Characterization of the Secreted Acid Phosphatase SapS Reveals a Novel Virulence Factor of Staphylococcus aureus That Contributes to Survival and Virulence in Mice
Abstract
1. Introduction
2. Results
2.1. SapS Is Involved in Intramacrophage Survival of S. aureus
2.2. SapS Participates to the Virulence of S. aureus in the Zebrafish and Murine Abscess Models
2.3. SapS Modifies the Immune Cell Population in S. aureus-Infected Mice Blood
2.4. SapS Affects the KC and MPO Contents in Kidneys of S. aureus-Infected Mice
2.5. SapS Does Not Alter the Uptake Rates of S. aureus by Polymorphonuclear Neutrophils in Whole Blood
2.6. The Ability of S. aureus to Survive in the Presence of Oxidative Stress Is Influenced by SapS
2.7. SapS Is Involved in S. aureus SA564 Biofilm Formation
2.8. S. aureus SapS Phosphatase Activity Relies on a Very Specific Aspartate Residue in Its Catalytic Loop but Its Activity Is Dispensable for In Vivo Survival
3. Materials and Methods
3.1. Bacterial Strains, Media, and Growth Conditions
3.2. Construction of the S. aureus sapS Deletion and Complementation Strains
3.3. Macrophage Culture and Infection
3.4. Infection of Zebrafish Embryos
3.5. Murine Abscess Model
3.6. Determination of Immune Cell Contents in Blood of Mice
3.7. Analysis of Phagocytosis in Human Whole Blood
3.8. Measurement of Gene Expression by qRT-PCR
3.9. Cell Fractionation and Immunoblotting
3.10. SapS Phosphatase Activity Assay
3.11. H2O2 Susceptibility Assays
3.12. Biofilm Assays
3.13. Statistical Analyses
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Lowy, F.D. Staphylococcus aureus Infections. N. Engl. J. Med. 1998, 339, 520–532. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tong, S.Y.C.; Davis, J.S.; Eichenberger, E.; Holland, T.L.; Fowler, V.G. Staphylococcus aureus Infections: Epidemiology, Pathophysiology, Clinical Manifestations, and Management. Clin. Microbiol. Rev. 2015, 28, 603–661. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Patti, J.M.; Allen, B.L.; McGavin, M.J.; Höök, M. MSCRAMM-Mediated Adherence of Microorganisms to Host Tissues. Annu. Rev. Microbiol. 1994, 48, 585–617. [Google Scholar] [CrossRef] [PubMed]
- Chavakis, T.; Preissner, K.T.; Herrmann, M. The Anti-Inflammatory Activities of Staphylococcus aureus. Trends Immunol. 2007, 28, 408–418. [Google Scholar] [CrossRef] [Scilit]
- Ahmad-Mansour, N.; Loubet, P.; Pouget, C.; Dunyach-Remy, C.; Sotto, A.; Lavigne, J.-P.; Molle, V. Staphylococcus aureus Toxins: An Update on Their Pathogenic Properties and Potential Treatments. Toxins 2021, 13, 677. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Serruto, D.; Rappuoli, R.; Scarselli, M.; Gros, P.; van Strijp, J.A.G. Molecular Mechanisms of Complement Evasion: Learning from Staphylococci and Meningococci. Nat. Rev. Microbiol. 2010, 8, 393–399. [Google Scholar] [CrossRef] [Scilit]
- Prince, A.; Wong Fok Lung, T. Consequences of Metabolic Interactions during Staphylococcus aureus Infection. Toxins 2020, 12, 581. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Prince, A.; Wang, H.; Kitur, K.; Parker, D. Humanized Mice Exhibit Increased Susceptibility to Staphylococcus aureus Pneumonia. J. Infect. Dis. 2017, 215, 1386–1395. [Google Scholar] [CrossRef] [Scilit]
- Tomlinson, K.L.; Prince, A.S.; Wong Fok Lung, T. Immunometabolites Drive Bacterial Adaptation to the Airway. Front. Immunol. 2021, 12, 790574. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Flannagan, R.S.; Heit, B.; Heinrichs, D.E. Antimicrobial Mechanisms of Macrophages and the Immune Evasion Strategies of Staphylococcus aureus. Pathogens 2015, 4, 826–868. [Google Scholar] [CrossRef] [Scilit]
- Bach, H.; Papavinasasundaram, K.G.; Wong, D.; Hmama, Z.; Av-Gay, Y. Mycobacterium tuberculosis Virulence Is Mediated by PtpA Dephosphorylation of Human Vacuolar Protein Sorting 33B. Cell Host Microbe 2008, 3, 316–322. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Heneberg, P. Finding the Smoking Gun: Protein Tyrosine Phosphatases as Tools and Targets of Unicellular Microorganisms and Viruses. Curr. Med. Chem. 2012, 19, 1530–1566. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dai, S.; Mohapatra, N.P.; Schlesinger, L.S.; Gunn, J.S. The Acid Phosphatase AcpA Is Secreted In Vitro and in Macrophages by Francisella spp. Infect. Immun. 2012, 80, 1088–1097. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Whitmore, S.E.; Lamont, R.J. Tyrosine Phosphorylation and Bacterial Virulence. Int. J. Oral Sci. 2012, 4, 1–6. [Google Scholar] [CrossRef] [Scilit]
- Wong, D.; Chao, J.D.; Av-Gay, Y. Mycobacterium tuberculosis-Secreted Phosphatases: From Pathogenesis to Targets for TB Drug Development. Trends Microbiol. 2013, 21, 100–109. [Google Scholar] [CrossRef] [Scilit]
- Gannoun-Zaki, L.; Pätzold, L.; Huc-Brandt, S.; Baronian, G.; Elhawy, M.I.; Gaupp, R.; Martin, M.; Blanc-Potard, A.-B.; Letourneur, F.; Bischoff, M.; et al. PtpA, a Secreted Tyrosine Phosphatase from Staphylococcus aureus, Contributes to Virulence and Interacts with Coronin-1A during Infection. J. Biol. Chem. 2018, 293, 15569–15580. [Google Scholar] [CrossRef] [Scilit]
- Brelle, S.; Baronian, G.; Huc-Brandt, S.; Zaki, L.G.; Cohen-Gonsaud, M.; Bischoff, M.; Molle, V. Phosphorylation-Mediated Regulation of the Staphylococcus aureus Secreted Tyrosine Phosphatase PtpA. Biochem. Biophys. Res. Commun. 2016, 469, 619–625. [Google Scholar] [CrossRef] [Scilit]
- du Plessis, E.M.; Theron, J.; Joubert, L.; Lotter, T.; Watson, T.G. Characterization of a Phosphatase Secreted by Staphylococcus aureus Strain 154, a New Member of the Bacterial Class C Family of Nonspecific Acid Phosphatases. Syst. Appl. Microbiol. 2002, 25, 21–30. [Google Scholar] [CrossRef] [Scilit]
- Vincent, J.B.; Crowder, M.W.; Averill, B.A. Hydrolysis of Phosphate Monoesters: A Biological Problem with Multiple Chemical Solutions. Trends Biochem. Sci. 1992, 17, 105–110. [Google Scholar] [CrossRef] [Scilit]
- Saha, A.K.; Dowling, J.N.; LaMarco, K.L.; Das, S.; Remaley, A.T.; Olomu, N.; Pope, M.T.; Glew, R.H. Properties of an Acid Phosphatase from Legionella Micdadei Which Blocks Superoxide Anion Production by Human Neutrophils. Arch. Biochem. Biophys. 1985, 243, 150–160. [Google Scholar] [CrossRef] [Scilit]
- Remaley, A.T.; Glew, R.H.; Kuhns, D.B.; Basford, R.E.; Waggoner, A.S.; Ernst, L.A.; Pope, M. Leishmania Donovani: Surface Membrane Acid Phosphatase Blocks Neutrophil Oxidative Metabolite Production. Exp. Parasitol. 1985, 60, 331–341. [Google Scholar] [CrossRef] [Scilit]
- Baca, O.G.; Roman, M.J.; Glew, R.H.; Christner, R.F.; Buhler, J.E.; Aragon, A.S. Acid Phosphatase Activity in Coxiella burnetii: A Possible Virulence Factor. Infect. Immun. 1993, 61, 4232–4239. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jungnitz, H.; West, N.P.; Walker, M.J.; Chhatwal, G.S.; Guzmán, C.A. A Second Two-Component Regulatory System of Bordetella bronchiseptica Required for Bacterial Resistance to Oxidative Stress, Production of Acid Phosphatase, and in Vivo Persistence. Infect. Immun. 1998, 66, 4640–4650. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saleh, M.T.; Belisle, J.T. Secretion of an Acid Phosphatase (SapM) by Mycobacterium Tuberculosis That Is Similar to Eukaryotic Acid Phosphatases. J. Bacteriol. 2000, 182, 6850–6853. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aragon, V.; Kurtz, S.; Cianciotto, N.P. Legionella pneumophila Major Acid Phosphatase and Its Role in Intracellular Infection. Infect. Immun. 2001, 69, 177–185. [Google Scholar] [CrossRef] [Scilit]
- Burtnick, M.; Bolton, A.; Brett, P.; Watanabe, D.; Woods, D. Identification of the Acid Phosphatase (AcpA) Gene Homologues in Pathogenic and Non-Pathogenic Burkholderia spp. Facilitates TnphoA Mutagenesis. Microbiology 2001, 147, 111–120. [Google Scholar] [CrossRef] [Scilit]
- Elhawy, M.I.; Huc-Brandt, S.; Pätzold, L.; Gannoun-Zaki, L.; Abdrabou, A.M.M.; Bischoff, M.; Molle, V. The Phosphoarginine Phosphatase PtpB from Staphylococcus aureus Is Involved in Bacterial Stress Adaptation during Infection. Cells 2021, 10, 645. [Google Scholar] [CrossRef] [Scilit]
- Ravipaty, S.; Reilly, J.P. Comprehensive Characterization of Methicillin-Resistant Staphylococcus aureus Subsp. aureus COL Secretome by Two-Dimensional Liquid Chromatography and Mass Spectrometry. Mol. Cell Proteom. 2010, 9, 1898–1919. [Google Scholar] [CrossRef] [Scilit]
- Cassat, J.E.; Hammer, N.D.; Campbell, J.P.; Benson, M.A.; Perrien, D.S.; Mrak, L.N.; Smeltzer, M.S.; Torres, V.J.; Skaar, E.P. A Secreted Bacterial Protease Tailors the Staphylococcus aureus Virulence Repertoire to Modulate Bone Remodeling during Osteomyelitis. Cell Host Microbe 2013, 13, 759–772. [Google Scholar] [CrossRef] [Scilit]
- Paharik, A.E.; Salgado-Pabon, W.; Meyerholz, D.K.; White, M.J.; Schlievert, P.M.; Horswill, A.R. The Spl Serine Proteases Modulate Staphylococcus aureus Protein Production and Virulence in a Rabbit Model of Pneumonia. mSphere 2016, 1, e00208-16. [Google Scholar] [CrossRef] [Scilit]
- Prajsnar, T.K.; Cunliffe, V.T.; Foster, S.J.; Renshaw, S.A. A Novel Vertebrate Model of Staphylococcus aureus Infection Reveals Phagocyte-Dependent Resistance of Zebrafish to Non-Host Specialized Pathogens. Cell. Microbiol. 2008, 10, 2312–2325. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rasheed, S.; Fries, F.; Müller, R.; Herrmann, J. Zebrafish: An Attractive Model to Study Staphylococcus aureus Infection and Its Use as a Drug Discovery Tool. Pharmaceuticals 2021, 14, 594. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lieschke, G.J.; Oates, A.C.; Crowhurst, M.O.; Ward, A.C.; Layton, J.E. Morphologic and Functional Characterization of Granulocytes and Macrophages in Embryonic and Adult Zebrafish. Blood 2001, 98, 3087–3096. [Google Scholar] [CrossRef] [Scilit]
- Li, C.; Sun, F.; Cho, H.; Yelavarthi, V.; Sohn, C.; He, C.; Schneewind, O.; Bae, T. CcpA Mediates Proline Auxotrophy and Is Required for Staphylococcus aureus Pathogenesis. J. Bacteriol. 2010, 192, 3883–3892. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pidwill, G.R.; Gibson, J.F.; Cole, J.; Renshaw, S.A.; Foster, S.J. The Role of Macrophages in Staphylococcus aureus Infection. Front. Immunol. 2021, 11, 3506. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Idrees, M.; Sawant, S.; Karodia, N.; Rahman, A. Staphylococcus aureus Biofilm: Morphology, Genetics, Pathogenesis and Treatment Strategies. Int. J. Environ. Res. Public Health 2021, 18, 7602. [Google Scholar] [CrossRef] [Scilit]
- Ahmad-Mansour, N.; Plumet, L.; Huc-Brandt, S.; Magnan, C.; Yahiaoui-Martinez, A.; Kissa, K.; Pantel, A.; Lavigne, J.-P.; Molle, V. Investigating Pathogenicity and Virulence of Staphylococcus pettenkoferi: An Emerging Pathogen. Int. J. Mol. Sci. 2021, 22, 13614. [Google Scholar] [CrossRef] [Scilit]
- Thaller, M.C.; Schippa, S.; Rossolini, G.M. Conserved Sequence Motifs among Bacterial, Eukaryotic, and Archaeal Phosphatases That Define a New Phosphohydrolase Superfamily. Protein. Sci. 1998, 7, 1647–1652. [Google Scholar] [CrossRef] [Scilit]
- Rossolini, G.M.; Schippa, S.; Riccio, M.L.; Berlutti, F.; Macaskie, L.E.; Thaller, M.C. Bacterial Nonspecific Acid Phosphohydrolases: Physiology, Evolution and Use as Tools in Microbial Biotechnology. CMLS Cell. Mol. Life Sci. 1998, 54, 833–850. [Google Scholar] [CrossRef] [Scilit]
- Reilly, T.J.; Green, B.A.; Zlotnick, G.W.; Smith, A.L. Contribution of the DDDD Motif of H. Influenzae e (P4) to Phosphomonoesterase Activity and Heme Transport. FEBS Lett. 2001, 494, 19–23. [Google Scholar] [CrossRef] [Scilit]
- Reilly, T.J.; Calcutt, M.J. The Class C Acid Phosphatase of Helicobacter pylori Is a 5′ Nucleotidase. Protein Expr. Purif. 2004, 33, 48–56. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reilly, T.J.; Chance, D.L.; Calcutt, M.J.; Tanner, J.J.; Felts, R.L.; Waller, S.C.; Henzl, M.T.; Mawhinney, T.P.; Ganjam, I.K.; Fales, W.H. Characterization of a Unique Class C Acid Phosphatase from Clostridium perfringens. Appl. Environ. Microbiol. 2009, 75, 3745–3754. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Somerville, G.A.; Beres, S.B.; Fitzgerald, J.R.; DeLeo, F.R.; Cole, R.L.; Hoff, J.S.; Musser, J.M. In Vitro Serial Passage of Staphylococcus aureus: Changes in Physiology, Virulence Factor Production, and Agr Nucleotide Sequence. J. Bacteriol. 2002, 184, 1430–1437. [Google Scholar] [CrossRef] [Scilit]
- Monk, I.R.; Tree, J.J.; Howden, B.P.; Stinear, T.P.; Foster, T.J. Complete Bypass of Restriction Systems for Major Staphylococcus aureus Lineages. mBio 2015, 6, e00308-15. [Google Scholar] [CrossRef] [Scilit]
- Schuster, C.F.; Howard, S.A.; Gründling, A. Use of the Counter Selectable Marker PheS* for Genome Engineering in Staphylococcus aureus. Microbiology 2019, 165, 572–584. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- de Jong, N.W.M.; van der Horst, T.; van Strijp, J.A.G.; Nijland, R. Fluorescent Reporters for Markerless Genomic Integration in Staphylococcus aureus. Sci. Rep. 2017, 7, 43889. [Google Scholar] [CrossRef] [Scilit]
- Lee, C.Y.; Buranen, S.L.; Ye, Z.H. Construction of Single-Copy Integration Vectors for Staphylococcus aureus. Gene 1991, 103, 101–105. [Google Scholar] [CrossRef] [Scilit]
- Dreymueller, D.; Martin, C.; Kogel, T.; Pruessmeyer, J.; Hess, F.M.; Horiuchi, K.; Uhlig, S.; Ludwig, A. Lung Endothelial ADAM17 Regulates the Acute Inflammatory Response to Lipopolysaccharide. EMBO Mol. Med. 2012, 4, 412–423. [Google Scholar] [CrossRef] [Scilit]
- Elhawy, M.I.; Molle, V.; Becker, S.L.; Bischoff, M. The Low-Molecular Weight Protein Arginine Phosphatase PtpB Affects Nuclease Production, Cell Wall Integrity, and Uptake Rates of Staphylococcus aureus by Polymorphonuclear Leukocytes. Int. J. Mol. Sci. 2021, 22, 5342. [Google Scholar] [CrossRef] [Scilit]
- Chatterjee, I.; Becker, P.; Grundmeier, M.; Bischoff, M.; Somerville, G.A.; Peters, G.; Sinha, B.; Harraghy, N.; Proctor, R.A.; Herrmann, M. Staphylococcus aureus ClpC Is Required for Stress Resistance, Aconitase Activity, Growth Recovery, and Death. J. Bacteriol. 2005, 187, 4488–4496. [Google Scholar] [CrossRef] [Scilit]
- Pätzold, L.; Brausch, A.-C.; Bielefeld, E.-L.; Zimmer, L.; Somerville, G.A.; Bischoff, M.; Gaupp, R. Impact of the Histidine-Containing Phosphocarrier Protein HPr on Carbon Metabolism and Virulence in Staphylococcus aureus. Microorganisms 2021, 9, 466. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schlievert, P.M. Staphylococcal Virulence Factors. In Staphylococcus: Genetics and Physiology; Caister Academic Press: Wymondham, UK, 2016; pp. 81–106. ISBN 978-1-910190-49-4. [Google Scholar]
- Bischoff, M.; Romby, P. Genetic Regulation. In Staphylococcus: Genetics and Physiology; Caister Academic Press: Wymondham, UK, 2016; pp. 301–334. ISBN 978-1-910190-49-4. [Google Scholar]











| Strain | Description | Reference or Source |
|---|---|---|
| S. aureus | ||
| SA564 | S. aureus clinical isolate, wild type | [43] |
| SA564 ΔsapS | SA564 deletion mutant of the sapS gene | This study |
| SA564 ΔsapS::sapS | SA564 ΔsapS complemented with the pJB38-NWMN2930_SapS-Spot integrative plasmid | This study |
| SA564 ΔsapS + pLI50_SapS-Spot | SA564 ΔsapS complemented with the pLI50_SapS-Spot plasmid | This study |
| SA564 ΔsapS + pLI50_SapS_D103A-Spot | SA564 ΔsapS complemented with the pLI50_SapS_D103A-Spot | This study |
| E. coli | ||
| TOP10 | E. coli derivative ultra-competent cells used for general cloning | Invitrogen |
| IM08B | E. coli DC10B derivative harbouring hsdS of S. aureus strain NRS384, Δdcm | [44] |
| Plasmids | ||
| pIMAY | E. coli–S. aureus temperature-sensitive suicide shuttle vector, pheS counterselection; cat | [45] |
| pIMAY_ΔsapS | pIMAY derivative harbouring the genomic regions flanking sapS; cat | This study |
| pJB38-NWMN2930 | E. coli–S. aureus temperature-sensitive shuttle vector for chromosomal integration containing the Newman genetic region between genes 29 and 30; bla, cat | [46] |
| pJB38NWMN2930_SapS-Spot | pJB38-NWMN2930 derivative used to integrate and express C-terminal Spot-tagged fusion of S. aureus SapS; bla, cat | This study |
| pLI50 | E. coli-S. aureus shuttle vector for native expression; bla, cat | [47] |
| pLI50_sapS | pLI50 derivative used to express C-terminal Spot-tagged fusion of S. aureus SapS; bla, cat | This study |
| pLI50_sapS_D103A | pLI50 derivative used to express C-terminal Spot-tagged fusion of S. aureus SapS_D103A; bla, cat | This study |
| Primers | 5′ to 3′ Sequence |
|---|---|
| #34 | CGGGCTGCAGGAATTTAAACTAATCCAGTAAACGA |
| #55 | TTTAACTTCGCCTGTTGAAATTTTATTCATCTTATCACCTCATG |
| #36 | ATGAATAAAATTTCAACAGGCGAAGTTAAATAATA |
| #37 | CGGGCCCCCCCTCGATGTAGCTGAAATGACAAATA |
| #85 | ATTCGAGCTCGGTACCGTAAATAAGAGATAGCACA |
| #77 | TGGCCCTGATGACCCTTTAACTTCGCCTGTTTTAG |
| #78 | ACAGGCGAAGTTAAAGGGTCATCAGGGCCAGATCG |
| #86 | CGACTCTAGAGGATCCTAAGAACTCCAATGTGATA |
| #116 | TTCATCTAAAGCCAAAGCAATAGCTAACTTATG |
| #117 | CATAAGTTAGCTATTGCTTTGGCTTTAGATGAA |
| qRT PCR primers | |
| ahpC for | TCCAACTGAATTAGAAGACT |
| ahpC rev | GAGAATACATTTACGCCTAAT |
| crtM for | ACAGTAGGTGAAGTATTGAC |
| crtM rev | ATCGTATGTCTGATGTGTTT |
| gyrA for | GACTGATGCCGATGTGGA |
| gyrA rev | AACGGTGGCTGTGCAATA |
| katA for | AATGGACAATGTATATTCAAGT |
| katA rev | ATCAAATGGATTATCTTTATGGT |
| sapS for | ATAATTCTCCATATCAAGGCTAT |
| sapS rev | TGGGAAAGGTTTATTATGTATTG |
| sodA for | ACCAAGATAATCCATTAACTGA |
| sodA rev | ATTTTAGGTAATAAGCGTGTTC |
| sodM for | CCAAGATAATCCATTAACAGAA |
| sodM rev | CCAAACATCAAATAGTAAGATTG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ahmad-Mansour, N.; Elhawy, M.I.; Huc-Brandt, S.; Youssouf, N.; Pätzold, L.; Martin, M.; Abdel-Wadood, N.; Aljohmani, A.; Morsli, M.; Krasteva-Christ, G.; et al. Characterization of the Secreted Acid Phosphatase SapS Reveals a Novel Virulence Factor of Staphylococcus aureus That Contributes to Survival and Virulence in Mice. Int. J. Mol. Sci. 2022, 23, 14031. https://doi.org/10.3390/ijms232214031
Ahmad-Mansour N, Elhawy MI, Huc-Brandt S, Youssouf N, Pätzold L, Martin M, Abdel-Wadood N, Aljohmani A, Morsli M, Krasteva-Christ G, et al. Characterization of the Secreted Acid Phosphatase SapS Reveals a Novel Virulence Factor of Staphylococcus aureus That Contributes to Survival and Virulence in Mice. International Journal of Molecular Sciences. 2022; 23(22):14031. https://doi.org/10.3390/ijms232214031
Chicago/Turabian StyleAhmad-Mansour, Nour, Mohamed Ibrahem Elhawy, Sylvaine Huc-Brandt, Nadhuma Youssouf, Linda Pätzold, Marianne Martin, Noran Abdel-Wadood, Ahmad Aljohmani, Madjid Morsli, Gabriela Krasteva-Christ, and et al. 2022. "Characterization of the Secreted Acid Phosphatase SapS Reveals a Novel Virulence Factor of Staphylococcus aureus That Contributes to Survival and Virulence in Mice" International Journal of Molecular Sciences 23, no. 22: 14031. https://doi.org/10.3390/ijms232214031
APA StyleAhmad-Mansour, N., Elhawy, M. I., Huc-Brandt, S., Youssouf, N., Pätzold, L., Martin, M., Abdel-Wadood, N., Aljohmani, A., Morsli, M., Krasteva-Christ, G., Becker, S. L., Yildiz, D., Lavigne, J.-P., Gannoun-Zaki, L., Bischoff, M., & Molle, V. (2022). Characterization of the Secreted Acid Phosphatase SapS Reveals a Novel Virulence Factor of Staphylococcus aureus That Contributes to Survival and Virulence in Mice. International Journal of Molecular Sciences, 23(22), 14031. https://doi.org/10.3390/ijms232214031

