Alterations in Mitochondrial Morphology and Quality Control in Primary Mouse Lung Microvascular Endothelial Cells and Human Dermal Fibroblasts under Hyperglycemic Conditions
Abstract
1. Introduction
2. Results
2.1. Hyperglycemia Induces a Decrease in the Membrane Potential of Mitochondria in Primary Endotheliocytes and Fibroblasts
2.2. Hyperglycemia Promotes Bidirectional Changes in the Morphology of Individual Mitochondria in Primary Mouse Lung Microvascular Endothelial Cells and Human Dermal Fibroblasts
2.3. Effect of Hyperglycemia on the mRNA Expression of Proteins Responsible for Mitochondrial Biogenesis, Mitochondrial Dynamics, and Mitophagy in Primary Endotheliocyte and Fibroblast Cultures
3. Discussion
4. Materials and Methods
4.1. Isolation and Culture of Primary Mouse Lung Microvascular Endothelial Cells and Human Dermal Fibroblasts
4.2. Mitochondrial Membrane Potential Assay
4.3. Assessment of the Morphology of Individual Mitochondria by Confocal Microscopy
4.4. RNA Extraction, Reverse Transcription, and Quantitative Real-Time PCR
4.5. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Maruhashi, T.; Higashi, Y. Pathophysiological Association between Diabetes Mellitus and Endothelial Dysfunction. Antioxidants 2021, 10, 1306. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Belosludtsev, K.N.; Belosludtseva, N.V.; Dubinin, M.V. Diabetes Mellitus, Mitochondrial Dysfunction and Ca2+-Dependent Permeability Transition Pore. Int. J. Mol. Sci. 2020, 21, 6559. [Google Scholar] [CrossRef] [Scilit]
- Sivitz, W.I.; Yorek, M.A. Mitochondrial Dysfunction in Diabetes: From Molecular Mechanisms to Functional Significance And Therapeutic Opportunities. Antioxid. Redox Signal. 2010, 12, 537–577. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Joseph, A.M.; Joanisse, D.R.; Baillot, R.G.; Hood, D.A. Mitochondrial Dysregulation in The Pathogenesis of Diabetes: Potential for Mitochondrial Biogenesis-Mediated Interventions. Exp. Diabetes Res. 2012, 2012, 642038. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Belosludtsev, K.N.; Starinets, V.S.; Talanov, E.Y.; Mikheeva, I.B.; Dubinin, M.V.; Belosludtseva, N.V. Alisporivir Treatment Alleviates Mitochondrial Dysfunction in the Skeletal Muscles of C57BL/6NCrl Mice with High-Fat Diet/Streptozotocin-Induced Diabetes Mellitus. Int. J. Mol. Sci. 2021, 22, 9524. [Google Scholar] [CrossRef] [Scilit]
- Pinti, M.V.; Fink, G.K.; Hathaway, Q.A.; Durr, A.J.; Kunovac, A.; Hollander, J.M. Mitochondrial Dysfunction in Type 2 Diabetes Mellitus: An Organ-Based Analysis. Am. J. Physiol. Endocrinol. Metab. 2019, 316, E268–E285. [Google Scholar] [CrossRef] [Scilit]
- Belosludtseva, N.V.; Starinets, V.S.; Mikheeva, I.B.; Serov, D.A.; Astashev, M.E.; Belosludtsev, M.N.; Dubinin, M.V.; Belosludtsev, K.N. Effect of the MPT Pore Inhibitor Alisporivir on the Development of Mitochondrial Dysfunction in the Heart Tissue of Diabetic Mice. Biology 2021, 10, 839. [Google Scholar] [CrossRef] [Scilit]
- Belosludtsev, K.N.; Starinets, V.S.; Belosludtsev, M.N.; Mikheeva, I.B.; Dubinin, M.V.; Belosludtseva, N.V. Chronic Treatment with Dapagliflozin Protects against Mitochondrial Dysfunction in the Liver of C57BL/6NCrl Mice with High-Fat Diet/Streptozotocin-Induced Diabetes Mellitus. Mitochondrion 2021, 59, 246–254. [Google Scholar] [CrossRef] [Scilit]
- Ferreira, F.M.; Seiça, R.; Oliveira, P.J.; Coxito, P.M.; Moreno, A.J.; Palmeira, C.M.; Santos, M.S. Diabetes Induces Metabolic Adaptations in Rat Liver Mitochondria: Role of Coenzyme Q And Cardiolipin Contents. Biochim. Biophys. Acta 2003, 1639, 113–120. [Google Scholar] [CrossRef] [Scilit]
- Belosludtsev, K.N.; Talanov, E.Y.; Starinets, V.S.; Agafonov, A.V.; Dubinin, M.V.; Belosludtseva, N.V. Transport of Ca2+ and Ca2+-Dependent Permeability Transition in Rat Liver Mitochondria under the Streptozotocin-Induced Type I Diabetes. Cells 2019, 8, 1014. [Google Scholar] [CrossRef] [Scilit]
- Suarez, J.; Cividini, F.; Scott, B.T.; Lehmann, K.; Diaz-Juarez, J.; Diemer, T.; Dai, A.; Suarez, J.A.; Jain, M.; Dillmann, W.H. Restoring Mitochondrial Calcium Uniporter Expression in Diabetic Mouse Heart Improves Mitochondrial Calcium Handling and Cardiac Function. J. Biol. Chem. 2018, 293, 8182–8195. [Google Scholar] [CrossRef] [Scilit]
- Ahmed, M.; Muhammed, S.J.; Kessler, B.; Salehi, A. Mitochondrial Proteome Analysis Reveals Altered Expression of Voltage Dependent Anion Channels in Pancreatic β-cells Exposed to High Glucose. Islets 2010, 2, 283–292. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gong, D.; Chen, X.; Middleditch, M.; Huang, L.; Vazhoor Amarsingh, G.; Reddy, S.; Lu, J.; Zhang, S.; Ruggiero, K.; Phillips, A.R.; et al. Quantitative Proteomic Profiling Identifies New Renal Targets of Copper(II)-Selective Chelation in the Reversal Of Diabetic Nephropathy in Rats. Proteomics 2009, 9, 4309–4320. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kuznetsov, A.V.; Margreiter, R. Heterogeneity of Mitochondria and Mitochondrial Function within Cells as Another Level of Mitochondrial Complexity. Int. J. Mol. Sci. 2009, 10, 1911–1929. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Patti, M.E.; Butte, A.J.; Crunkhorn, S.; Cusi, K.; Berria, R.; Kashyap, S.; Miyazaki, Y.; Kohane, I.; Costello, M.; Saccone, R. Coordinated Reduction of Genes of Oxidative Metabolism in Humans with Insulin Resistance and Diabetes: Potential Role of PGC1 and NRF1. Proc. Natl. Acad. Sci. USA 2003, 100, 8466–8471. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Choi, J.; Chandrasekaran, K.; Inoue, T.; Muragundla, A.; Russell, J.W. PGC-1α Regulation of Mitochondrial Degeneration In Experimental Diabetic Neuropathy. Neurobiol. Dis. 2014, 64, 118–130. [Google Scholar] [CrossRef] [Scilit]
- Yoon, J.C.; Puigserver, P.; Chen, G.; Donovan, J.; Wu, Z.; Rhee, J.; Adelmant, G.; Stafford, J.; Kahn, C.R.; Granner, D.K. Control of Hepatic Gluconeogenesis Through the Transcriptional Coactivator PGC-1. Nature 2001, 413, 131–138. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Liu, Y.; Liu, S.; Gao, M.; Wang, W.; Chen, K.; Huang, L.; Liu, Y. Diabetic Vascular Diseases: Molecular Mechanisms and Therapeutic Strategies. Signal Transduct. Target. Ther. 2023, 8, 152. [Google Scholar] [CrossRef] [Scilit]
- Yamagishi, S.; Nakamura, K.; Matsui, T.; Yoshida, Y.; Takenaka, K.; Jinnouchi, Y.; Imaizumi, T. Signal Transduction Therapy of Diabetic Vascular Complication. Curr. Signal Transduct. Ther. 2007, 2, 91–100. [Google Scholar] [CrossRef] [Scilit]
- Shenouda, S.M.; Widlansky, M.E.; Chen, K.; Xu, G.; Holbrook, M.; Tabit, C.E.; Hamburg, N.M.; Frame, A.A.; Caiano, T.L.; Kluge, M.A.; et al. Altered Mitochondrial Dynamics Contributes to Endothelial Dysfunction in Diabetes Mellitus. Circulation 2011, 124, 444–453. [Google Scholar] [CrossRef] [Scilit]
- Eisner, V.; Picard, M.; Hajnóczky, G. Mitochondrial Dynamics in Adaptive and Maladaptive Cellular Stress Responses. Nat. Cell Biol. 2018, 20, 755–765. [Google Scholar] [CrossRef] [Scilit]
- Scorrano, L. Keeping Mitochondria in Shape: A Matter of Life and Death. Eur. J. Clin. Investig. 2013, 43, 886–893. [Google Scholar] [CrossRef] [Scilit]
- Zorova, L.D.; Popkov, V.A.; Plotnikov, E.Y.; Silachev, D.N.; Pevzner, I.B.; Jankauskas, S.S.; Babenko, V.A.; Zorov, S.D.; Balakireva, A.V.; Juhaszova, M.; et al. Mitochondrial Membrane Potential. Anal. Biochem. 2018, 552, 50–59. [Google Scholar] [CrossRef] [Scilit]
- Glancy, B.; Kim, Y.; Katti, P.; Willingham, T.B. The Functional Impact of Mitochondrial Structure Across Subcellular Scales. Front. Physiol. 2020, 11, 541040. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kurihara, Y.; Kanki, T.; Aoki, Y.; Hirota, Y.; Saigusa, T.; Uchiumi, T.; Kang, D. Mitophagy Plays an Essential Role in Reducing Mitochondrial Production of Reactive Oxygen Species and Mutation of Mitochondrial DNA by Maintaining Mitochondrial Quantity and Quality in Yeast. J. Biol. Chem. 2012, 287, 3265–3272. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Boncler, M.; Lukasiak, M.; Dastych, J.; Golanski, J.; Watala, C. Differentiated Mitochondrial Function in Mouse 3T3 Fibroblasts and Human Epithelial or Endothelial Cells in Response to Chemical Exposure. Basic Clin. Pharmacol. Toxicol. 2019, 124, 199–210. [Google Scholar] [CrossRef] [Scilit]
- Makino, A.; Scott, B.T.; Dillmann, W.H. Mitochondrial fragmentation and superoxide anion production in coronary endothelial cells from a mouse model of type 1 diabetes. Diabetologia 2010, 53, 1783–1794. [Google Scholar] [CrossRef] [Scilit]
- Park, J.; Lee, J.; Choi, C. Mitochondrial Network Determines Intracellular ROS Dynamics And Sensitivity to Oxidative Stress Through Switching Inter-Mitochondrial Messengers. PLoS ONE. 2011, 6, e23211. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Suski, J.M.; Lebiedzinska, M.; Bonora, M.; Pinton, P.; Duszynski, J.; Wieckowski, M.R. Relation Between Mitochondrial Membrane Potential and ROS Formation. Methods Mol. Biol. 2012, 810, 183–205. [Google Scholar] [CrossRef] [Scilit]
- Starinets, V.S.; Serov, D.A.; Penkov, N.V.; Belosludtseva, N.V.; Dubinin, M.V.; Belosludtsev, K.N. Alisporivir Normalizes Mitochondrial Function of Primary Mouse Lung Endothelial Cells Under Conditions of Hyperglycemia. Biochemistry 2022, 87, 605–616. [Google Scholar] [CrossRef] [Scilit]
- Sobczak, M.; Dargatz, J.; Chrzanowska-Wodnicka, M. Isolation and Culture of Pulmonary Endothelial Cells from Neonatal Mice. J. Vis. Exp. 2016, 46, e2316. [Google Scholar] [CrossRef] [Scilit]
- Wiemerslage, L.; Lee, D. Quantification of Mitochondrial Morphology in Neurites of Dopaminergic Neurons Using Multiple Parameters. J. Neurosci. Methods 2016, 262, 56–65. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schmittgen, T.D.; Livak, K.J. Analyzing Real-Time PCR Data by the Comparative C(T) Method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [Scilit] [PubMed]




| Parameters of Mitochondrial Morphology | Endotheliocytes | Fibroblasts | ||
|---|---|---|---|---|
| NG | HG | NG | HG | |
| Number, pcs | 359 ± 69 | 631 ± 122 * | 792 ± 166 | 586 ± 141 * |
| Mean Perimeter, µm | 3.7 ± 0.2 | 3.3 ± 0.2 ** | 5.46 ± 0.81 | 6.24 ± 0.86 * |
| Interconnectivity, a. u. | 0.17 ± 0.01 | 0.15 ± 0.01 * | 0.21 ± 0.01 | 0.21 ± 0.01 |
| Elongation, a. u. | 1.73 ± 0.02 | 1.74 ± 0.01 | 1.80 ± 0.10 | 1.95 ± 0.13 * |
| Gene | Forward (5′→3′) | Reverse (5′→3′) |
|---|---|---|
| Gene-specific primers—Human | ||
| Pink1 | AGCCACCATGCCTACATTGC | TGGAGGAACCTGCCGAGATG |
| Prkn | ACAGCAGGAAGGACTCACCA | TGCTGCACTGTACCCTGAGT |
| Drp1 | CTTCGGAGCTATGCGGTGGT | GCAGGACGAGGACCAGTAGC |
| Mfn2 | AAGTGGAGAGGCAGGTGTCG | TCCTCTATGTGGCGGTGCAG |
| Ppargc1a | GCCTTCCAACTCCCTCATGG | CTCCGGAAGAAACCCTTGCAT |
| Rplp2 | GACGACCGGCTCAACAAGGT | CCAATACCCTGGGCAATGACG |
| Gene-specific primers—Mouse | ||
| Pink1 | TTGCCCCACACCCTAACATC | GCAGGGTACAGGGGTAGTTCT |
| Prkn | AGCCAGAGGTCCAGCAGTTA | GAGGGTTGCTTGTTTGCAGG |
| Drp1 | TTACAGCACACAGGAATTGT | TTGTCACGGGCAACCTTTTA |
| Mfn2 | CACGCTGATGCAGACGGAGAA | ATCCCAGCGGTTGTTCAGG |
| Ppargc1a | CTGCCATTGTTAAGACCGAG | GTGTGAGGAGGGTCATCGTT |
| Rplp2 | CGGCTCAACAAGGTCATCAGTGA | AGCAGAAACAGCCACAGCCCCAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Belosludtseva, N.V.; Serov, D.A.; Starinets, V.S.; Penkov, N.V.; Belosludtsev, K.N. Alterations in Mitochondrial Morphology and Quality Control in Primary Mouse Lung Microvascular Endothelial Cells and Human Dermal Fibroblasts under Hyperglycemic Conditions. Int. J. Mol. Sci. 2023, 24, 12485. https://doi.org/10.3390/ijms241512485
Belosludtseva NV, Serov DA, Starinets VS, Penkov NV, Belosludtsev KN. Alterations in Mitochondrial Morphology and Quality Control in Primary Mouse Lung Microvascular Endothelial Cells and Human Dermal Fibroblasts under Hyperglycemic Conditions. International Journal of Molecular Sciences. 2023; 24(15):12485. https://doi.org/10.3390/ijms241512485
Chicago/Turabian StyleBelosludtseva, Natalia V., Dmitriy A. Serov, Vlada S. Starinets, Nikita V. Penkov, and Konstantin N. Belosludtsev. 2023. "Alterations in Mitochondrial Morphology and Quality Control in Primary Mouse Lung Microvascular Endothelial Cells and Human Dermal Fibroblasts under Hyperglycemic Conditions" International Journal of Molecular Sciences 24, no. 15: 12485. https://doi.org/10.3390/ijms241512485
APA StyleBelosludtseva, N. V., Serov, D. A., Starinets, V. S., Penkov, N. V., & Belosludtsev, K. N. (2023). Alterations in Mitochondrial Morphology and Quality Control in Primary Mouse Lung Microvascular Endothelial Cells and Human Dermal Fibroblasts under Hyperglycemic Conditions. International Journal of Molecular Sciences, 24(15), 12485. https://doi.org/10.3390/ijms241512485

