Next Article in Journal
Characteristic Evaluation of Recombinant MiSp/Poly(lactic-co-glycolic) Acid (PLGA) Nanofiber Scaffolds as Potential Scaffolds for Bone Tissue Engineering
Next Article in Special Issue
Impact of Prenatal Exposure to Maternal Diabetes and High-Fat Diet on Postnatal Myocardial Ketone Body Metabolism in Rats
Previous Article in Journal
ame-miR-34 Modulates the Larval Body Weight and Immune Response of Apis mellifera Workers to Ascosphara apis Invasion
Previous Article in Special Issue
Ketone Body Exposure of Cardiomyocytes Impairs Insulin Sensitivity and Contractile Function through Vacuolar-Type H+-ATPase Disassembly—Rescue by Specific Amino Acid Supplementation
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Regular Exercise in Drosophila Prevents Age-Related Cardiac Dysfunction Caused by High Fat and Heart-Specific Knockdown of skd

Key Laboratory of Physical Fitness and Exercise Rehabilitation of Hunan Province, College of Physical Education, Hunan Normal University, Changsha 410012, China
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2023, 24(2), 1216; https://doi.org/10.3390/ijms24021216
Submission received: 20 November 2022 / Revised: 1 January 2023 / Accepted: 4 January 2023 / Published: 7 January 2023
(This article belongs to the Special Issue Cardiac Metabolism in Heart Failure)

Abstract

Skuld (skd) is a subunit of the Mediator complex subunit complex. In the heart, skd controls systemic obesity, is involved in systemic energy metabolism, and is closely linked to cardiac function and aging. However, it is unclear whether the effect of cardiac skd on cardiac energy metabolism affects cardiac function. We found that cardiac-specific knockdown of skd showed impaired cardiac function, metabolic impairment, and premature aging. Drosophila was subjected to an exercise and high-fat diet (HFD) intervention to explore the effects of exercise on cardiac skd expression and cardiac function in HFD Drosophila. We found that Hand-Gal4>skd RNAi (KC) Drosophila had impaired cardiac function, metabolic impairment, and premature aging. Regular exercise significantly improved cardiac function and metabolism and delayed aging in HFD KC Drosophila. Thus, our study found that the effect of skd on cardiac energy metabolism in the heart affected cardiac function. Exercise may counteract age-related cardiac dysfunction and metabolic disturbances caused by HFD and heart-specific knockdown of skd. Skd may be a potential therapeutic target for heart disease.

1. Introduction

The global obesity epidemic continues to grow relentlessly and now affects over two billion people [1,2]. Obesity increases the risk of cardiovascular disease [3], raises the chances of metabolic disorders [4], and increases blood lipids [5]. There are various factors that contribute to obesity, such as high-fat diet (HFD) intake, aging, and a sedentary lifestyle [6]. HFD can lead to lipid accumulation, conduction block, and severe structural lesions in the heart [7]. Studies have reported that the heart can fine-tune metabolism and gene expression patterns to adapt to dietary changes and external stimuli to maximize energy efficiency [8,9]. Cardiac energy metabolism affects systemic energy metabolism and homeostasis in vivo [10,11,12]. The heart under normal conditions relies primarily on the oxidation of fatty acids delivered by the circulation for energy [13,14]. Skuld (skd) is primarily expressed in the heart, skeletal muscle, and brain in human tissues [15]. Skd is homologous to the human Mediator complex subunit 13 (MED13) [16]; the gene sequence position is 3L:20992814..21027434.
Cardiac-specific knockdown of skd in Drosophila increases fat accumulation and induces obesity. Cardiac skd is involved in whole-body energy metabolism [10] and is associated with obesity and other diseases related to energy metabolism [11]. Studies have shown that cardiac-specific knockout of skd increases susceptibility to accumulation of triglycerides (TG) and obesity in HFD mice [17]. In particular, there are sex differences in skd expression, and skd is a protective factor in the hearts of healthy female rats [18]. In addition, cardiac skd regulates other transcription factors (TFs) involved in the regulation of lipid biosynthesis and metabolism, such as srebp [19] and Eip75B [20]. Skd may be a possible therapeutic target for metabolic and nonmetabolic heart disease. However, it remains unclear whether the effect of cardiac skd on cardiac energy metabolism affects cardiac function. Further studies are needed to determine whether cardiac skd is associated with other cardiovascular diseases and whether it regulates cardiac function. In addition, cardiac brummer (bmm) has been identified as a key antagonist of HFD-induced lipotoxic cardiomyopathy in Drosophila [7,21]. The metabolic dysregulation associated with obesity caused by poor lifestyle habits is similar to that observed in normal aging, and there is substantial evidence that obesity has the potential to accelerate aging. Adipose tissue storage, distribution, and function change with age. Moreover, adipose tissue is associated with aging and aging-related diseases, such as heart disease [22,23,24] and metabolic dysfunction [25].
Exercise training reduces the incidence of obesity and heart disease [26,27,28,29], and slows aging [30]. Our previous studies have shown that regular exercise improves cardiac function [31,32], counteracts myocardial lipotropic damage induced by HFDs, and leads to a benign reversal of cardiac lipid metabolism [33,34,35]. A growing number of studies have shown that regular exercise at different times of life also delays cardiac age-related phenotypes [36,37,38]. Thus, the potential mechanism of exercise resistance to HFD-induced age-related premature heart failure remains to be further determined.
Drosophila is a well-known model organism for the study of basic metabolic diseases such as obesity and diabetes [39]. Drosophila fed HFD for short periods of time show lipid accumulation, structural changes, and premature failure in the myocardium. This study explored the effect of the skd gene intervention in the heart on cardiac function and whether cardiac skd is further damaging to cardiac energy metabolism and cardiac function under HFD conditions.
We wanted to understand whether exercise can modulate skd expression in the heart to improve whole-body energy metabolism and cardiac function in Drosophila and prevent premature cardiac failure caused by HFD and cardiac-specific knockdown of skd. Hence, we sought to investigate the relationship between exercise, HFD, skd, and cardiac aging.

2. Results

2.1. High-Fat Diet Promotes Aging-Related Cardiac Dysfunction and Systemic Lipid Accumulation

Similar to mammals, Drosophila developed an age-related decline in cardiac function with reduced heart rate and increased fibrillation particularly pronounced under stress conditions [40]. It is unclear whether skd gene expression changes in the heart with aging and whether skd in the heart affects cardiac function. In addition, these longitudinal muscles are closely associated with the heart tube, and have been proposed to assist in circulation of the hemolymph through the heart tube [41]. In this experiment, to determine the adverse effects of aging on the cytoarchitecture of myocytes, a 12-day (12D) and 36-day (36D) old Drosophila cardiac tubules were assayed for filamentous actin (F-actin) structures in myogenic fibers using Phalloidin. As shown in Figure 1A, senescent myocardial fibers are less dense and disorganized, the regularity of their myogenic fibers is reduced, and the heart tube is thinner. We examined cardiac function using M-mode. Compared to Hand-Gal4>w1118-12D-NFD-C (12-C), Hand-Gal4>w1118-36D-NFD-C (36-C) shows significant increases in heart period (HP) (Figure S1A), arrhythmia index (AI) (Figure 1B,C), systolic intervals (SI) (Figure S1B), and diastolic intervals (DI) (Figure S1C), and a significant decrease in heart rate (HR) (Figure S1D). Thus, it was shown that aging leads to cardiac dysfunction in Drosophila. qPCR further confirmed the relationship between the expression level of skd in the heart tube and aging, and the results show that the relative mRNA expression of skd in the heart tube of 36-C Drosophila was also significantly lower than that of 12-C Drosophila (Figure 1D).
However, in mammals, HFD causes systemic lipid overload, which accelerates the aging of their organs and affects cardiac function, leading to severe heart failure [33,42]. Drosophila fed an HFD in which 30% coconut oil is added to the normal medium for 5 days of HFD [7,43], is the widely used model for inducing their obesity. We performed HFD interventions in young and old Drosophila by staining for ghost pen cyclic peptides to observe the structure of F-actin in myogenic fibers after HFD. The myocardial fibers of HFD-fed Drosophila melanogaster show a similar phenotype to that of senescence-reduced density, disorganized arrangement, reduced regularity of their myogenic fibers, and changes in the morphology of the heart tube (Figure 1A). Analysis of the cardiac function revealed that the cardiac function was impaired. HR (Figure S1D) and AI (Figure 1B,C) increased significantly, and HP (Figure S1A), DI (Figure S1C), and SI (Figure S1B) decreased significantly in Hand-Gal4>w1118-12D-HFD-C (12-HC) Drosophila. Hand-Gal4>w1118-36D-HFD-C (36-HC) Drosophila shows clear signs of irregular heartbeat (Figure 1C), a significant increase in HP (Figure S1A), a significant decrease in HR (Figure S1D), and a significant increase in DI (Figure S1C). In addition, the AI (Figure 1B,C) and SI (Figure S1B) show a nonsignificant increase. The 12-HC AI and 36-C AI values were essentially the same, suggesting that HFD accelerates Drosophila aging. However, does HFD affect skd gene expression in the heart? The relationship between the cardiac skd and HFD was examined using qPCR, which shows that the relative mRNA level expression of skd in the heart tube was significantly reduced in both 12D and 36D Drosophila after HFD intervention (Figure 1D).
TG are the major form of lipid storage in mammals and Drosophila, and elevated TG causes obesity and metabolic syndrome. In rodent models of obesity and diabetes and in human subjects, myocardial steatosis is associated with functional and structural changes in the heart [44]. Our results indicate that the 36-C Drosophila shows increased adipose area and TG levels compared to the 12-C Drosophila. In the 12-HC and 36-HC Drosophila, Oil red O (ORO) test results show a significant increase in abdominal fat (Figure 1E) and whole-body TG (Figure 1F). Thus, after 5 days of feeding HFD to 12D or 36D Drosophila, cardiac function is impaired and whole-body fat accumulation is increased.
Both senescent and HFD Drosophila show lipid accumulation, so is metabolism within the heart tube altered? We went on to examine changes in a number of metabolic genes in the Drosophila heart tube to elucidate the mechanisms underlying senescence, HFD, and obesity levels. Compared with the 12-C Drosophila, in the 36-C Drosophila, the relative mRNA expression levels of bmm (Figure 1G) decreased significantly, and the relative mRNA expression levels of srebp (Figure 1H) and Eip75B (Figure 1I) in the heart tube increased, but it was not significant. Under HFD conditions, the relative mRNA expression levels of srebp (Figure 1H) and Eip75B (Figure 1I) increased significantly in the heart tube of Drosophila at 12-HC, while the relative mRNA expression levels of bmm (Figure 1G) decreased significantly. At 36-HC, the relative mRNA expression levels of srebp (Figure 1H) and Eip75B (Figure 1I) increased significantly in the heart tube of Drosophila, while the relative mRNA expression levels of bmm (Figure 1G) increased, but it was not significant.
In conclusion, HFD affects cardiac function, disrupts cardiac structure, leads to obesity, and accelerates aging in Drosophila. Both HFD and aging lead to an age-related increase in arrhythmias, which may be due to the downregulation of the expression of cardiac skd and metabolic disorders. However, the effect of the cardiac skd gene on the heart is not well understood.

2.2. Cardiac Skd-Specific RNAi and/or HFD Promotes Age-Related Cardiac Insufficiency and Increased Systemic Lipids

Systemic TG increased significantly after knockdown of Drosophila skd using cardiac-specific Tin-Gal4 [17]. However, the relevance of the relationship between the cardiac skd gene and cardiac function is unclear. In this experiment, Hand-Gal4>skd RNAi (KC) Drosophila were constructed using the UAS/Hand-gal4 system to test whether cardiac-specific knockdown of skd impairs their cardiac function. The results showed that skd gene expression levels were lower in the hearts of Hand-Gal4>skd RNAi-12D-NFD-C (12-KC) Drosophila than in the control 12-C Drosophila, indicating that the KC Drosophila strain was successfully constructed (Figure 2A). However, genetic manipulation of the cardiac myocytes may have a significant non-cell-autonomous effect on the ventral muscle layer containing longitudinal myogenic fibers. To determine whether the specific knockdown of skd mRNA levels and fat accumulation in KC Drosophila hearts adversely affect the cytoarchitecture of cardiac myocytes, the heart tubes of KC were stained with ghost pen cyclic peptide. The results show that the cardiac structure of the 12-KC Drosophila was disrupted, with reduced density and disorganized arrangement of the cardiac fibers and gaps in certain locations (Figure 2B). This implies that the cardiac-specific knockdown of skd affects myocardial development in Drosophila. Further analysis of cardiac function shows a significant increase in AI (Figure 2C,D), a significant decrease in HP(Figure S2A) and SI (Figure S2B), and no significant change in DI(Figure S2C) and HR(Figure S2D) in the 12-KC Drosophila compared to the 12-C Drosophila.
In Drosophila, HFD downregulates skd gene expression in the heart, promotes total body fat gain, and accelerates aging. Heart-specific knockdown of skd leads to an increase in total body lipids, so does it lead to premature aging? To explore the relationship between 12C-KC and HFD and heart and senescence, first, 12-HC was compared with 12-KC. The heart morphology of the 12-KC Drosophila was similar to the heart tube morphology of the 12-HC Drosophila (Figure 1A and Figure 2B). Furthermore, by analyzing the heart function, it was found that HR (Figure S2D), HP (Figure S2A), AI (Figure 2C,D), DI (Figure S2C), and SI (Figure S2B) of 12-KC were not significantly different from those of 12-HC. 12-KC and 12-HC show the same phenotype. Cardiac-specific knockdown of skd appeared to have similar effects to HFD.
Further HFD intervention on 12-KC resulted in a significant decrease in the density of Hand-Gal4>skd RNAi-12D-HFD-C (12-KHC) Drosophila cardiac myocardial fibers, whose arrangement appeared very disorganized and even fiber loss in some places and thinning of the heart tube diameter (Figure 2B). Further analysis of the cardiac function shows that HR reduced significantly in 12-KHC (Figure S2D), and AI (Figure 2C,D), HP (Figure S2A), SI (Figure S2B), and DI (Figure S2C) increased significantly. We determined the relationship between the expression level of skd and HFD in the heart using qPCR. The expression of skd relative mRNA in the 12 KHC heart reduced significantly (Figure 2A). We further demonstrate that HFD and heart-specific knockdown of skd after Drosophila appear to have aging-like characteristics.
To explore fat accumulation in KC Drosophila, we examined TG levels and ORO. The results show that TG levels increased significantly in the 12-KC Drosophila compared with the 12-C Drosophila (Figure 2F) and ORO staining was stronger (Figure 2E). We further tested whether cardiac-specific knockdown of skd promotes fat accumulation in Drosophila under HFD conditions. The 12-KHC Drosophila shows a significant increase in abdominal fat (Figure 2E) and a significant increase in whole-body TG levels (Figure 2F).
We further investigated the expression levels of metabolic genes and skd-regulated transcription factors in the heart tube of Hand-Gal4>skd RNAi Drosophila to explore the mechanisms by which skd promotes age-related cardiac insufficiency and increases systemic lipids. The relative mRNA expression levels of srebp (Figure 2G) and bmm (Figure 2H) were significantly lower, and that of Eip75B (Figure 2I) was significantly higher in 12-KC, compared with 12-C. Under HFD conditions, the relative mRNA expression levels of 12-KHC srebp were significantly higher (Figure 2G), and the relative mRNA expression levels of Eip75B (Figure 2I) and bmm (Figure 2H) decreased significantly.
These results suggest that cardiac skd-specific RNAi and/or HFD promote age-related cardiac insufficiency, increased systemic lipids, and promote aging in the Drosophila heart. Under HFD conditions, aging was accelerated in KC Drosophila, further impairing cardiac function. The mechanism may be related to altered levels of cardiac srebp, Eip75B, and bmm mRNA expression.
In addition, a two-way ANOVA was performed with skd RNAi (C vs. KC) and HFD (HFD and NFD) as factors, as shown in Table 1. The 12 D Hand-Gal4>skd RNAi Drosophila show a significant interaction between physical exercise and HFD in terms of HP (p = 0.000) and HR (p = 0.000) and DI (p = 0.000) and SI (p = 0.008) significant interactions, and no significant interactions were detected for AI and TG.

2.3. Regular Exercise Resists HFD-Induced Decline in Cardiac Skd Expression, Age-Related Cardiac Abnormalities, and Increased Systemic Lipid Accumulation

Exercise training improves cardiac function, metabolic disorders, and fat loss in Drosophila and regulates metabolic gene expression in the heart [32]. To investigate the effect of regular exercise at different ages on cardiac function and metabolism, we exercised young and old Drosophila and found that exercise had an effect in both young and old age. First, the results from ghost pen cyclin show a more regular arrangement and increased density of cardiac myogenic fibers in the Hand-Gal4>w1118-12D-NFD-E (12-E) and 36-E Drosophila (Figure 3A). Cardiac function reduced significantly in AI (Figure 3B,C) and HR (Figure S3A) in the 12-E group compared with those in the 12-C group. There were significant increases in DI (Figure S3B) and HP (Figure S3C) and no significant changes in SI (Figure S3D). Compared with 36-C, SI (Figure S3E) and AI (Figure 3B,D) were significantly lower and highly significantly different, HR (Figure S3F) increased significantly, and HP (Figure S3G) and DI (Figure S3H) did not change significantly in Hand-Gal4>w1118-36D-NFD-E (36-E). Further testing using qPCR shows that the skd gene was significantly upregulated in the heart tube in both 12-E and 36-E Drosophila compared with the sedentary group (Figure 3E,F).
In addition, the effect of exercise under different dietary conditions was investigated using phalloidin staining. The results show a more regular arrangement and increased density of cardiac myogenic fibers in Hand-Gal4>w1118-12D-HFD-E (12-HE) and Hand-Gal4>w1118-36D-HFD-E (36-HE) Drosophila (Figure 3A). Further analysis of the cardiac function revealed a significant decrease in AI (Figure 3B,D) and HR (Figure S3A) and a significant increase in DI (Figure S3B), SI (Figure S3D), and HP (Figure S3C) in 12-HE compared with 12-HC. Compared with 36-HC Drosophila, AI (Figure 3B,D), HP (Figure S3G), and DI (Figure S3H) decreased significantly, HR (Figure S3F) increased significantly, and SI (Figure S3E) was not significantly different in 36-HE. Further detection using qPCR shows that the skd gene was significantly upregulated in the heart tube in both NFD and HFD exercise groups, compared with the sedentary group, in 12-E, 12-HE, 36-E, and 36-HE Drosophila (Figure 3E,F).
To further observe the improving effect of exercise on lipids in Drosophila, the 12-E and 36-E Drosophila were tested for ORO and TG levels. The results show that in the NFD situation, 12-E had reduced abdominal fat (Figure 3G) and significantly increased whole-body TG levels (Figure 3H). In the 36-E Drosophila, their whole-body TG levels reduced significantly (Figure 3I), and their abdominal ORO shows that fat deposition became less (Figure 3G). In the case of HFD, the 12-HE and 36-HE Drosophila the abdominal ORO shows that abdominal fat deposition became less (Figure 3G) and the whole-body TG levels decreased significantly (Figure 3H,I). Moreover, To further our explanation of the mechanisms of the exercise effect, the mRNA expression levels of the relevant metabolic genes in the Drosophila heart tube were examined. The results show that the relative mRNA expression levels of srebp (Figure 3J,K) and Eip75B (Figure 3L,M) reduced significantly following the exercise intervention in W1118>Hand-Gal4 Drosophila under either 12D or 36D and NFD or HFD conditions. Compared with 12-C and 12-HC, the expression levels were significantly higher for both 12-E and 12-HE bmm (Figure 3N); 36-E bmm was significantly higher than 36-C, and 36-HE bmm was significantly lower than 36-HC (Figure 3O).
Therefore, regular exercise resisted the HFD-induced decrease in cardiac skd expression, age-related cardiac function abnormalities, and increased systemic lipid accumulation, suggesting that exercise can resist an increase in AI due to aging and HFD, and can improve cardiac function in Drosophila. The mechanisms may be that exercise improves the mRNA levels of skd and related metabolic genes in the Drosophila heart.

2.4. Regular Exercise Improves Age-Related Cardiac Dysfunction and Systemic Lipid Increase Caused by Cardiac Skd-Specific RNAi

To investigate whether regular exercise can counteract the age-related cardiac dysfunction and systemic lipid increase induced by cardiac skd-specific RNAi. First, we explored the ameliorative effects of regular exercise on cardiac function in the KC Drosophila. The morphology of the heart tube was restored in the Hand-Gal4>skdRNAi-12D-NFD–E (12-KE) Drosophila, the arrangement of myogenic fibers became regular, and their number increased (Figure 4A), and the gap of the fibers reduced. Further analysis of heart function shows that exercise significantly reduced HR (Figure S4A) and AI (Figure 4B,C) and significantly increased HP (Figure S4B), DI (Figure S4C), and SI (Figure S4D). The relative expression levels of skd mRNA in Drosophila heart tubes increased significantly (Figure 4D).
We further explored the effect of regular exercise on improving cardiac function in HFD-fed KC Drosophila. The morphology of the heart tube improved, and the arrangement of myogenic fibers became regular and increased in number in the Hand-Gal4>skdRNAi-12D-NFD–C (12-KHE) Drosophila after regular exercise (Figure 4A). From the results of the cardiac function analysis, 12-KHE shows significantly reduced AI (Figure 4B,C), HP (Figure S4B), DI (Figure S4C), and SI (Figure S4D) and significantly increased skd content in the heart tube (Figure 4D).
In addition, with cardiac-specific knockdown of the skd gene, Drosophila developed an obese phenotype. This phenotype improved with exercise. The 12-KE and 12-KHE Drosophila show a significant reduction in abdominal fat (Figure 4E) and a significant reduction in TG levels (Figure 4F).
To further determine the mechanisms by which exercise ameliorates cardiac dysfunction in KC and the obesity phenotype in Drosophila, bmm, srebp, and Eip75B mRNA levels were further examined in the heart tube of the KC Drosophila. Under NFD conditions, the relative mRNA expression levels of 12-KE, srebp (Figure 4G), and Eip75B (Figure 4H) decreased significantly and the relative mRNA expression levels of bmm increased significantly (Figure 4I). Under HFD conditions, the relative mRNA expression levels of 12-KHE, srebp (Figure 4G), and Eip75B (Figure 4H) reduced significantly and bmm relative mRNA expression levels increased significantly (Figure 4I).
The results of this experiment show that exercise can counteract cardiac dysfunction caused by cardiac-specific knockdown of skd, mainly improving rhythm-related indicators in Drosophila. Exercise also improved the systematic obesity and cardiometabolic status of the KC Drosophila and resisted premature aging. Thus, exercise training improves cardiac dysfunction and obesity due to the cardiac-specific knockdown of skd, and the mechanisms may be related to the upregulation of cardiac skd gene expression and metabolic genes.

3. Discussion

HFD can cause obesity and metabolic disorders. Obesity and metabolic disorders cause cardiac dysfunction and a pathophysiological phenotype of myocardial response to triacylglycerol dysregulation. In contrast, skd in the heart controls metabolic homeostasis, and the specific knockdown of skd in the heart of Drosophila increases fat accumulation and induces obesity [10,17]. It has recently been reported that skd may be a possible therapeutic target for metabolic and nonmetabolic heart disease. However, it is unknown whether the effect of skd on cardiac energy metabolism affects cardiac function [11]. Furthermore, cardiac brummer (bmm) has been identified as a key antagonist of HFD-induced lipotropic cardiomyopathy in Drosophila [7,21]. Cardiac skd regulates the transcription factors involved in the regulation of lipid biosynthesis and metabolism, such as SREBP and Eip75B (Eip75B is a PPARγ homolog in Drosophila). In the present study conducted separately in 12D and 36D Drosophila, we discussed whether the effect of cardiac skd on cardiac energy metabolism affects cardiac function, and whether regular exercise modulates cardiac skd against age-related cardiac dysfunction and metabolic impairment induced by HFD in Drosophila.
We have revealed the effects of cardiac skd on cardiac function. The results show that the specific knockdown of cardiac skd causes general obesity and abnormal cardio metabolism in Drosophila and affects the cardiac function, mainly by affecting rhythm and aging-like characteristics. Under HFD conditions in Hand-Gal4>skd RNAi flies, the specific knockdown of cardiac skd further impairs cardiac function in response to HFD. Cardiac skd mRNA levels decreased with advancing age. Regular exercise under different intervention conditions and at different ages resisted both skd RNAi and HFD-induced cardiac impairment and metabolic disturbances. Changes in the mRNA expression levels of srebp, Eip75B, and bmm were observed under different intervention conditions and at different ages. These results suggest a previously unknown relationship between skd and cardiac function, and suggest that exercise may improve the cardiac dysfunction caused by HFD and aging.
Drosophila is a very popular model organism in the study of metabolism and aging. It has a tubular heart with a conserved mechanism of heart tube development [40,45,46]. Approximately 77% of human disease genes can be found in Drosophila, including genes associated with cardiovascular diseases [40,45,47]. It has a well-established and rich set of molecular and genetic tools [48], technological tools [49], and is short-lived [38,50]. Exercise has been shown to improve cardiac function and high-fat-induced metabolic disorders in Drosophila. Therefore, we used Drosophila as a model organism to explore the relationship between skd, HFD, aging, and exercise.
One study showed obesity phenotypes in rodents fed HFD [51]. Diet-induced obesity usually induces many secondary diseases, including heart disease [52]. Epidemiologists have linked HFD to heart diseases [53]. For example, skd has been shown to play an important role in regulating energy metabolism in the heart of Drosophila and mice [8,10,17]. Chronic caloric excess leads to increased delivery of fat-derived fatty acids and cytokines to the heart and skeletal muscle, which may increase the risk of organ lipotoxicity [54,55,56]. Short-term feeding of Drosophila with HFDs affects their cardiac function, with lipid accumulation and changes in myocardial structure [7]. HFDs appear to have direct lipotoxic effects on the myocardium. Fibrillation is also seen in Drosophila, and it is similar [57] and a common persistent arrhythmia [58]. Saturated fatty acids can poison normal cells. Both lard and coconut oil are rich in saturated fatty acids. Saturated fatty acids induce apoptosis of the ventricular cardiomyocytes, activation of stress-related protein kinases, and oxidative stress of proteins [59]. The main component of olive oil is monounsaturated fatty acids. It has been shown that extra virgin olive oil diets significantly improved glycemia, insulinemia, glucose tolerance, insulin sensitivity, and insulin degradation. At a later stage, we can consider the use of different oils for the configuration of the high-fat medium [60]. In humans and Drosophila, an important marker of aging is the ectopic deposition of fat, leading to impaired multi-organ function and metabolic changes [31,50,61,62]. In turn, HFD causes obesity, which accelerates aging and is associated with the induction of age-related diseases such as cardiovascular disease [63]. Many studies have shown that metabolism changes with age [50].
The results of this study show that HFD in Drosophila increased TG levels and severe degeneration and disruption of myogenic fibers during the different life cycles. In addition, aging caused a significant decrease in the expression of the skd gene in the heart, a decrease in cardiac function, structural damage to the heart, blurring of myocardial fibers, and metabolic disturbances, in line with previous experiments. In both obese and diabetic rodent models and human subjects, myocardial steatosis is associated with functional and structural changes in the heart [44,64]. In addition, cardiac aging in mammals is always accompanied by disorganized and reduced myocardial fiber arrangement [65].
Skd is involved in systemic energy metabolism and has been linked to obesity, diabetes, and other diseases related to energy metabolism [11]. Whole-body energy metabolism is regulated in the hearts of Drosophila and mouse [17]. Cardiac overexpression of skd in transgenic (α-myosin heavy chain (αMHC)-MED13-TG or MED13-cTG) mice inhibits the binding of RNA polymerase II (Pol II) to MED, thereby inhibiting the transcription and expression of target genes involved in cardiac energy metabolism, improving insulin sensitivity and increasing energy expenditure, thereby preventing HFD-induced obesity [66]. In Drosophila, skd has been identified as a negative regulator of lipid accumulation [18].
In rodents, cardiac skd deficiency in the context of hypothyroidism exacerbates cardiac dysfunction [67]. Cardiac skd expression is primarily involved in energy homeostasis. However, it is unclear whether the effect of skd on cardiac energy metabolism affects cardiac function. Further studies are needed to determine whether cardiac skd is associated with other cardiovascular diseases and whether it regulates cardiac function.
We have demonstrated that cardiac-specific knockdown of skd affects cardiac function, mainly affecting cardiac rhythm problems, through a significant increase in AI and changes in cardiac structure, with the appearance of depression. Under NFD conditions, 12-KC showed a generalized obesity phenotype, increased systemic triglyceride levels, increased cardiac AI in Drosophila, and cardiac dysfunction in Drosophila. Moreover, the phenotype of 12-KC was similar to that of 12-HC and 36-C. Under HFD conditions, skd expression levels were reduced in the heart tube of 12-KHC Drosophila, and mRNA expression levels of srebp, Eip75B, and bmm were altered in the heart tube.
Our results show that HFD, aging, and cardiac-specific knockdown skd increase cardiac AI in Drosophila. The degree of fibrosis and fat accumulation increases in the aging Drosophila heart. Senescence is a disruption of intracellular Ca2+ [68] regulation driven by changes in the kinetics of L-type Ca2+ channel currents [69], transient outward K channel currents, and reduced activity of the SERCA Ca2+ pump [70]. The combination of these mechanisms ultimately leads to a high degree of arrhythmia.
Then, A study reported that a HFD activated NADPH oxidase 2 (NOX2) in the heart, which increased oxidative stress and led to abnormal calcium handling [71]. HFD can reduce Kv1.5, which generates repolarizing currents. Abnormal repolarization appears to play a role in the pathophysiology of arrhythmias after HFD [72]. In addition, high lipids exacerbate lipid accumulation and alter the cardiac structure and environment, and we showed that HFD altered Drosophila heart structure, HR, HP, DI, and SI. HFD promotes obesity and activates key signaling pathways including the renin–angiotensin–aldosterone system, TGF-β, connective tissue growth factor, and endothelin-1 activation can lead to increased interstitial collagen deposition and cardiac tubular fibrosis, which may disrupt atrial conduction, leading to AI [73,74].
Cardiac-specific knockdown skd Drosophila show a similar phenotype of hyperlipidemia and senescence with increased AI, probably also due to the above.
Exercise is an economical, nontoxic, and effective pill to improve heart function, alleviate and prevent obesity, improve metabolic levels, and delay premature aging. Some studies have reported that exercise can reduce excess body fat accumulation and obesity [75]. Exercise is considered an effective way to delay cardiac aging in the form of physiological stress that it induces. In aging mammals, increasing evidence confirms that moderate exercise training reduces abnormal cardiac remodeling, left-ventricular dilatation, myocardial fibrosis, mitochondrial dysfunction, and cardiac dysfunction, and improves cardiac function and quality of life [18,66]. Previous studies in our laboratory have confirmed that exercise improves cardiac function in Drosophila [32,33,35,38,76].
Our results suggest that exercise improves HFD, aging, and cardiac-specific knockdown skd Drosophila heart structure and reduces AI. The reduction of cardiac AI by exercise may be due to improvements in cardiometabolic risk factors, reduced sympathetic drive, and favorable changes in cardiac structure and function [73,77].
Exercise improves cardiac function in high-fat Drosophila, but it is unclear whether regular exercise improves age-related cardiac dysfunction and systemic lipid increase caused by cardiac skd-specific RNAi. To demonstrate this, we fed W1118>Hand-Gal4 and Hand-Gal4>skd RNAi flies HFD for 5 days, followed by regular exercise. The results showed that exercise increased skd expression in the heart tube, reduced AI, improved cardiac rhythm disturbances and cardiac myogenic fiber reconstruction in Drosophila in both the 12D and 36D groups, and substantially rescued myocardial fibers. Whole-body TG levels and ORO staining intensity were reduced. Curiously, whole-body TG increased in 12-E and 12-KE Drosophila; this may be because 12D Drosophila is in a growth phase, and the body is stressed to store energy to incubate offspring, causing the body to store fat. It is also possible that exercise raises the number of eggs and increases the size of the ovaries in Drosophila. This is because lipid accumulation is also important in reproduction and is necessary for ovarian fat accumulation in female Drosophila [76].
HFD downregulates skd expression in the heart tube of Drosophila 12D and 36D, with stronger ORO intensity and increased TG levels. Aging decreases skd expression in the heart tube, and increases ORO intensity, TG levels, and body weight. Exercise was also found to increase skd expression levels and reduce heart mass in mice [78]. The results showed that exercise training upregulated skd expression levels in the heart in both schizont and Drosophila.
The strategy of regulating substrate utilization to improve oxidative metabolism is rapidly becoming a popular therapy. Thus, can exercise improve metabolic genes? Exercise improves the expression levels of skd, srebp, Eip75B, and bmm in the heart at different ages and under different dietary conditions. In contrast, lipolysis, a major component of lipid metabolism, is the breakdown of TG to free fatty acids. Drosophila brummer (bmm) is homologous to the human adipose triglyceride lipase [79]. Previous studies have shown that bmm overexpression effectively prevents HFD-induced lipid accumulation and cardiac dysfunction [7]. Srebp sterol regulatory element binding proteins (SREBPs) are the major transcription factors that regulate cholesterol, fatty acid, and triglyceride biosynthesis [80], Inhibition of SREBP decreased cholesterol and fatty acid biosynthesis [81] and studies have reported that SREBPs partially mediate the deleterious effects of HFD on the heart. Drosophila Eip75B is homologous to the human and mammalian peroxisome value-added agent-activated receptor PPAR-γ. Studies have shown that cardiac-specific overexpression of Eip75B induces lipotoxicity in the heart [82]. Reduced activity of Eip75B, increased FFA oxidation, and reduced abiogenesis resist HFD-induced obesity [83]. Our results show that bmm mRNA levels are decreased in the hearts of HFD, aging, and heart-specific knockdown skd Drosophila, and increased in the heart tube after exercise. In the gene normal expression group, cardiac tubular srebp and Eip75B mRNA levels were elevated after HFD intervention and aging. In the NFD, 12-KC Drosophila heart tube Eip75B mRNA levels were similarly elevated, as were 12-KHC Drosophila heart srebp mRNA levels. Under NFD and HFD conditions, srebp and Eip75B mRNA levels in the heart tube were decreased in Drosophila from the genetically normal and cardiac deliberate knockdown groups after regular exercise. Unexpectedly, bmm mRNA levels were elevated in 12-KHC Drosophila. Possibly, the elevated triglyceride levels themselves in cardiac-specific knockdown Drosophila further exacerbate lipid accumulation after hyperlipidemia, possibly activating their own protective mechanisms and upregulating bmm expression levels. As with bmm, srebp and Eip75B mRNA levels mRNA expression levels were decreased in the heart tube of 12-KC Drosophila. The reason may be that the lipid content of Drosophila increased after Drosophila heart-specific knockdown of skd, but the young Drosophila’s own regulatory mechanism was not completely disrupted, and self-protection occurred. Decreased bmm mRNA expression levels in the heart tube of Drosophila 36-KE. The reason for this may be that triglycerides are a medium lipid storage form, and in older Drosophila, fat stores become less and less, while exercise promotes organism health and resists aging [84], keeping Drosophila heart tube bmm mRNA levels in a normal state.
Thus, exercise improved various physical indicators, and the mechanisms could be that exercise improved the mRNA expression levels of skd, srebp, Eip75B, and bmm in the heart tube. Based on our findings, we conclude that whenever we consume an HFD, it can impair our cardiac function and metabolic homeostasis. Appropriate exercise is effective and can improve cardiac function and metabolic status whether started young or old. These results suggest that specific knockdown of skd in the Drosophila heart tube causes general obesity, cardiometabolic disorders, cardiac dysfunction, and structural disruption of the heart, with loss of myogenic fibers and disorganization. Regular exercise increases skd expression in the heart, counteracts age-related cardiac and metabolic disorders induced by cardiac-specific knockdown of skd in HFD-fed Drosophila, restores the structure of the Drosophila heart tube and rescues myogenic fibers, and improves obesity caused by diet and aging.
However, in this experiment, a 5-day exercise intervention was performed on 12D and 36D Drosophila, with the possibility of a later exercise intervention of a different duration and different exercise lengths to further explore the mechanisms of exercise.
It is worthwhile to further explore the mechanisms by which regular exercise ameliorates age-related cardiac dysfunction caused by cardiac skd-specific knockdown. It may be related to the reported involvement of skd in adipose tissue conversion. Further proof at the protein side at a later stage. In addition, the Drosophila model also has limitations in human cardiovascular disease. Morphologically, the heart of Drosophila is a simple linear tube, while that of human beings is circular. Functionally, the Drosophila heart pumps hemolymph in the open circulatory system, while the human heart is part of the closed circulatory system [40]. The subtle physiological defects observed in the human cardiovascular system cannot be completely reproduced in Drosophila [85]. In Drosophila, it is still impossible to observe the reduction in the number of myocardial cells and left-ventricular hypertrophy in human heart aging.
A characteristic of human cardiac aging is a reduction in the number of cardiomyocytes, as well as a moderate left-ventricular hypertrophy [86]. However, it is difficult to determine the equivalent of “heart hypertrophy” in the aged hearts of flies.
In conclusion, HFD impairs cardiac function and promotes metabolic disorders. Cardiac-specific knockdown of skd impairs cardiac function, disrupts lipid metabolism, and accelerates aging in Drosophila. In contrast, exercise is the remedy, and regular exercise can counteract the age-related cardiac dysfunction caused by high lipids and cardiac skd-specific knockdown.

4. Materials and Methods

4.1. Fly Stocks and Groups

Two strains of Drosophila, W1118 (stock number: 3605; genotype: W1118) and hand-Gal4 (stock number: 48396; W [1118]; P{y [+t7.7] w [+mC] = GMR88D05-GAL4} attP2), were purchased from Bloomington Drosophila Stock Center. Skd-UAS-RNAi (stock number: v330726; genotype: P {VSH330726} attP40) was purchased from the Vienna Drosophila RNAi Center. The control Drosophila and cardiomyocyte skd knockdown Drosophila were generated by crossing male Hand-Gal4 with female W1118 or UAS-skd RNAi, and all crosses were collected within 12 h from F1-featured females for the experiment.
There are three variables in this experiment. For ease of writing, high-fat diet is denoted by HFD, normal-fat diet is denoted by NFD, regular exercise is denoted by E, 12 days old is denoted by 12D, and 36 days old is denoted by 36D. This experiment has the following groupings: Hand-Gal4>w1118-12D-NFD-C (12-C), Hand-Gal4>w1118-12D-NFD-E (12-E), Hand-Gal4>w1118-12D-HFD-C (12-HC), Hand-Gal4>w1118-12D-HFD-E (12-HE), Hand-Gal4>w1118-36D-NFD-C (36-C), Hand-Gal4>w1118-36D-NFD-E (36-E), Hand-Gal4>w1118-36D-HFD-C (36-HC), Hand-Gal4>w1118-36D-HFD-E (36-HE), Hand-Gal4>skdRNAi-12D-NFD-C (12-KC), Hand-Gal4>skdRNAi-12D-NFD-E (12-KE), Hand-Gal4>skdRNAi-12D-HFD-C (12-KHC), and Hand-Gal4>skdRNAi-12D-HFD-E (12 -KHE).
During the experiment, NFD Drosophila were placed in a 25 ± 1 °C incubator with 50% humidity and a 12 h light/dark cycle; HFD-fed Drosophila were placed in a 22 °C incubator to prevent coconut oil from melting and sticking to the flies.

4.2. Diet Preparation

The medium was prepared as Ryan T Birse [7,35]. The normal medium consists of soybean flour, corn flour, yeast flour, and sucrose. The high-fat medium was prepared by adding 30% coconut oil to the normal medium and mixing it well. All the diets were changed once every 2 days. 12D Drosophila started HFD on 2D and ended on 6 D; 36D Drosophila started HFD on 26D and ended on 30D.

4.3. Motion Devices and Protocols

We invented a locomotor device to induce continuous upward movement of the fruit flies by exploiting their natural negative grounding behavior. A glass jar containing 20 fruit flies was fixed horizontally to a steel tube, which is rotated along its horizontal axis by an electric motor, with a gear that regulates its shaft speed. The glass tube rotates with the tube, causing the fruit flies in the glass tube to make a climbing motion. Most of the fruit flies responded by climbing throughout the movement, while the few that could not climb actively walked along the inner wall of the glass tube. The distance between the glass jar and the stopper was adjusted before exercise to ensure that each glass tube was 8 cm away for exercise. In addition, the environment during exercise was consistent with the incubator environment. All exercise groups in this experiment had an exercise intervention of 5 D for 2.5 h each [87]. The 12-day-old exercise group started exercise on 7 D and ended on 11 D, with pickup on 12 D. The 36 D exercise group started exercise on 31 D and ended on 35 D, with pickup on 36 D [36].

4.4. Real-Time Quantitative PCR (qPCR)

Thirty heart tube tissue samples were collected from each group and homogenized, and total RNA was extracted using Trizol (Invitrogen, CA, USA) reagent in lysate according to the manufacturer’s protocol. cDNA was generated using Superscript III reverse transcriptase (Invitrogen, CA) and used as a template for quantitative real-time PCR. Thermal cycling and fluorescence monitoring was performed in an ABI7300 Real-time PCR Instrument (Applied Biosystems, USA): (30 s at 95 °C, 5 s at 95 °C, and 30 s at 60 °C) × 40. Real-time PCR was performed using SYBR green (TaKaRa) normalized with rp49. The relative abundance of the genes tested was calculated using the 2−ΔΔCt method [88]. The primers used for the expression analysis were skd (F: TCCCATAGCCGAGAAGATCCTTGAG; R: CTTATGACCACCCGACACCACTTC); srebp (F: GCAGTTCCTTCGTTTTCTTTTC; R: GGCTTCCATTTCCAGTCAGTT); bmm (F: ACTCACATTTCGCTTACCC; R: GAGAATCCGGGTATGAAGCA); Eip75B (F: AACTGCACCACCACTTGACA; R: TTCTTCTCGTTGCCCGACTC); Rp49 (F: CTAAGCTGTCGCACAAATGG; R: AACTTCTTGAATCCGGTGGG).

4.5. Analysis of Cardiac Function

Steps for preparation of semi-exposed Drosophila hearts: First, an artificial hemolymph solution was configured and placed under 26 °C conditions to pump oxygen for 30 min. Then, the fruit flies were anesthetized with carbon dioxide for 2–3 min and fixed on Petri dishes coated with medical petroleum jelly. Then, the head was removed with special scissors and forceps at the microscope, and the artificial hemolymph fluid filled with oxygen was added. Finally, the ventral thorax and ventral abdominal corpuscles were cut open under the microscope with special scissors and forceps to clip out their internal organs. The surrounding fat was aspirated with a capillary needle to expose the heart, and oxygen was pumped continuously for 30 min [89].
The heartbeat of the Drosophila was recorded using an EM-CCD high-speed camera (video 124 fps for 30 s), and the ECG data were recorded using HC Image software. Analysis of Drosophila heart function based on previous research methods by Martin Fink [90]. Semi-automated optical heartbeat analysis was used to quantify the heart rate (HR), heart period (HP), diastolic intervals (DI), systolic intervals (SI), and arrhythmia index (AI). Each sample group was 25 ± 5.

4.6. Oil Red O (ORO)

ORO is a fat-soluble dye that specifically colors neutral fats such as TG in the tissue. Sample preparation: The Drosophila was dissected in ADH and the head and tail were removed leaving the back plate. Sample fixation: The PBS was discarded, and 4% paraformaldehyde was used to fix the sample for 25 min. First wash: The 4% paraformaldehyde was discarded, and the sample was washed three times/10 min with PBS. Staining: A drop of Oil red O reagent (Oil Red O solution3:2 for staining solution and distilled water) was placed on the sample and incubated for 30 min on a shaker. Second wash: The dye was discarded, and the sample was washed with PBS three times/10 min. Sample fixation: A slide was prepared, and then the sample was transferred onto the slide and covered with a coverslip. Photography: A Leica stereo microscope (Leica; Wetzlar; Germany) was used to capture the images.

4.7. Phalloidin

Semi-intact Drosophila hearts were prepared as described previously [89]. The ADH was quickly replaced with a relaxation buffer (containing 10 mM EGTA ADH), and 4% paraformaldehyde was used to fix the sample for 25 min. Washing: The 4% paraformaldehyde was discarded, and the sample was washed three times/10 min with PBS. Staining: Drops of ghost pen cyclopeptide dye were placed on the sample and incubated for 30 min on a shaker protected from light. Third washing: The dye was discarded, and the sample was washed with PBS three times/10 min. Sample fixation: A slide was prepared, and then the sample was transferred to the prepared slide and covered with a coverslip. Finally, a Leica stereo microscope (Leica; Wetzlar; Germany) was used to capture the images.

4.8. Triglyceride Determination

The microplate method was used to measure whole-body TG levels in Drosophila. The test was performed using the Shanghai Enzyme-linked Biotechnology Co., Ltd. Triglyceride Content Assay Kit (ml076637, China). Take 15 fruit flies of appropriate age, divide them into 3 groups, and put them into mortar, 1 mL of anhydrous ethanol was added, homogenized on ice, centrifuged at 12,000 rpm for 10 min at 4 °C, and the supernatant was taken for measurement. This was used strictly according to the manufacturer’s instructions [43].

4.9. Statistical Analysis

The independent-samples t tests were used to assess the differences between 12-C Drosophila and 36-C, 12-C Drosophila and 12-HC Drosophila, 36-C Drosophila and 36-HC, 12-C and 12-KC, 12-KC and 12-KHC, and the sedentary group of Drosophila and the exercise group. Two-factor ANOVA was used, followed by LSD tests among 12-C, 12-HC, 12-KC, and 12-KHC. The GraphPad Prism and Statistical Package for Social Sciences (SPSS) version 2.0 were used for statistical analysis. The significance was set at p < 0.05. All the data are presented as means ± SEM [31].

4.10. Institutional Review Board Statement

The animal study protocol was approved by the Biomedical Research Ethics Committee of Hunan Normal University (Ethics Section 2022 No. 450).

5. Conclusions

1. Cardiac-specific knockdown of skd impairs cardiac function, disrupts lipid metabolism in Drosophila.
2. Regular exercise can resist age-related cardiac dysfunction caused by high lipids and cardiac skd-specific knockdown.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms24021216/s1.

Author Contributions

Y.C. writing—original draft, formal analysis and funding acquisition; S.H. project administration and supervision; M.D., W.G., T.W., S.Z. and J.F. data curation and investigation; Q.L. wrote the manuscript, revised the manuscript, investigation, and funding acquisition; L.Z. conceptualization, revised the manuscript and funding acquisition. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (grant number 32071175), the Hunan Provincial Innovation Foundation For Postgraduate (grant number CX20220498 and CX20210480).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

Abbreviations

AIarrhythmia index
Bmmbrummer
DIdiastolic intervals
F-actinfilamentous actin
HPheart period
HRheart rate
HFDhigh-fat diet
OROOil red O
skdSkuld
SIsystolic intervals
TGtriglycerides

References

  1. Caballero, B. Humans against Obesity: Who Will Win? Adv. Nutr. 2019, 10 (Suppl. 1), S4–S9. [Google Scholar] [CrossRef] [Scilit]
  2. Adams, M.D.; Celniker, S.E.; Holt, R.A.; Evans, C.A.; Gocayne, J.D.; Amanatides, P.G.; Scherer, S.E.; Li, P.W.; Hoskins, R.A.; Galle, R.F.; et al. The genome sequence of Drosophila melanogaster. Science 2000, 287, 2185–2195. [Google Scholar] [CrossRef] [Scilit]
  3. Packer, M. Epicardial Adipose Tissue May Mediate Deleterious Effects of Obesity and Inflammation on the Myocardium. J. Am. Coll. Cardiol. 2018, 71, 2360–2372. [Google Scholar] [CrossRef] [Scilit]
  4. Liao, S.; Amcoff, M.; Nassel, D.R. Impact of high-fat diet on lifespan, metabolism, fecundity and behavioral senescence in Drosophila. Insect Biochem. Mol. Biol. 2021, 133, 103495. [Google Scholar] [CrossRef] [Scilit]
  5. Mouton, A.J.; Li, X.; Hall, M.E.; Hall, J.E. Obesity, Hypertension, and Cardiac Dysfunction: Novel Roles of Immunometabolism in Macrophage Activation and Inflammation. Circ. Res. 2020, 126, 789–806. [Google Scholar] [CrossRef] [Scilit]
  6. Wilmot, E.G.; Edwardson, C.L.; Achana, F.A.; Davies, M.J.; Gorely, T.; Gray, L.J.; Khunti, K.; Yates, T.; Biddle, S.J. Sedentary time in adults and the association with diabetes, cardiovascular disease and death: Systematic review and meta-analysis. Diabetologia 2012, 55, 2895–2905. [Google Scholar] [CrossRef] [Scilit]
  7. Birse, R.T.; Choi, J.; Reardon, K.; Rodriguez, J.; Graham, S.; Diop, S.; Ocorr, K.; Bodmer, R.; Oldham, S. High-fat-diet-induced obesity and heart dysfunction are regulated by the TOR pathway in Drosophila. Cell Metab. 2010, 12, 533–544. [Google Scholar] [CrossRef] [Scilit]
  8. Grueter, C.E.; van Rooij, E.; Johnson, B.A.; DeLeon, S.M.; Sutherland, L.B.; Qi, X.; Gautron, L.; Elmquist, J.K.; Bassel-Duby, R.; Olson, E.N. A cardiac microRNA governs systemic energy homeostasis by regulation of MED13. Cell 2012, 149, 671–683. [Google Scholar] [CrossRef] [Scilit]
  9. Balaban, R.S.; Kantor, H.L.; Katz, L.A.; Briggs, R.W. Relation between work and phosphate metabolite in the in vivo paced mammalian heart. Science 1986, 232, 1121–1123. [Google Scholar] [CrossRef] [Scilit]
  10. Baskin, K.K.; Grueter, C.E.; Kusminski, C.M.; Holland, W.L.; Bookout, A.L.; Satapati, S.; Kong, Y.M.; Burgess, S.C.; Malloy, C.R.; Scherer, P.E.; et al. MED13-dependent signaling from the heart confers leanness by enhancing metabolism in adipose tissue and liver. EMBO Mol. Med. 2014, 6, 1610–1621. [Google Scholar] [CrossRef] [Scilit]
  11. Zhou, W.; Cai, H.; Li, J.; Xu, H.; Wang, X.; Men, H.; Zheng, Y.; Cai, L. Potential roles of mediator Complex Subunit 13 in Cardiac Diseases. Int. J. Biol. Sci. 2021, 17, 328–338. [Google Scholar] [CrossRef] [Scilit]
  12. Liu, Y.; Bao, H.; Wang, W.; Lim, H.Y. Cardiac Snail family of transcription factors directs systemic lipid metabolism in Drosophila. PLoS Genet. 2019, 15, e1008487. [Google Scholar] [CrossRef] [Scilit]
  13. Sun, K.; Kusminski, C.M.; Scherer, P.E. Adipose tissue remodeling and obesity. J. Clin. Investig. 2011, 121, 2094–2101. [Google Scholar] [CrossRef] [Scilit]
  14. Rosen, E.D.; Spiegelman, B.M. What we talk about when we talk about fat. Cell 2014, 156, 20–44. [Google Scholar] [CrossRef] [Scilit]
  15. Ito, M.; Yuan, C.X.; Malik, S.; Gu, W.; Fondell, J.D.; Yamamura, S.; Fu, Z.Y.; Zhang, X.; Qin, J.; Roeder, R.G. Identity between TRAP and SMCC complexes indicates novel pathways for the function of nuclear receptors and diverse mammalian activators. Mol. Cell 1999, 3, 361–370. [Google Scholar] [CrossRef] [Scilit]
  16. Janody, F.; Martirosyan, Z.; Benlali, A.; Treisman, J.E. Two subunits of the Drosophila mediator complex act together to control cell affinity. Development 2003, 130, 3691–3701. [Google Scholar] [CrossRef] [Scilit]
  17. Lee, J.H.; Bassel-Duby, R.; Olson, E.N. Heart- and muscle-derived signaling system dependent on MED13 and Wingless controls obesity in Drosophila. Proc. Natl. Acad. Sci. USA 2014, 111, 9491–9496. [Google Scholar] [CrossRef] [Scilit]
  18. Lum-Naihe, K.; Toedebusch, R.; Mahmood, A.; Bajwa, J.; Carmack, T.; Kumar, S.A.; Ardhanari, S.; DeMarco, V.G.; Emter, C.A.; Pulakat, L. Cardiovascular disease progression in female Zucker Diabetic Fatty rats occurs via unique mechanisms compared to males. Sci. Rep. 2017, 7, 17823. [Google Scholar] [CrossRef] [Scilit]
  19. Yang, F.; Vought, B.W.; Satterlee, J.S.; Walker, A.K.; Jim Sun, Z.Y.; Watts, J.L.; DeBeaumont, R.; Saito, R.M.; Hyberts, S.G.; Yang, S.; et al. An ARC/Mediator subunit required for SREBP control of cholesterol and lipid homeostasis. Nature 2006, 442, 700–704. [Google Scholar] [CrossRef] [Scilit]
  20. Jones, J.R.; Barrick, C.; Kim, K.A.; Lindner, J.; Blondeau, B.; Fujimoto, Y.; Shiota, M.; Kesterson, R.A.; Kahn, B.B.; Magnuson, M.A. Deletion of PPARgamma in adipose tissues of mice protects against high fat diet-induced obesity and insulin resistance. Proc. Natl. Acad. Sci. USA 2005, 102, 6207–6212. [Google Scholar] [CrossRef] [Scilit]
  21. Diop, S.B.; Bisharat-Kernizan, J.; Birse, R.T.; Oldham, S.; Ocorr, K.; Bodmer, R. PGC-1/Spargel Counteracts High-Fat-Diet-Induced Obesity and Cardiac Lipotoxicity Downstream of TOR and Brummer ATGL Lipase. Cell Rep. 2015, 10, 1572–1584. [Google Scholar] [CrossRef] [Scilit]
  22. Guo, S.S.; Zeller, C.; Chumlea, W.C.; Siervogel, R.M. Aging, body composition, and lifestyle: The Fels Longitudinal Study. Am. J. Clin. Nutr. 1999, 70, 405–411. [Google Scholar] [CrossRef] [Scilit]
  23. Lutz, W.; Sanderson, W.; Scherbov, S. The coming acceleration of global population ageing. Nature 2008, 451, 716–719. [Google Scholar] [CrossRef] [Scilit]
  24. Juppi, H.K.; Sipila, S.; Fachada, V.; Hyvarinen, M.; Cronin, N.; Aukee, P.; Karppinen, J.E.; Selanne, H.; Kujala, U.M.; Kovanen, V.; et al. Total and regional body adiposity increases during menopause-evidence from a follow-up study. Aging Cell 2022, 21, e13621. [Google Scholar] [CrossRef] [Scilit]
  25. Wang, X.; Xu, M.; Li, Y. Adipose Tissue Aging and Metabolic Disorder, and the Impact of Nutritional Interventions. Nutrients 2022, 14, 3134. [Google Scholar] [CrossRef] [Scilit]
  26. Barretti, D.L.; Magalhaes Fde, C.; Fernandes, T.; do Carmo, E.C.; Rosa, K.T.; Irigoyen, M.C.; Negrao, C.E.; Oliveira, E.M. Effects of aerobic exercise training on cardiac renin-angiotensin system in an obese Zucker rat strain. PLoS ONE 2012, 7, e46114. [Google Scholar] [CrossRef] [Scilit]
  27. Fernandes, T.; Barauna, V.G.; Negrao, C.E.; Phillips, M.I.; Oliveira, E.M. Aerobic exercise training promotes physiological cardiac remodeling involving a set of microRNAs. Am. J. Physiol. Heart Circ. Physiol. 2015, 309, H543–H552. [Google Scholar] [CrossRef] [Scilit]
  28. Silveira, A.C.; Fernandes, T.; Soci, U.P.R.; Gomes, J.L.P.; Barretti, D.L.; Mota, G.G.F.; Negrao, C.E.; Oliveira, E.M. Exercise Training Restores Cardiac MicroRNA-1 and MicroRNA-29c to Nonpathological Levels in Obese Rats. Oxidative Med. Cell. Longev. 2017, 2017, 1549014. [Google Scholar] [CrossRef] [Scilit]
  29. Boulghobra, D.; Coste, F.; Geny, B.; Reboul, C. Exercise training protects the heart against ischemia-reperfusion injury: A central role for mitochondria? Free Radic. Biol. Med. 2020, 152, 395–410. [Google Scholar] [CrossRef] [Scilit]
  30. Strasser, B. Physical activity in obesity and metabolic syndrome. Ann. N. Y. Acad. Sci. 2013, 1281, 141–159. [Google Scholar] [CrossRef] [Scilit]
  31. Wen, D.T.; Zheng, L.; Yang, F.; Li, H.Z.; Hou, W.Q. Endurance exercise prevents high-fat-diet induced heart and mobility premature aging and dsir2 expression decline in aging Drosophila. Oncotarget 2018, 9, 7298–7311. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Zheng, L.; Li, Q.F.; Ni, L.; Wang, H.; Ruan, X.C.; Wu, X.S. Lifetime regular exercise affects the incident of different arrhythmias and improves organismal health in aging female Drosophila melanogaster. Biogerontology 2017, 18, 97–108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Wen, D.T.; Zheng, L.; Lu, K.; Hou, W.Q. Activation of cardiac Nmnat/NAD+/SIR2 pathways mediates endurance exercise resistance to lipotoxic cardiomyopathy in aging Drosophila. J. Exp. Biol. 2021, 224, jeb242425. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Ding, M.; Zheng, L.; Li, Q.F.; Wang, W.L.; Peng, W.D.; Zhou, M. Exercise-Training Regulates Apolipoprotein B in Drosophila to Improve HFD-Mediated Cardiac Function Damage and Low Exercise Capacity. Front. Physiol. 2021, 12, 650959. [Google Scholar] [CrossRef] [Scilit]
  35. Huang, T.; Jian, X.; Liu, J.; Zheng, L.; Li, F.Q.; Meng, D.; Wang, T.; Zhang, S.; Liu, Y.; Guan, Z.; et al. Exercise and/or Cold Exposure Alters the Gene Expression Profile in the Fat Body and Changes the Heart Function in Drosophila. Front. Endocrinol. 2022, 13, 790414. [Google Scholar] [CrossRef] [Scilit]
  36. Piazza, N.; Gosangi, B.; Devilla, S.; Arking, R.; Wessells, R. Exercise-training in young Drosophila melanogaster reduces age-related decline in mobility and cardiac performance. PLoS ONE 2009, 4, e5886. [Google Scholar] [CrossRef] [Scilit]
  37. Sujkowski, A.; Wessells, R. Using Drosophila to Understand Biochemical and Behavioral Responses to Exercise. Exerc. Sport Sci. Rev. 2018, 46, 112–120. [Google Scholar] [CrossRef] [Scilit]
  38. Wen, D.T.; Zheng, L.; Li, J.X.; Lu, K.; Hou, W.Q. The activation of cardiac dSir2-related pathways mediates physical exercise resistance to heart aging in old Drosophila. Aging 2019, 11, 7274–7293. [Google Scholar] [CrossRef] [Scilit]
  39. Alfa, R.W.; Kim, S.K. Using Drosophila to discover mechanisms underlying type 2 diabetes. Dis. Model. Mech. 2016, 9, 365–376. [Google Scholar] [CrossRef] [Scilit]
  40. Souidi, A.; Jagla, K. Drosophila Heart as a Model for Cardiac Development and Diseases. Cells 2021, 10, 3078. [Google Scholar] [CrossRef] [Scilit]
  41. Molina, M.R.; Cripps, R.M. Ostia, the inflow tracts of the Drosophila heart, develop from a genetically distinct subset of cardial cells. Mech. Dev. 2001, 109, 51–59. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Hu, Q.; Zhang, H.; Gutierrez Cortes, N.; Wu, D.; Wang, P.; Zhang, J.; Mattison, J.A.; Smith, E.; Bettcher, L.F.; Wang, M.; et al. Increased Drp1 Acetylation by Lipid Overload Induces Cardiomyocyte Death and Heart Dysfunction. Circ. Res. 2020, 126, 456–470. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Diop, S.B.; Birse, R.T.; Bodmer, R. High Fat Diet Feeding and High Throughput Triacylglyceride Assay in Drosophila Melanogaster. J. Vis. Exp. 2017, e56029. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Abel, E.D.; Litwin, S.E.; Sweeney, G. Cardiac remodeling in obesity. Physiol. Rev. 2008, 88, 389–419. [Google Scholar] [CrossRef] [Scilit]
  45. Reiter, L.T.; Potocki, L.; Chien, S.; Gribskov, M.; Bier, E. A systematic analysis of human disease-associated gene sequences in Drosophila melanogaster. Genome Res. 2001, 11, 1114–1125. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Tao, Y.; Schulz, R.A. Heart development in Drosophila. Semin. Cell Dev. Biol. 2007, 18, 3–15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Bodmer, R.; Venkatesh, T.V. Heart development in Drosophila and vertebrates: Conservation of molecular mechanisms. Dev. Genet. 1998, 22, 181–186. [Google Scholar] [CrossRef] [Scilit]
  48. Brand, A.H.; Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 1993, 118, 401–415. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  49. Gratz, S.J.; Harrison, M.M.; Wildonger, J.; O’Connor-Giles, K.M. Precise Genome Editing of Drosophila with CRISPR RNA-Guided Cas9. Methods Mol. Biol. 2015, 1311, 335–348. [Google Scholar] [PubMed]
  50. Blice-Baum, A.C.; Guida, M.C.; Hartley, P.S.; Adams, P.D.; Bodmer, R.; Cammarato, A. As time flies by: Investigating cardiac aging in the short-lived Drosophila model. Biochim. Biophys. Acta Mol. Basis Dis. 2019, 1865, 1831–1844. [Google Scholar] [CrossRef] [Scilit]
  51. Tchkonia, T.; Morbeck, D.E.; Von Zglinicki, T.; Van Deursen, J.; Lustgarten, J.; Scrable, H.; Khosla, S.; Jensen, M.D.; Kirkland, J.L. Fat tissue, aging, and cellular senescence. Aging Cell 2010, 9, 667–684. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  52. Oldham, S. Obesity and nutrient sensing TOR pathway in flies and vertebrates: Functional conservation of genetic mechanisms. Trends Endocrinol. Metab. 2011, 22, 45–52. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  53. Foster, M.C.; Hwang, S.J.; Larson, M.G.; Lichtman, J.H.; Parikh, N.I.; Vasan, R.S.; Levy, D.; Fox, C.S. Overweight, obesity, and the development of stage 3 CKD: The Framingham Heart Study. Am. J. Kidney Dis. 2008, 52, 39–48. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Lee, Y.; Hirose, H.; Ohneda, M.; Johnson, J.H.; McGarry, J.D.; Unger, R.H. Beta-cell lipotoxicity in the pathogenesis of non-insulin-dependent diabetes mellitus of obese rats: Impairment in adipocyte-beta-cell relationships. Proc. Natl. Acad. Sci. USA 1994, 91, 10878–10882. [Google Scholar] [CrossRef] [Scilit]
  55. Borradaile, N.M.; Schaffer, J.E. Lipotoxicity in the heart. Curr. Hypertens. Rep. 2005, 7, 412–417. [Google Scholar] [CrossRef] [Scilit]
  56. Unger, R.H.; Scherer, P.E. Gluttony, sloth and the metabolic syndrome: A roadmap to lipotoxicity. Trends Endocrinol. Metab. 2010, 21, 345–352. [Google Scholar] [CrossRef] [Scilit]
  57. Wiersma, M.; van Marion, D.M.S.; Wust, R.C.I.; Houtkooper, R.H.; Zhang, D.; Groot, N.M.S.; Henning, R.H.; Brundel, B. Mitochondrial Dysfunction Underlies Cardiomyocyte Remodeling in Experimental and Clinical Atrial Fibrillation. Cells 2019, 8, 1202. [Google Scholar] [CrossRef] [Scilit]
  58. Vaquero, M.; Calvo, D.; Jalife, J. Cardiac fibrillation: From ion channels to rotors in the human heart. Heart Rhythm 2008, 5, 872–879. [Google Scholar] [CrossRef] [Scilit]
  59. Emelyanova, L.; Boukatina, A.; Myers, C.; Oyarzo, J.; Lustgarten, J.; Shi, Y.; Jahangir, A. High calories but not fat content of lard-based diet contribute to impaired mitochondrial oxidative phosphorylation in C57BL/6J mice heart. PLoS ONE 2019, 14, e0217045. [Google Scholar] [CrossRef] [Scilit]
  60. Jurado-Ruiz, E.; Alvarez-Amor, L.; Varela, L.M.; Berna, G.; Parra-Camacho, M.S.; Oliveras-Lopez, M.J.; Martinez-Force, E.; Rojas, A.; Hmadcha, A.; Soria, B.; et al. Extra virgin olive oil diet intervention improves insulin resistance and islet performance in diet-induced diabetes in mice. Sci. Rep. 2019, 9, 11311. [Google Scholar] [CrossRef] [Scilit]
  61. Perez, L.M.; Pareja-Galeano, H.; Sanchis-Gomar, F.; Emanuele, E.; Lucia, A.; Galvez, B.G. ‘Adipaging’: Ageing and obesity share biological hallmarks related to a dysfunctional adipose tissue. J. Physiol. 2016, 594, 3187–3207. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  62. Hunter, G.R.; Gower, B.A.; Kane, B.L. Age Related Shift in Visceral Fat. Int. J. Body Compos. Res. 2010, 8, 103–108. [Google Scholar] [PubMed]
  63. Jura, M.; Kozak, L.P. Obesity and related consequences to ageing. Age 2016, 38, 23. [Google Scholar] [CrossRef] [Scilit]
  64. Harmancey, R.; Wilson, C.R.; Taegtmeyer, H. Adaptation and maladaptation of the heart in obesity. Hypertension 2008, 52, 181–187. [Google Scholar] [CrossRef] [Scilit]
  65. Li, Q.F.; Wang, H.; Zheng, L.; Yang, F.; Li, H.Z.; Li, J.X.; Cheng, D.; Lu, K.; Liu, Y. Effects of Modest Hypoxia and Exercise on Cardiac Function, Sleep-Activity, Negative Geotaxis Behavior of Aged Female Drosophila. Front. Physiol. 2019, 10, 1610. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  66. Amoasii, L.; Holland, W.; Sanchez-Ortiz, E.; Baskin, K.K.; Pearson, M.; Burgess, S.C.; Nelson, B.R.; Bassel-Duby, R.; Olson, E.N. A MED13-dependent skeletal muscle gene program controls systemic glucose homeostasis and hepatic metabolism. Genes Dev. 2016, 30, 434–446. [Google Scholar] [CrossRef] [Scilit]
  67. Minerath, R.A.; Dewey, C.M.; Hall, D.D.; Grueter, C.E. Regulation of cardiac transcription by thyroid hormone and Med13. J. Mol. Cell. Cardiol. 2019, 129, 27–38. [Google Scholar] [CrossRef] [Scilit]
  68. Lompre, A.M.; Lambert, F.; Lakatta, E.G.; Schwartz, K. Expression of sarcoplasmic reticulum Ca(2+)-ATPase and calsequestrin genes in rat heart during ontogenic development and aging. Circ. Res. 1991, 69, 1380–1388. [Google Scholar] [CrossRef] [Scilit]
  69. Dai, D.F.; Santana, L.F.; Vermulst, M.; Tomazela, D.M.; Emond, M.J.; MacCoss, M.J.; Gollahon, K.; Martin, G.M.; Loeb, L.A.; Ladiges, W.C.; et al. Overexpression of catalase targeted to mitochondria attenuates murine cardiac aging. Circulation 2009, 119, 2789–2797. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  70. Baris, O.R.; Ederer, S.; Neuhaus, J.F.; von Kleist-Retzow, J.C.; Wunderlich, C.M.; Pal, M.; Wunderlich, F.T.; Peeva, V.; Zsurka, G.; Kunz, W.S.; et al. Mosaic Deficiency in Mitochondrial Oxidative Metabolism Promotes Cardiac Arrhythmia during Aging. Cell Metab. 2015, 21, 667–677. [Google Scholar] [CrossRef] [Scilit]
  71. Joseph, L.C.; Avula, U.M.R.; Wan, E.Y.; Reyes, M.V.; Lakkadi, K.R.; Subramanyam, P.; Nakanishi, K.; Homma, S.; Muchir, A.; Pajvani, U.B.; et al. Dietary Saturated Fat Promotes Arrhythmia by Activating NOX2 (NADPH Oxidase 2). Circ. Arrhythmia Electrophysiol. 2019, 12, e007573. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  72. Joseph, L.C.; Reyes, M.V.; Homan, E.A.; Gowen, B.; Avula, U.M.R.; Goulbourne, C.N.; Wan, E.Y.; Elrod, J.W.; Morrow, J.P. The mitochondrial calcium uniporter promotes arrhythmias caused by high-fat diet. Sci. Rep. 2021, 11, 17808. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  73. Lavie, C.J.; Pandey, A.; Lau, D.H.; Alpert, M.A.; Sanders, P. Obesity and Atrial Fibrillation Prevalence, Pathogenesis, and Prognosis: Effects of Weight Loss and Exercise. J. Am. Coll. Cardiol. 2017, 70, 2022–2035. [Google Scholar] [CrossRef] [Scilit]
  74. Abed, H.S.; Samuel, C.S.; Lau, D.H.; Kelly, D.J.; Royce, S.G.; Alasady, M.; Mahajan, R.; Kuklik, P.; Zhang, Y.; Brooks, A.G.; et al. Obesity results in progressive atrial structural and electrical remodeling: Implications for atrial fibrillation. Heart Rhythm 2013, 10, 90–100. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  75. Yu, J.; Zheng, J.; Liu, X.F.; Feng, Z.L.; Zhang, X.P.; Cao, L.L.; Zhou, Z.P. Exercise improved lipid metabolism and insulin sensitivity in rats fed a high-fat diet by regulating glucose transporter 4 (GLUT4) and musclin expression. Braz. J. Med. Biol. Res. 2016, 49, e5129. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  76. Ding, M.; Li, Q.F.; Yin, G.; Liu, J.L.; Jan, X.Y.; Huang, T.; Li, A.C.; Zheng, L. Effects of Drosophila melanogaster regular exercise and apolipoprotein B knockdown on abnormal heart rhythm induced by a high-fat diet. PLoS ONE 2022, 17, e0262471. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  77. Pathak, R.K.; Elliott, A.; Middeldorp, M.E.; Meredith, M.; Mehta, A.B.; Mahajan, R.; Hendriks, J.M.; Twomey, D.; Kalman, J.M.; Abhayaratna, W.P.; et al. Impact of CARDIOrespiratory FITness on Arrhythmia Recurrence in Obese Individuals With Atrial Fibrillation: The CARDIO-FIT Study. J. Am. Coll. Cardiol. 2015, 66, 985–996. [Google Scholar] [CrossRef] [Scilit]
  78. Fernandes, T.; Barretti, D.L.; Phillips, M.I.; Menezes Oliveira, E. Exercise training prevents obesity-associated disorders: Role of miRNA-208a and MED13. Mol. Cell. Endocrinol. 2018, 476, 148–154. [Google Scholar] [CrossRef] [Scilit]
  79. Gronke, S.; Mildner, A.; Fellert, S.; Tennagels, N.; Petry, S.; Muller, G.; Jackle, H.; Kuhnlein, R.P. Brummer lipase is an evolutionary conserved fat storage regulator in Drosophila. Cell Metab. 2005, 1, 323–330. [Google Scholar] [CrossRef] [Scilit]
  80. Xiao, J.; Xiong, Y.; Yang, L.T.; Wang, J.Q.; Zhou, Z.M.; Dong, L.W.; Shi, X.J.; Zhao, X.; Luo, J.; Song, B.L. POST1/C12ORF49 regulates the SREBP pathway by promoting site-1 protease maturation. Protein Cell 2021, 12, 279–296. [Google Scholar]
  81. Tang, J.J.; Li, J.G.; Qi, W.; Qiu, W.W.; Li, P.S.; Li, B.L.; Song, B.L. Inhibition of SREBP by a Small Molecule, Betulin, Improves Hyperlipidemia and Insulin Resistance and Reduces Atherosclerotic Plaques. Cell Metab. 2021, 33, 222. [Google Scholar] [CrossRef] [Scilit]
  82. Khan, D.; Ara, T.; Ravi, V.; Rajagopal, R.; Tandon, H.; Parvathy, J.; Gonzalez, E.A.; Asirvatham-Jeyaraj, N.; Krishna, S.; Mishra, S.; et al. SIRT6 transcriptionally regulates fatty acid transport by suppressing PPARgamma. Cell Rep. 2021, 35, 109190. [Google Scholar] [CrossRef] [Scilit]
  83. Kadowaki, T. PPAR gamma agonist and antagonist. Nihon Yakurigaku Zasshi 2001, 118, 321–326. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  84. Riddle, N.C. Drosophila melanogaster, a new model for exercise research. Acta Physiol. 2019, 227, e13352. [Google Scholar] [CrossRef] [Scilit]
  85. Choma, M.A.; Suter, M.J.; Vakoc, B.J.; Bouma, B.E.; Tearney, G.J. Physiological homology between Drosophila melanogaster and vertebrate cardiovascular systems. Dis. Model. Mech. 2011, 4, 411–420. [Google Scholar] [CrossRef] [Scilit]
  86. Olivetti, G.; Melissari, M.; Capasso, J.M.; Anversa, P. Cardiomyopathy of the aging human heart. Myocyte loss and reactive cellular hypertrophy. Circ. Res. 1991, 68, 1560–1568. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  87. Ding, M.; Li, H.; Zheng, L. Drosophila exercise, an emerging model bridging the fields of exercise and aging in human. Front. Cell Dev. Biol. 2022, 10, 966531. [Google Scholar] [CrossRef] [Scilit]
  88. Zou, Y.; Chen, Z.; Sun, C.; Yang, D.; Zhou, Z.; Peng, X.; Zheng, L.; Tang, C. Exercise Intervention Mitigates Pathological Liver Changes in NAFLD Zebrafish by Activating SIRT1/AMPK/NRF2 Signaling. Int. J. Mol. Sci. 2021, 22, 10940. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  89. Vogler, G.; Ocorr, K. Visualizing the beating heart in Drosophila. J. Vis. Exp. 2009, e1425. [Google Scholar] [CrossRef] [Scilit]
  90. Fink, M.; Callol-Massot, C.; Chu, A.; Ruiz-Lozano, P.; Izpisua Belmonte, J.C.; Giles, W.; Bodmer, R.; Ocorr, K. A new method for detection and quantification of heartbeat parameters in Drosophila, zebrafish, and embryonic mouse hearts. Biotechniques 2009, 46, 101–113. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Effects of HFD and aging on cardiac function and systemic TG metabolism in Drosophila. (A) Cardiac F-actin staining in W1118>Hand-Gal4 Drosophila. Note: scale bar = 100 μm, The two white arrows point to the heart of the fruit fly. (B) Cardiac function assays included AI in 12-C, 12-HC, 36-C, and 36-HC groups, N = 25 ± 5. (C) M-mode ECG. Note: Cardiac cycle—each group of M-mode ECGs was intercepted for 10 s, N = 25 ± 5. HP: horizontal blue line. DI: horizontal green line. SI: horizontal red line, Rectangle for fibrillation, # for cardiac arrest. (D) Cardiac skd expression. (E) Drosophila Abdominal ORO, scale bar = 250 μm. (F) Systemic TG of W1118>Hand-Gal4 Drosophila. (GI) The cardiac srebp, bmm, and Eip75B mRNA expression levels of 12D W1118>Hand-Gal4 Drosophila. Independent-samples t tests were used to assess differences between 12-C Drosophila and 36-C Drosophila; 12-C Drosophila and 12-HC Drosophila; 36-C Drosophila and 36-HC Drosophila. The data represent the mean, and the error bars represent SEM. ns p > 0.05; * p < 0.05; ** p < 0.01; *** p < 0.001.
Figure 1. Effects of HFD and aging on cardiac function and systemic TG metabolism in Drosophila. (A) Cardiac F-actin staining in W1118>Hand-Gal4 Drosophila. Note: scale bar = 100 μm, The two white arrows point to the heart of the fruit fly. (B) Cardiac function assays included AI in 12-C, 12-HC, 36-C, and 36-HC groups, N = 25 ± 5. (C) M-mode ECG. Note: Cardiac cycle—each group of M-mode ECGs was intercepted for 10 s, N = 25 ± 5. HP: horizontal blue line. DI: horizontal green line. SI: horizontal red line, Rectangle for fibrillation, # for cardiac arrest. (D) Cardiac skd expression. (E) Drosophila Abdominal ORO, scale bar = 250 μm. (F) Systemic TG of W1118>Hand-Gal4 Drosophila. (GI) The cardiac srebp, bmm, and Eip75B mRNA expression levels of 12D W1118>Hand-Gal4 Drosophila. Independent-samples t tests were used to assess differences between 12-C Drosophila and 36-C Drosophila; 12-C Drosophila and 12-HC Drosophila; 36-C Drosophila and 36-HC Drosophila. The data represent the mean, and the error bars represent SEM. ns p > 0.05; * p < 0.05; ** p < 0.01; *** p < 0.001.
Ijms 24 01216 g001
Figure 2. Cardiac function and systemic TG in 12-KC Drosophila under NFD and HFD conditions. (A) Cardiac-specific knockdown of skd in Drosophila strain validation and cardiac skd expression under 12-KC HFD conditions. (B) Cardiac F-actin staining in 12-KC Drosophila. Note: scale bar = 100 μm, The two white arrows point to the heart of the fruit fly. (C) 12-KC cardiac function under NFD and HFD conditions in Drosophila AI. (D) M-mode ECG, cardiac cycle—each group of M-mode ECGs was intercepted for 10 s, N = 25 ± 5. HP: horizontal blue line. DI: horizontal green line. SI: horizontal red line. Rectangle for fibrillation. # for cardiac arrest. (E) Drosophila Abdominal ORO. scale bar = 250 μm, N = 5. (F) Drosophila Whole-body TG levels. (GI) The cardiac srebp, bmm, and Eip75B mRNA expression levels on 12D KC Drosophila. Two-factor ANOVA was used, followed by LSD tests for 12-C, 12-HC, 12-KC, and 12-KHC. Independent-samples t test for assessment of 12-C and 12-KC, 12-KC and 12-KHC TG, SREBP, bmm, and Eip75B levels. The data represent the mean, and the error bars represent SEM. ns p > 0.05; * p < 0.05; ** p < 0.01; *** p < 0.001.
Figure 2. Cardiac function and systemic TG in 12-KC Drosophila under NFD and HFD conditions. (A) Cardiac-specific knockdown of skd in Drosophila strain validation and cardiac skd expression under 12-KC HFD conditions. (B) Cardiac F-actin staining in 12-KC Drosophila. Note: scale bar = 100 μm, The two white arrows point to the heart of the fruit fly. (C) 12-KC cardiac function under NFD and HFD conditions in Drosophila AI. (D) M-mode ECG, cardiac cycle—each group of M-mode ECGs was intercepted for 10 s, N = 25 ± 5. HP: horizontal blue line. DI: horizontal green line. SI: horizontal red line. Rectangle for fibrillation. # for cardiac arrest. (E) Drosophila Abdominal ORO. scale bar = 250 μm, N = 5. (F) Drosophila Whole-body TG levels. (GI) The cardiac srebp, bmm, and Eip75B mRNA expression levels on 12D KC Drosophila. Two-factor ANOVA was used, followed by LSD tests for 12-C, 12-HC, 12-KC, and 12-KHC. Independent-samples t test for assessment of 12-C and 12-KC, 12-KC and 12-KHC TG, SREBP, bmm, and Eip75B levels. The data represent the mean, and the error bars represent SEM. ns p > 0.05; * p < 0.05; ** p < 0.01; *** p < 0.001.
Ijms 24 01216 g002
Figure 3. Effects of regular exercise on cardiac function and general obesity of Drosophila with HFD. (A) Cardiac F-actin staining. Note: scale bar = 100 μm, The two white arrows point to the heart of the fruit fly. N = 5. (B) Effects of regular exercise on 12D and 36D NFD and HFD W1118>Hand-Gal4 Drosophila M-mode ECG. Note: Cardiac cycle—each group of M-mode ECGs was intercepted for 10 s, N = 25 ± 5. HP: horizontal blue line. DI: horizontal green line. SI: horizontal red line. Rectangle for fibrillation. # for cardiac arrest. (C) Regular exercise affects AI in cardiac function in 12D NFD and HFD Drosophila. N = 25 ± 5. (D) Regular exercise affects AI in cardiac function in 36D NFD and HFD Drosophila. N = 25 ± 5. (E) Effect of regular exercise on 12D NFD and HFD W1118>Hand-Gal4 Drosophila heart skd mRNA expression levels. (F) Effect of regular exercise on 36D NFD and HFD W1118>Hand-Gal4 Drosophila heart skd mRNA expression levels. (G) Effects of regular exercise on abdominal ORO staining in 12D, 36D NFD, and HFD W1118>Hand-Gal4.scale bar = 250 μm, N = 5. (H) Effects of regular exercise on systemic TG in 12D, NFD and HFD W1118>Hand-Gal4 Drosophila. (I) Effects of regular exercise on systemic TG in 36D, NFD and HFD W1118>Hand-Gal4 Drosophila. (J) Expression levels of 12D Drosophila heart tube srebp mRNA in after exercise intervention. (K) Expression levels of 36D Drosophila heart tube srebp mRNA in after exercise intervention. (L) Expression levels of 12D Drosophila heart tube Eip75B mRNA in after exercise intervention. (M) Expression levels of 36D Drosophila heart tube Eip75B mRNA in after exercise intervention. (N) Expression levels of 12D Drosophila heart tube bmm mRNA in after exercise intervention. (O) Expression levels of 36D Drosophila heart tube bmm mRNA in after exercise intervention. The independent-samples t test was used to assess the difference between the sedentary group of Drosophila and the exercise group. The data represent the mean, and the error bars represent SEM. * p < 0.05; ** p < 0.01; *** p < 0.001.
Figure 3. Effects of regular exercise on cardiac function and general obesity of Drosophila with HFD. (A) Cardiac F-actin staining. Note: scale bar = 100 μm, The two white arrows point to the heart of the fruit fly. N = 5. (B) Effects of regular exercise on 12D and 36D NFD and HFD W1118>Hand-Gal4 Drosophila M-mode ECG. Note: Cardiac cycle—each group of M-mode ECGs was intercepted for 10 s, N = 25 ± 5. HP: horizontal blue line. DI: horizontal green line. SI: horizontal red line. Rectangle for fibrillation. # for cardiac arrest. (C) Regular exercise affects AI in cardiac function in 12D NFD and HFD Drosophila. N = 25 ± 5. (D) Regular exercise affects AI in cardiac function in 36D NFD and HFD Drosophila. N = 25 ± 5. (E) Effect of regular exercise on 12D NFD and HFD W1118>Hand-Gal4 Drosophila heart skd mRNA expression levels. (F) Effect of regular exercise on 36D NFD and HFD W1118>Hand-Gal4 Drosophila heart skd mRNA expression levels. (G) Effects of regular exercise on abdominal ORO staining in 12D, 36D NFD, and HFD W1118>Hand-Gal4.scale bar = 250 μm, N = 5. (H) Effects of regular exercise on systemic TG in 12D, NFD and HFD W1118>Hand-Gal4 Drosophila. (I) Effects of regular exercise on systemic TG in 36D, NFD and HFD W1118>Hand-Gal4 Drosophila. (J) Expression levels of 12D Drosophila heart tube srebp mRNA in after exercise intervention. (K) Expression levels of 36D Drosophila heart tube srebp mRNA in after exercise intervention. (L) Expression levels of 12D Drosophila heart tube Eip75B mRNA in after exercise intervention. (M) Expression levels of 36D Drosophila heart tube Eip75B mRNA in after exercise intervention. (N) Expression levels of 12D Drosophila heart tube bmm mRNA in after exercise intervention. (O) Expression levels of 36D Drosophila heart tube bmm mRNA in after exercise intervention. The independent-samples t test was used to assess the difference between the sedentary group of Drosophila and the exercise group. The data represent the mean, and the error bars represent SEM. * p < 0.05; ** p < 0.01; *** p < 0.001.
Ijms 24 01216 g003
Figure 4. Effects of regular exercise on cardiac function and systemic obesity in Hand-Gal4>skd RNAi HFD Drosophila. (A) Cardiac F-actin staining in Drosophila. Note: scale bar = 100 μm, The two white arrows point to the heart of the fruit fly. N = 5. (B) Effects of regular exercise on cardiac function in 12D NFD and HFD Hand-Gal4>skd RNAi Drosophila M-mode ECG. Note: Cardiac cycle—each group of M-mode ECGs was intercepted for 10 s, N = 25 ± 5. HP: horizontal blue line. DI: horizontal green line. SI: horizontal red line. Rectangle for fibrillation. # for cardiac arrest. (C) Effects of regular exercise on AI in cardiac function in 12D Hand-Gal4>skd RNAi NFD and HFD Drosophila. N = 25 ± 5. (D) Effects of regular exercise on cardiac skd mRNA expression levels in 12D NFD and HFD Hand-Gal4>skd RNAi Drosophila. (E) Abdominal ORO staining. scale bar = 250 μm, N = 5. (F) Drosophila whole-body TG levels. (GI) Cardiac tube srebp, bmm, and Eip75B mRNA expression levels after exercise intervention in 12D NFD and HFD Hand-Gal4>skd RNAi Drosophila. The independent-samples t test was used to assess the difference between the sedentary group of Drosophila and the exercise group. * p < 0.05; ** p < 0.01; *** p < 0.001.
Figure 4. Effects of regular exercise on cardiac function and systemic obesity in Hand-Gal4>skd RNAi HFD Drosophila. (A) Cardiac F-actin staining in Drosophila. Note: scale bar = 100 μm, The two white arrows point to the heart of the fruit fly. N = 5. (B) Effects of regular exercise on cardiac function in 12D NFD and HFD Hand-Gal4>skd RNAi Drosophila M-mode ECG. Note: Cardiac cycle—each group of M-mode ECGs was intercepted for 10 s, N = 25 ± 5. HP: horizontal blue line. DI: horizontal green line. SI: horizontal red line. Rectangle for fibrillation. # for cardiac arrest. (C) Effects of regular exercise on AI in cardiac function in 12D Hand-Gal4>skd RNAi NFD and HFD Drosophila. N = 25 ± 5. (D) Effects of regular exercise on cardiac skd mRNA expression levels in 12D NFD and HFD Hand-Gal4>skd RNAi Drosophila. (E) Abdominal ORO staining. scale bar = 250 μm, N = 5. (F) Drosophila whole-body TG levels. (GI) Cardiac tube srebp, bmm, and Eip75B mRNA expression levels after exercise intervention in 12D NFD and HFD Hand-Gal4>skd RNAi Drosophila. The independent-samples t test was used to assess the difference between the sedentary group of Drosophila and the exercise group. * p < 0.05; ** p < 0.01; *** p < 0.001.
Ijms 24 01216 g004
Table 1. Two-way analysis of variance results for interaction effect of 12D Drosophila physical skd × HFD.
Table 1. Two-way analysis of variance results for interaction effect of 12D Drosophila physical skd × HFD.
Dependent VariableType III Sum of SquaresdfMean SquareFSig.
Heart rate7.18317.18338.7470.000
Heart period0.73610.73656.2330.000
Arrhythmicity index0.00410.0040.8560.357
Diastolic intervals0.60710.60755.3780.000
Systolic interval0.00610.0067.2520.008
TG level0.52810.5284.4250.069
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Cao, Y.; He, S.; Ding, M.; Gu, W.; Wang, T.; Zhang, S.; Feng, J.; Li, Q.; Zheng, L. Regular Exercise in Drosophila Prevents Age-Related Cardiac Dysfunction Caused by High Fat and Heart-Specific Knockdown of skd. Int. J. Mol. Sci. 2023, 24, 1216. https://doi.org/10.3390/ijms24021216

AMA Style

Cao Y, He S, Ding M, Gu W, Wang T, Zhang S, Feng J, Li Q, Zheng L. Regular Exercise in Drosophila Prevents Age-Related Cardiac Dysfunction Caused by High Fat and Heart-Specific Knockdown of skd. International Journal of Molecular Sciences. 2023; 24(2):1216. https://doi.org/10.3390/ijms24021216

Chicago/Turabian Style

Cao, Yurou, Shiyi He, Meng Ding, Wenzhi Gu, Tongquan Wang, Shihu Zhang, Jiadong Feng, Qiufang Li, and Lan Zheng. 2023. "Regular Exercise in Drosophila Prevents Age-Related Cardiac Dysfunction Caused by High Fat and Heart-Specific Knockdown of skd" International Journal of Molecular Sciences 24, no. 2: 1216. https://doi.org/10.3390/ijms24021216

APA Style

Cao, Y., He, S., Ding, M., Gu, W., Wang, T., Zhang, S., Feng, J., Li, Q., & Zheng, L. (2023). Regular Exercise in Drosophila Prevents Age-Related Cardiac Dysfunction Caused by High Fat and Heart-Specific Knockdown of skd. International Journal of Molecular Sciences, 24(2), 1216. https://doi.org/10.3390/ijms24021216

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop