ICI 182,780 Attenuates Selective Upregulation of Uterine Artery Cystathionine β-Synthase Expression in Rat Pregnancy
Abstract
:1. Introduction
2. Results
2.1. E2β Stimulates CBS Expression via ER Mediation in Rat UA Ex Vivo
2.2. ICI Decreases UA but Not Systemic Artery CBS mRNA in Rat Pregnancy In Vivo
2.3. ICI Decreases Rat UA Endothelial and SM CBS Protein
3. Discussion
4. Materials and Methods
4.1. Chemicals and Antibodies
4.2. Animals and Treatments
4.3. RNA Extraction, Reverse Transcription, and Quantitative Real-Time Polymerase Chain Reaction (qPCR)
4.4. Immunofluorescence Microscopy and Image Analysis
4.5. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Thornburg, K.L.; Jacobson, S.L.; Giraud, G.D.; Morton, M.J. Hemodynamic changes in pregnancy. Semin. Perinatol. 2000, 24, 11–14. [Google Scholar] [CrossRef] [PubMed]
- Sanghavi, M.; Rutherford, J.D. Cardiovascular physiology of pregnancy. Circulation 2014, 130, 1003–1008. [Google Scholar] [CrossRef] [PubMed]
- Rosenfeld, C.R. Distribution of cardiac output in ovine pregnancy. Am. J. Physiol. 1977, 232, H231–H235. [Google Scholar] [CrossRef] [PubMed]
- Palmer, S.K.; Zamudio, S.; Coffin, C.; Parker, S.; Stamm, E.; Moore, L.G. Quantitative estimation of human uterine artery blood flow and pelvic blood flow redistribution in pregnancy. Obstet. Gynecol. 1992, 80, 1000–1006. [Google Scholar] [PubMed]
- Redman, C.W.; Sargent, I.L. Latest advances in understanding preeclampsia. Science 2005, 308, 1592–1594. [Google Scholar] [CrossRef] [PubMed]
- Ives, C.W.; Sinkey, R.; Rajapreyar, I.; Tita, A.T.N.; Oparil, S. Preeclampsia—Pathophysiology and Clinical Presentations. J. Am. Coll. Cardiol. 2020, 76, 1690–1702. [Google Scholar] [CrossRef] [PubMed]
- Jung, E.; Romero, R.; Yeo, L.; Gomez-Lopez, N.; Chaemsaithong, P.; Jaovisidha, A.; Gotsch, F.; Erez, O. The etiology of preeclampsia. Am. J. Obstet. Gynecol. 2022, 226, S844–S866. [Google Scholar] [CrossRef] [PubMed]
- Gluckman, P.D.; Hanson, M.A.; Cooper, C.; Thornburg, K.L. Effect of in utero and early-life conditions on adult health and disease. N. Engl. J. Med. 2008, 359, 61–73. [Google Scholar] [CrossRef]
- Albrecht, E.D.; Pepe, G.J. Placental steroid hormone biosynthesis in primate pregnancy. Endocr. Rev. 1990, 11, 124–150. [Google Scholar] [CrossRef]
- Parisi, F.; Fenizia, C.; Introini, A.; Zavatta, A.; Scaccabarozzi, C.; Biasin, M.; Savasi, V. The pathophysiological role of estrogens in the initial stages of pregnancy: Molecular mechanisms and clinical implications for pregnancy outcome from the periconceptional period to end of the first trimester. Hum. Reprod. Updat. 2023, dmad016. [Google Scholar] [CrossRef]
- Magness, R.R.; Rosenfeld, C.R. Local and systemic estradiol-17 beta: Effects on uterine and systemic vasodilation. Am. J. Physiol. 1989, 256, E536–E542. [Google Scholar] [CrossRef] [PubMed]
- Magness, R.R.; Phernetton, T.M.; Zheng, J. Systemic and uterine blood flow distribution during prolonged infusion of 17beta-estradiol. Am. J. Physiol. 1998, 275, H731–H743. [Google Scholar] [PubMed]
- Magness, R.R.; Phernetton, T.M.; Gibson, T.C.; Chen, D.B. Uterine blood flow responses to ICI 182 780 in ovariectomized oestradiol-17beta-treated, intact follicular and pregnant sheep. J. Physiol. 2005, 565, 71–83. [Google Scholar] [CrossRef] [PubMed]
- Berkane, N.; Liere, P.; Oudinet, J.P.; Hertig, A.; Lefevre, G.; Pluchino, N.; Schumacher, M.; Chabbert-Buffet, N. From pregnancy to preeclampsia: A key role for estrogens. Endocr. Rev. 2017, 38, 123–144. [Google Scholar] [CrossRef] [PubMed]
- Magness, R.R.; Sullivan, J.A.; Li, Y.; Phernetton, T.M.; Bird, I.M. Endothelial vasodilator production by uterine and systemic arteries. VI. Ovarian and pregnancy effects on eNOS and NO(x). Am. J. Physiol. Heart Circ. Physiol. 2001, 280, H1692–H1698. [Google Scholar] [CrossRef]
- Rupnow, H.L.; Phernetton, T.M.; Shaw, C.E.; Modrick, M.L.; Bird, I.M.; Magness, R.R. Endothelial vasodilator production by uterine and systemic arteries. VII. Estrogen and progesterone effects on eNOS. Am. J. Physiol. Heart Circ. Physiol. 2001, 280, H1699–H1705. [Google Scholar] [CrossRef]
- Nelson, S.H.; Steinsland, O.S.; Wang, Y.; Yallampalli, C.; Dong, Y.L.; Sanchez, J.M. Increased nitric oxide synthase activity and expression in the human uterine artery during pregnancy. Circ. Res. 2000, 87, 406–411. [Google Scholar] [CrossRef] [PubMed]
- Chen, D.B.; Bird, I.M.; Zheng, J.; Magness, R.R. Membrane estrogen receptor-dependent extracellular signal-regulated kinase pathway mediates acute activation of endothelial nitric oxide synthase by estrogen in uterine artery endothelial cells. Endocrinology 2004, 145, 113–125. [Google Scholar] [CrossRef]
- Rosenfeld, C.R.; Cox, B.E.; Roy, T.; Magness, R.R. Nitric oxide contributes to estrogen-induced vasodilation of the ovine uterine circulation. J. Clin. Investig. 1996, 98, 2158–2166. [Google Scholar] [CrossRef]
- Van Buren, G.A.; Yang, D.S.; Clark, K.E. Estrogen-induced uterine vasodilatation is antagonized by L-nitroarginine methyl ester, an inhibitor of nitric oxide synthesis. Am. J. Obstet. Gynecol. 1992, 167, 828–833. [Google Scholar] [CrossRef]
- Larre, A.B.; Parisotto, A.; Rockenbach, B.F.; Pasin, D.M.; Capellari, C.; Escouto, D.C.; Pinheiro da Costa, B.E.; Poli-de-Figueiredo, C.E. Phosphodiesterases and preeclampsia. Med Hypotheses 2017, 108, 94–100. [Google Scholar] [CrossRef]
- Trapani, A., Jr.; Goncalves, L.F.; Trapani, T.F.; Vieira, S.; Pires, M.; Pires, M.M.S. Perinatal and hemodynamic evaluation of Sildenafil Citrate for preeclampsia treatment: A randomized controlled trial. Obstet. Gynecol. 2016, 128, 253–259. [Google Scholar] [CrossRef] [PubMed]
- Sharp, A.; Cornforth, C.; Jackson, R.; Harrold, J.; Turner, M.A.; Kenny, L.C.; Baker, P.N.; Johnstone, E.D.; Khalil, A.; von Dadelszen, P.; et al. Maternal sildenafil for severe fetal growth restriction (STRIDER): A multicentre, randomised, placebo-controlled, double-blind trial. Lancet Child Adolesc. Health 2018, 2, 93–102. [Google Scholar] [CrossRef] [PubMed]
- Papapetropoulos, A.; Pyriochou, A.; Altaany, Z.; Yang, G.; Marazioti, A.; Zhou, Z.; Jeschke, M.G.; Branski, L.K.; Herndon, D.N.; Wang, R.; et al. Hydrogen sulfide is an endogenous stimulator of angiogenesis. Proc. Natl. Acad. Sci. USA 2009, 106, 21972–21977. [Google Scholar] [CrossRef] [PubMed]
- Yang, G.; Wu, L.; Jiang, B.; Yang, W.; Qi, J.; Cao, K.; Meng, Q.; Mustafa, A.K.; Mu, W.; Zhang, S.; et al. H2S as a physiologic vasorelaxant: Hypertension in mice with deletion of cystathionine gamma-lyase. Science 2008, 322, 587–590. [Google Scholar] [CrossRef] [PubMed]
- Lechuga, T.J.; Zhang, H.H.; Sheibani, L.; Karim, M.; Jia, J.; Magness, R.R.; Rosenfeld, C.R.; Chen, D.B. Estrogen replacement therapy in ovariectomized nonpregnant ewes stimulates uterine artery hydrogen sulfide biosynthesis by selectively up-regulating cystathionine beta-synthase expression. Endocrinology 2015, 156, 2288–2298. [Google Scholar] [CrossRef]
- Lechuga, T.J.; Qi, Q.R.; Kim, T.; Magness, R.R.; Chen, D.B. E2beta stimulates ovine uterine artery endothelial cell H2S production in vitro by estrogen receptor-dependent upregulation of cystathionine beta-synthase and cystathionine gamma-lyase expression. Biol. Reprod. 2019, 100, 514–522. [Google Scholar] [CrossRef]
- Sheibani, L.; Lechuga, T.J.; Zhang, H.; Hameed, A.; Wing, D.A.; Kumar, S.; Rosenfeld, C.R.; Chen, D.B. Augmented H2S production via cystathionine-beta-synthase upregulation plays a role in pregnancy-associated uterine vasodilation. Biol. Reprod. 2017, 96, 664–672. [Google Scholar] [CrossRef]
- Lechuga, T.J.; Qi, Q.R.; Magness, R.R.; Chen, D.B. Ovine uterine artery hydrogen sulfide biosynthesis in vivo: Effects of ovarian cycle and pregnancydagger. Biol. Reprod. 2019, 100, 1630–1636. [Google Scholar] [CrossRef]
- Li, Y.; Bai, J.; Yang, Y.H.; Hoshi, N.; Chen, D.B. Hydrogen sulfide relaxes human uterine artery via activating smooth muscle BKCa channels. Antioxidants 2020, 9, 1127. [Google Scholar] [CrossRef]
- Rosenfeld, C.R.; Cornfield, D.N.; Roy, T. Ca2+-activated K+ channels modulate basal and E2beta-induced rises in uterine blood flow in ovine pregnancy. Am. J. Physiol. Heart Circ. Physiol. 2001, 281, H422–H431. [Google Scholar] [CrossRef] [PubMed]
- Rosenfeld, C.R.; Roy, T. Large conductance Ca2+-activated and voltage-activated K+ channels contribute to the rise and maintenance of estrogen-induced uterine vasodilation and maintenance of blood pressure. Endocrinology 2012, 153, 6012–6020. [Google Scholar] [CrossRef] [PubMed]
- Lechuga, T.J.; Bilg, A.K.; Patel, B.A.; Nguyen, N.A.; Qi, Q.R.; Chen, D.B. Estradiol-17beta stimulates H2S biosynthesis by ER-dependent CBS and CSE transcription in uterine artery smooth muscle cells in vitro. J. Cell Physiol. 2019, 234, 9264–9273. [Google Scholar] [CrossRef]
- Bai, J.; Lechuga, T.J.; Makhoul, J.; Yan, H.; Major, C.; Hameed, A.; Chen, D.B. ERalpha/ERbeta-directed CBS transcription mediates E2beta-stimulated hUAEC H2S production. J. Mol. Endocrinol. 2023, 70, 1109445. [Google Scholar] [CrossRef]
- Magness, R.R. Maternal cardiovascular and other physiologic responses to the endocrinology of pregnancy. In Endocrinology of Pregnancy; Contemporary Endocrinology; Bazer, F.W., Ed.; Humana Press: Totowa, NJ, USA, 1998; Volume 9, pp. 507–539. [Google Scholar]
- Dong, Y.L.; Fang, L.; Gangula, P.R.; Yallampalli, C. Regulation of inducible nitric oxide synthase messenger ribonucleic acid expression in pregnant rat uterus. Biol. Reprod. 1998, 59, 933–940. [Google Scholar] [CrossRef] [PubMed]
- Markee, J.E. Rhythmic vascular uterine changes. Am. J. Physiol. 1932, 100, 32–39. [Google Scholar] [CrossRef]
- Greiss, F.C., Jr.; Anderson, S.G. Effect of ovarian hormones on the uterine vascular bed. Am. J. Obstet. Gynecol. 1970, 107, 829–836. [Google Scholar] [CrossRef] [PubMed]
- Killam, A.P.; Rosenfeld, C.R.; Battaglia, F.C.; Makowski, E.L.; Meschia, G. Effect of estrogens on the uterine blood flow of oophorectomized ewes. Am. J. Obstet. Gynecol. 1973, 115, 1045–1052. [Google Scholar] [CrossRef]
- Rosenfeld, C.R.; Killam, A.P.; Battaglia, F.C.; Makowski, E.L.; Meschia, G. Effect of estradiol-17, on the magnitude and distribution of uterine blood flow in nonpregnant, oophorectomized ewes. Pediatr. Res. 1973, 7, 139–148. [Google Scholar] [CrossRef]
- Resnik, R.; Killam, A.P.; Battaglia, F.C.; Makowski, E.L.; Meschia, G. The stimulation of uterine blood flow by various estrogens. Endocrinology 1974, 94, 1192–1196. [Google Scholar] [CrossRef]
- Magness, R.R.; Parker, C.R., Jr.; Rosenfeld, C.R. Systemic and uterine responses to chronic infusion of estradiol-17 beta. Am. J. Physiol. 1993, 265, E690–E698. [Google Scholar] [CrossRef] [PubMed]
- Miller, V.M.; Duckles, S.P. Vascular actions of estrogens: Functional implications. Pharmacol. Rev. 2008, 60, 210–241. [Google Scholar] [CrossRef]
- Jobe, S.O.; Tyler, C.T.; Magness, R.R. Aberrant synthesis, metabolism, and plasma accumulation of circulating estrogens and estrogen metabolites in preeclampsia implications for vascular dysfunction. Hypertension 2013, 61, 480–487. [Google Scholar] [CrossRef] [PubMed]
- Kanasaki, K.; Palmsten, K.; Sugimoto, H.; Ahmad, S.; Hamano, Y.; Xie, L.; Parry, S.; Augustin, H.G.; Gattone, V.H.; Folkman, J.; et al. Deficiency in catechol-O-methyltransferase and 2-methoxyoestradiol is associated with pre-eclampsia. Nature 2008, 453, 1117–1121. [Google Scholar] [CrossRef] [PubMed]
- Chambliss, K.; Mineo, C.; Shaul, P.W. Endothelial biology of estrogen and cardiovascular disease. Endocrinology 2023, bqad122. [Google Scholar] [CrossRef] [PubMed]
- Levine, M.G.; Miodovnik, M.; Clark, K.E. Uterine vascular effects of estetrol in nonpregnant ewes. Am. J. Obstet. Gynecol. 1984, 148, 735–738. [Google Scholar] [CrossRef] [PubMed]
- Clark, K.E.; Baker, R.S.; Lang, U. Premarin-induced increases in coronary and uterine blood flow in nonpregnant sheep. Am. J. Obstet. Gynecol. 2000, 183, 12–17. [Google Scholar]
- Rosenfeld, C.R.; Jackson, G.M. Induction and inhibition of uterine vasodilation by catechol estrogen in oophorectomized, nonpregnant ewes. Endocrinology 1982, 110, 1333–1339. [Google Scholar] [CrossRef]
- Magness, R.R.; Mitchell, M.D.; Rosenfeld, C.R. Uteroplacental production of eicosanoids in ovine pregnancy. Prostaglandins 1990, 39, 75–88. [Google Scholar] [CrossRef]
- Gibson, T.C.; Phernetton, T.M.; Wiltbank, M.C.; Magness, R.R. Development and use of an ovarian synchronization model to study the effects of endogenous estrogen and nitric oxide on uterine blood flow during ovarian cycles in sheep. Biol. Reprod. 2004, 70, 1886–1894. [Google Scholar] [CrossRef]
- Ford, S.P. Control of uterine and ovarian blood flow throughout the estrous cycle and pregnancy of ewes, sows and cows. J. Anim. Sci. 1982, 55 (Suppl. S2), 32–42. [Google Scholar] [PubMed]
- Magness, R.R.; Rosenfeld, C.R.; Carr, B.R. Protein kinase C in uterine and systemic arteries during ovarian cycle and pregnancy. Am. J. Physiol. 1991, 260, E464–E470. [Google Scholar] [CrossRef] [PubMed]
- Bernstein, I.M.; Ziegler, W.F.; Leavitt, T.; Badger, G.J. Uterine artery hemodynamic adaptations through the menstrual cycle into early pregnancy. Obstet. Gynecol. 2002, 99, 620–624. [Google Scholar] [PubMed]
- Resnik, R.; Brink, G.W.; Plumer, M.H. The effect of progesterone on estrogen-induced uterine blood flow. Am. J. Obstet. Gynecol. 1977, 128, 251–254. [Google Scholar] [CrossRef] [PubMed]
- Magness, R.R.; Rosenfeld, C.R. The role of steroid hormones in the control of uterine blood flow. In The Uterine Circulation; Perinatology Press: Ithaca, NY, USA, 1989; Volume 10, pp. 239–271. [Google Scholar]
- Liao, W.X.; Magness, R.R.; Chen, D.B. Expression of estrogen receptors-alpha and -beta in the pregnant ovine uterine artery endothelial cells in vivo and in vitro. Biol. Reprod. 2005, 72, 530–537. [Google Scholar] [CrossRef] [PubMed]
- Byers, M.J.; Zangl, A.; Phernetton, T.M.; Lopez, G.; Chen, D.B.; Magness, R.R. Endothelial vasodilator production by ovine uterine and systemic arteries: Ovarian steroid and pregnancy control of ERalpha and ERbeta levels. J. Physiol. 2005, 565, 85–99. [Google Scholar] [CrossRef]
- Mishra, J.S.; Te Riele, G.M.; Qi, Q.R.; Lechuga, T.J.; Gopalakrishnan, K.; Chen, D.B.; Kumar, S. Estrogen receptor-beta mediates estradiol-induced pregnancy-specific uterine artery endothelial cell angiotensin type-2 receptor expression. Hypertension 2019, 74, 967–974. [Google Scholar] [CrossRef]
- O’Regan, R.M.; Cisneros, A.; England, G.M.; MacGregor, J.I.; Muenzner, H.D.; Assikis, V.J.; Bilimoria, M.M.; Piette, M.; Dragan, Y.P.; Pitot, H.C.; et al. Effects of the antiestrogens tamoxifen, toremifene, and ICI 182,780 on endometrial cancer growth. J. Natl. Cancer Inst. 1998, 90, 1552–1558. [Google Scholar] [CrossRef]
- Goldstein, S.R.; Siddhanti, S.; Ciaccia, A.V.; Plouffe, L., Jr. A pharmacological review of selective oestrogen receptor modulators. Hum. Reprod. Update 2000, 6, 212–224. [Google Scholar] [CrossRef]
- al-Matubsi, H.Y.; Fairclough, R.J.; Jenkin, G. Oestrogenic effects of ICI 182,780, a putative anti-oestrogen, on the secretion of oxytocin and prostaglandin F2alpha during oestrous cycle in the intact ewe. Anim. Reprod. Sci. 1998, 51, 81–96. [Google Scholar] [CrossRef]
- Zoma, W.; Baker, R.S.; Lang, U.; Clark, K.E. Hemodynamic response to tibolone in reproductive and nonreproductive tissues in the sheep. Am. J. Obstet. Gynecol. 2001, 184, 544–551. [Google Scholar] [CrossRef] [PubMed]
- MacRitchie, A.N.; Jun, S.S.; Chen, Z.; German, Z.; Yuhanna, I.S.; Sherman, T.S.; Shaul, P.W. Estrogen upregulates endothelial nitric oxide synthase gene expression in fetal pulmonary artery endothelium. Circ. Res. 1997, 81, 355–362. [Google Scholar] [CrossRef] [PubMed]
- Ramadoss, J.; Liao, W.X.; Morschauser, T.J.; Lopez, G.E.; Patankar, M.S.; Chen, D.B.; Magness, R.R. Endothelial caveolar hub regulation of adenosine triphosphate-induced endothelial nitric oxide synthase subcellular partitioning and domain-specific phosphorylation. Hypertension 2012, 59, 1052–1059. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Yuhanna, I.S.; Galcheva-Gargova, Z.; Karas, R.H.; Mendelsohn, M.E.; Shaul, P.W. Estrogen receptor alpha mediates the nongenomic activation of endothelial nitric oxide synthase by estrogen. J. Clin. Investig. 1999, 103, 401–406. [Google Scholar] [CrossRef] [PubMed]
- Fulton, D.; Gratton, J.P.; McCabe, T.J.; Fontana, J.; Fujio, Y.; Walsh, K.; Franke, T.F.; Papapetropoulos, A.; Sessa, W.C. Regulation of endothelium-derived nitric oxide production by the protein kinase Akt. Nature 1999, 399, 597–601. [Google Scholar] [CrossRef] [PubMed]
- Wang, R. Hydrogen sulfide: The third gasotransmitter in biology and medicine. Antioxid. Redox Signal. 2010, 12, 1061–1064. [Google Scholar] [CrossRef] [PubMed]
- Weiner, C.P.; Lizasoain, I.; Baylis, S.A.; Knowles, R.G.; Charles, I.G.; Moncada, S. Induction of calcium-dependent nitric oxide synthases by sex hormones. Proc. Natl. Acad. Sci. USA 1994, 91, 5212–5216. [Google Scholar] [CrossRef]
- Kulandavelu, S.; Whiteley, K.J.; Qu, D.; Mu, J.; Bainbridge, S.A.; Adamson, S.L. Endothelial nitric oxide synthase deficiency reduces uterine blood flow, spiral artery elongation, and placental oxygenation in pregnant mice. Hypertension 2012, 60, 231–238. [Google Scholar] [CrossRef]
- Bai, J.; Qi, Q.R.; Li, Y.; Day, R.; Makhoul, J.; Magness, R.R.; Chen, D.B. Estrogen receptors and estrogen-induced uterine vasodilation in pregnancy. Int. J. Mol. Sci. 2020, 21, 4349–4398. [Google Scholar] [CrossRef]
- Tropea, T.; De Francesco, E.M.; Rigiracciolo, D.; Maggiolini, M.; Wareing, M.; Osol, G.; Mandala, M. Pregnancy augments G-protein estrogen receptor (GPER) induced vasodilation in rat uterine arteries via the nitric oxide-cGMP signaling pathway. PLoS ONE 2015, 10, e0141997. [Google Scholar] [CrossRef]
- Tropea, T.; Rigiracciolo, D.; Esposito, M.; Maggiolini, M.; Mandala, M. G-protein-coupled estrogen receptor expression in rat uterine artery is increased by pregnancy and induces dilation in a Ca2+ and ERK1/2 dependent manner. Int. J. Mol. Sci. 2022, 23, 5996. [Google Scholar] [CrossRef]
- Lin, A.H.; Li, R.W.; Ho, E.Y.; Leung, G.P.; Leung, S.W.; Vanhoutte, P.M.; Man, R.Y. Differential ligand binding affinities of human estrogen receptor-alpha isoforms. PLoS ONE 2013, 8, e63199. [Google Scholar]
- Oliveira, C.A.; Zhou, Q.; Carnes, K.; Nie, R.; Kuehl, D.E.; Jackson, G.L.; Franca, L.R.; Nakai, M.; Hess, R.A. ER function in the adult male rat: Short- and long-term effects of the antiestrogen ICI 182,780 on the testis and efferent ductules, without changes in testosterone. Endocrinology 2002, 143, 2399–2409. [Google Scholar] [CrossRef]
- Bai, J.; Chen, D.B. Enhanced Sp1/YY1 expression directs CBS transcription to mediate VEGF-stimulated pregnancy-dependent H2S production in human uterine artery endothelial cells. Hypertension 2021, 78, 1902–1913. [Google Scholar] [CrossRef]
Gene | Forward | Reverse | Product Size |
---|---|---|---|
CBS | TGAGATTGTGAGGACGCCCAC | TCGCACTGCTGCAGGATCTC | 177 bp |
CSE | AGCGATCACACCACAGACCAAG | ATCAGCACCCAGAGCCAAAGG | 178 bp |
eNOS | TACAGAGCAGCAAATCCAC | CAGGCTGCAGTCCTTTGAT | 813 bp |
L19 | GGACCCCAATGAAACCAACG | GTGTTCTTCTAGCATCGAGC | 129 bp |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bai, J.; Li, Y.; Yan, G.; Zhou, J.; Salmeron, A.G.; Fategbe, O.T.; Kumar, S.; Chen, X.; Chen, D.-B. ICI 182,780 Attenuates Selective Upregulation of Uterine Artery Cystathionine β-Synthase Expression in Rat Pregnancy. Int. J. Mol. Sci. 2023, 24, 14384. https://doi.org/10.3390/ijms241814384
Bai J, Li Y, Yan G, Zhou J, Salmeron AG, Fategbe OT, Kumar S, Chen X, Chen D-B. ICI 182,780 Attenuates Selective Upregulation of Uterine Artery Cystathionine β-Synthase Expression in Rat Pregnancy. International Journal of Molecular Sciences. 2023; 24(18):14384. https://doi.org/10.3390/ijms241814384
Chicago/Turabian StyleBai, Jin, Yao Li, Guofeng Yan, Jing Zhou, Alejandra Garcia Salmeron, Olamide Tolulope Fategbe, Sathish Kumar, Xuejin Chen, and Dong-Bao Chen. 2023. "ICI 182,780 Attenuates Selective Upregulation of Uterine Artery Cystathionine β-Synthase Expression in Rat Pregnancy" International Journal of Molecular Sciences 24, no. 18: 14384. https://doi.org/10.3390/ijms241814384