resistant Pseudomonas aeruginosa: Association with Virulence Genes and Biofilm Formation. Braz. J. Microbiol. 2016, 48, 211–217. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wolska, K.; Szweda, P. Genetic Features of Clinical Pseudomonas aeruginosa Strains. Pol. J. Microbiol. 2009, 58, 255–260. [Google Scholar] [PubMed]
- Foulkes, D.M.; McLean, K.; Haneef, A.S.; Fernig, D.G.; Winstanley, C.; Berry, N.; Kaye, S.B. Pseudomonas aeruginosa Toxin ExoU as a Therapeutic Target in the Treatment of Bacterial Infections. Microorganisms 2019, 7, 707. [Google Scholar] [CrossRef] [Green Version]
- Naik, P.; Pandey, S.; Gagan, S.; Biswas, S.; Joseph, J. Virulence Factors in Multidrug (MDR) and Pan-Drug Resistant (XDR) Pseudomonas aeruginosa: A Cross-Sectional Study of Isolates Recovered from Ocular Infections in a High-Incidence Setting in Southern India. J. Ophthalmic Inflamm. Infect. 2021, 11, 36. [Google Scholar] [CrossRef]
- Mitov, I.; Strateva, T.; Markova, B. Prevalence of Virulence Genes among Bulgarian Nosocomial and Cystic Fibrosis Isolates of Pseudomonas aeruginosa. Braz. J. Microbiol. Publ. Braz. Soc. Microbiol. 2010, 41, 588–595. [Google Scholar] [CrossRef]
- Horna, G.; Amaro, C.; Palacios, A.; Guerra, H.; Ruiz, J. High Frequency of the ExoU+/ExoS+ Genotype Associated with Multidrug-Resistant “High-Risk Clones” of Pseudomonas aeruginosa Clinical Isolates from Peruvian Hospitals. Sci. Rep. 2019, 9, 10874. [Google Scholar] [CrossRef] [Green Version]
- Subedi, D.; Vijay, A.K.; Kohli, G.S.; Rice, S.A.; Willcox, M. Association between Possession of ExoU and Antibiotic Resistance in Pseudomonas aeruginosa. PLoS ONE 2018, 13, e0204936. [Google Scholar] [CrossRef] [Green Version]
- Wolska, K.; Kot, B.; Mioduszewska, H.; Sempruch, C.; Borkowska, L.; Rymuza, K. Occurrence of the nan1 gene and adhesion of Pseudomonas aeruginosa isolates to human buccal epithelial cells. Biol. Lett. 2012, 49, 59–64. [Google Scholar] [CrossRef] [Green Version]
- Soong, G.; Muir, A.; Gomez, M.I.; Waks, J.; Reddy, B.; Planet, P.; Singh, P.K.; Kaneko, Y.; Kanetko, Y.; Wolfgang, M.C.; et al. Bacterial Neuraminidase Facilitates Mucosal Infection by Participating in Biofilm Production. J. Clin. Invest. 2006, 116, 2297–2305. [Google Scholar] [CrossRef] [Green Version]
- Elmaraghy, N.; Abbadi, S.; Elhadidi, G.; Hashem, A.; Yousef, A. Virulence Genes in Pseudomonas aeruginosa Strains Isolated at Suez Canal University Hospitals with Respect to the Site of Infection and Antimicrobial Resistance. Int. J. Clin. Microbiol. Biochem. Technol. 2019, 2, 8–19. [Google Scholar] [CrossRef]
- Nikbin, V.S.; Aslani, M.M.; Sharafi, Z.; Hashemipour, M.; Shahcheraghi, F.; Ebrahimipour, G.H. Molecular Identification and Detection of Virulence Genes among Pseudomonas aeruginosa Isolated from Different Infectious Origins. Iran. J. Microbiol. 2012, 4, 118–123. [Google Scholar] [PubMed]
- Haghi, F.; Zeighami, H.; Monazami, A.; Toutouchi, F.; Nazaralian, S.; Naderi, G. Diversity of Virulence Genes in Multidrug Resistant Pseudomonas aeruginosa Isolated from Burn Wound Infections. Microb. Pathog. 2018, 115, 251–256. [Google Scholar] [CrossRef]
- Rezaloo, M.; Motalebi, A.; Mashak, Z.; Anvar, A. Prevalence, Antimicrobial Resistance, and Molecular Description of Pseudomonas aeruginosa Isolated from Meat and Meat Products. J. Food Qual. 2022, 2022, 1–11. [Google Scholar] [CrossRef]
- Deptuła, A.; Gospodarek, E. Reduced Expression of Virulence Factors in Multidrug-Resistant Pseudomonas aeruginosa Strains. Arch. Microbiol. 2010, 192, 79–84. [Google Scholar] [CrossRef] [PubMed]
- Bogiel, T.; Mikucka, A.; Skalski, T.; Gospodarek, E. Occurrence and susceptibility to antibiotics of carbapenem-resistant Pseudomonas aeruginosa strains between 1998 and 2009. Med. Dosw. Mikrobiol. 2010, 62, 221–229. [Google Scholar] [PubMed]
- Sonbol, F.; Khalil, M.; Mohamed, A.; Ali, S. Correlation between Antibiotic Resistance and Virulence Of Pseudomonas aeruginosa Clinical Isolates. Turk. J. Med. Sci. 2015, 45, 568–577. [Google Scholar] [CrossRef]
- Hassuna, N.A.; Mandour, S.A.; Mohamed, E.S. Virulence Constitution of Multi-Drug-Resistant Pseudomonas aeruginosa in Upper Egypt. Infect. Drug Resist. 2020, 13, 587–595. [Google Scholar] [CrossRef] [Green Version]
- Gajdács, M.; Baráth, Z.; Kárpáti, K.; Szabó, D.; Usai, D.; Zanetti, S.; Donadu, M.G. No Correlation between Biofilm Formation, Virulence Factors, and Antibiotic Resistance in Pseudomonas aeruginosa: Results from a Laboratory-Based In Vitro Study. Antibiotics 2021, 10, 1134. [Google Scholar] [CrossRef]
- Hwang, W.; Yoon, S.S. Virulence Characteristics and an Action Mode of Antibiotic Resistance in Multidrug-Resistant Pseudomonas aeruginosa. Sci. Rep. 2019, 9, 487. [Google Scholar] [CrossRef] [Green Version]
- Magiorakos, A.-P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-Resistant, Extensively Drug-Resistant and Pandrug-Resistant Bacteria: An International Expert Proposal for Interim Standard Definitions for Acquired Resistance. Clin. Microbiol. Infect. Off. Publ. Eur. Soc. Clin. Microbiol. Infect. Dis. 2012, 18, 268–281. [Google Scholar] [CrossRef] [PubMed]
- Finnan, S.; Morrissey, J.P.; O’Gara, F.; Boyd, E.F. Genome Diversity of Pseudomonas aeruginosa Isolates from Cystic Fibrosis Patients and the Hospital Environment. J. Clin. Microbiol. 2004, 42, 5783–5792. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lanotte, P.; Watt, S.; Mereghetti, L.; Dartiguelongue, N.; Rastegar-Lari, A.; Goudeau, A.; Quentin, R. Genetic Features of Pseudomonas aeruginosa Isolates from Cystic Fibrosis Patients Compared with Those of Isolates from Other Origins. J. Med. Microbiol. 2004, 53, 73–81. [Google Scholar] [CrossRef] [PubMed]
- Ajayi, T.; Allmond, L.R.; Sawa, T.; Wiener-Kronish, J.P. Single-Nucleotide-Polymorphism Mapping of the Pseudomonas aeruginosa Type III Secretion Toxins for Development of a Diagnostic Multiplex PCR System. J. Clin. Microbiol. 2003, 41, 3526–3531. [Google Scholar] [CrossRef] [PubMed]
Genotype | Gene Presence (+) or Absence (-) in a Particular Genotype | ||||||||
---|---|---|---|---|---|---|---|---|---|
Name | n | % | lasB | plC N | plC H | exoU | nan1 | pilA | pilB |
I-S | 1 | 1.4 | + | + | + | + | + | - | + |
II-S | 10 | 13.5 | + | + | + | + | + | - | - |
III-S | 15 | 20.3 | + | + | + | + | - | - | - |
IV-S | 1 | 1.4 | + | + | + | - | + | + | - |
V-S | 6 | 8.1 | + | + | + | - | + | - | - |
VI-S | 2 | 2.7 | + | + | + | - | - | + | - |
VII-S | 22 | 29.7 | + | + | + | - | - | - | - |
VIII-S | 1 | 1.4 | + | + | - | + | + | - | - |
IX-S | 2 | 2.7 | + | + | - | + | - | - | - |
X-S | 2 | 2.7 | + | - | + | + | + | - | - |
XI-S | 1 | 1.4 | + | - | + | + | - | - | - |
XII-S | 1 | 1.4 | + | - | + | - | + | + | - |
XIII-S | 1 | 1.4 | + | - | + | - | + | - | - |
XIV-S | 2 | 2.7 | + | - | - | + | - | - | - |
XV-S | 1 | 1.4 | + | - | - | - | - | - | - |
XVI-S | 2 | 2.7 | - | + | - | + | - | - | - |
XVII-S | 3 | 4.1 | - | + | - | - | - | - | - |
XVIII-S | 1 | 1.4 | - | - | - | - | - | - | - |
Genotype | Gene Presence (+) or Absence (-) in a Particular Genotype | ||||||||
---|---|---|---|---|---|---|---|---|---|
name | n | % | lasB | plC N | plC H | exoU | nan1 | pilA | pilB |
I-R | 1 | 1.8 | + | + | + | + | + | + | - |
II-R | 8 | 14.0 | + | + | + | + | + | - | - |
III-R | 20 | 35.1 | + | + | + | + | - | - | - |
IV-R | 1 | 1.8 | + | + | + | - | + | + | + |
V-R | 5 | 8.8 | + | + | + | - | + | - | - |
VI-R | 1 | 1.8 | + | + | + | - | - | + | - |
VII-R | 19 | 33.3 | + | + | + | - | - | - | - |
VIII-R | 1 | 1.8 | + | + | - | + | + | - | - |
IX-R | 1 | 1.8 | + | + | - | - | - | - | - |
Virulence Factor Detected | Gene/PCR Primer Name | Manufacturer | Primer Sequence 5′→3′ | Tm (°C) | Annealing Temperature (°C) | Amplicon Size (bp) |
---|---|---|---|---|---|---|
Exotoxin U | exoU F | Sigma | CCGTTGTGGTGCCGTTGAAG | 55.9 | 64 | 134 |
exoU R | CCAGATGTTCACCGACTCGC | 55.9 | ||||
Phospholipase C (non-hemolytic) | plC N F | Integrated DNA Technologies | GTTATCGCAACCAGCCCTAC | 55.9 | 54 | 466 |
plC N R | AGGTCGAACACCTGGAACAC | 57.2 | ||||
Phospholipase C (hemolytic) | plC H F | GAAGCCATGGGCTACTTCAA | 55.1 | 50 | 307 | |
plC H R | AGAGTGACGAGGAGCGGTAG | 58.2 | ||||
Elastase B | lasB F | Genomed | GGAATGAACGAAGCGTTCTC | 51.8 | 50 | 300 |
lasB R | GGTCCAGTAGTAGCGGTTGG | 55.9 | ||||
Pilin A | pilA F | ACAGCATCCAACTGAGCG | 50.3 | 59 | 1675 | |
pilA R | TTGACTTCCTCCAGGCTG | 50.3 | ||||
Pilin B | pilB F | TCGAACTGATGATCGTGG | 48.0 | 56 | 408 | |
pilB R | CTTTCGGAGTGAACATCG | 48.0 | ||||
Neuraminidase 1 | nan1 F | AGGATGAATACTTATTTTGAT | 42.6 | 47 | 1316 | |
nan1 R | TCACTAAATCCATCTCTGACCCGATA | 56.4 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bogiel, T.; Depka, D.; Kruszewski, S.; Rutkowska, A.; Kanarek, P.; Rzepka, M.; Leitão, J.H.; Deptuła, A.; Gospodarek-Komkowska, E. Comparison of Virulence-Factor-Encoding Genes and Genotype Distribution amongst Clinical Pseudomonas aeruginosa Strains. Int. J. Mol. Sci. 2023, 24, 1269. https://doi.org/10.3390/ijms24021269
Bogiel T, Depka D, Kruszewski S, Rutkowska A, Kanarek P, Rzepka M, Leitão JH, Deptuła A, Gospodarek-Komkowska E. Comparison of Virulence-Factor-Encoding Genes and Genotype Distribution amongst Clinical Pseudomonas aeruginosa Strains. International Journal of Molecular Sciences. 2023; 24(2):1269. https://doi.org/10.3390/ijms24021269
Chicago/Turabian StyleBogiel, Tomasz, Dagmara Depka, Stanisław Kruszewski, Adrianna Rutkowska, Piotr Kanarek, Mateusz Rzepka, Jorge H. Leitão, Aleksander Deptuła, and Eugenia Gospodarek-Komkowska. 2023. "Comparison of Virulence-Factor-Encoding Genes and Genotype Distribution amongst Clinical Pseudomonas aeruginosa Strains" International Journal of Molecular Sciences 24, no. 2: 1269. https://doi.org/10.3390/ijms24021269
APA StyleBogiel, T., Depka, D., Kruszewski, S., Rutkowska, A., Kanarek, P., Rzepka, M., Leitão, J. H., Deptuła, A., & Gospodarek-Komkowska, E. (2023). Comparison of Virulence-Factor-Encoding Genes and Genotype Distribution amongst Clinical Pseudomonas aeruginosa Strains. International Journal of Molecular Sciences, 24(2), 1269. https://doi.org/10.3390/ijms24021269