Next Article in Journal
Sortilin Is Upregulated in Osteoarthritis-Dependent Cartilage Calcification and Associated with Cellular Senescence
Previous Article in Journal
Short Culture of Bovine Hepatocytes Biopsied from Dairy Cows as a Model for Toxicological Studies—CYP 1A1 Activity Response to Zearalenone Treatment
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 24
Issue 15
10.3390/ijms241512345
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Roles of Hormone Signals Involved in Rhizosphere Pressure Response Induce Corm Expansion in Sagittaria trifolia

by
Enjiao Li
1,
Jing Tang
1,
Jiexia Liu
1,
Zhiping Zhang
1,
Bing Hua
1,
Jiezeng Jiang
1 and
Minmin Miao
1,2,3,*
1
College of Horticulture and Landscape Architecture, Yangzhou University, Yangzhou 225009, China
2
Joint International Research Laboratory of Agriculture and Agri-Product Safety, Ministry of Education of China, Yangzhou University, Yangzhou 225009, China
3
Key Laboratory of Plant Functional Genomics, the Ministry of Education, Yangzhou University, Yangzhou 225009, China
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2023, 24(15), 12345; https://doi.org/10.3390/ijms241512345
Submission received: 7 June 2023 / Revised: 28 July 2023 / Accepted: 30 July 2023 / Published: 2 August 2023
(This article belongs to the Section Molecular Plant Sciences)
Browse Figures
Versions Notes

Abstract

:
Soil is the base for conventional plant growth. The rhizosphere pressure generated from soil compaction shows a dual effect on plant growth in agricultural production. Compacted soil leads to root growth stagnation and causes bending or thickening, thus affecting the growth of aboveground parts of plants. In arrowhead (Sagittaria trifolia L.), the corms derived from the expanded tips of underground stolons are its storage organ. We found that the formation of corms was significantly delayed under hydroponic conditions without rhizosphere pressure originating from soil/sand. In the initial stage of corm expansion, the anatomic structure of arrowhead corm-forming parts harvested from hydroponics and sand culture was observed, and we found that the corm expansion was derived from cell enlargement and starch accumulation. Comparative transcriptome analysis indicated that the corm expansion was closely related to the change in endogenous hormone levels. Endogenous abscisic acid and salicylic acid concentrations were significantly increased in sand-cultured corms. Higher ethylene and jasmonic acid contents were also detected in all arrowhead samples, demonstrating that these hormones may play potential roles in the rhizosphere pressure response and corm expansion. The expression of genes participating in hormone signaling could explain the rising accumulation of certain hormones. Our current results draw an extensive model to reveal the potential regulation mechanism of arrowhead corm expansion promoted by rhizosphere pressure, which will provide important references for further studying the molecular mechanism of rhizosphere pressure modulating the development of underground storage organs in other plants.

1. Introduction

In agricultural production, soil compaction or mechanical impedance has always been a negative factor for crop growth [1,2]. Early research reported that the growth of plants was weakened [3], the roots became thinner and shallower [4], lateral roots were proliferated [5], the radial growth diameter of roots was increased [6,7], and the shoot growth was inhibited [8] in compacted soil. When plant roots penetrate the soil and extend in all directions, they are subjected to axial mechanical resistance and radial friction. The resistances applied to root growth are summarized as rhizosphere pressure herein. The magnitude of rhizosphere pressure is closely related to the soil’s physical condition, compaction density, and root position [9]. Rhizosphere pressure that roots recognize from different directions has different effects on the root system. According to the research by Feng et al. [10], the positive impedance of soil caused a decreased root length, while lateral pressure promoted the radial enlargement of cortical cells, thus yielding an increased root diameter. Montagu et al. [8] described that the growth of aboveground parts is affected by rhizosphere pressure, whereby the total root length is inhibited. Considerable studies have shown that rhizosphere pressure has a regulatory role in the growth of plant roots and aboveground parts. However, it is still unclear whether rhizosphere pressure has an impact on the development of underground storage organs.
Plant hormones are important regulatory factors in the process of plant growth and development. Several studies have reported that the effects of rhizosphere pressure on underground growth are closely associated with changes in endogenous hormones in plants. Whalen and Feldman [11] found that the phenotypic changes in roots induced by rhizosphere pressure were similar to those induced by exogenous ethylene (ETH). Plant roots produce ETH after sensing rhizosphere pressure, thus promoting the root system to penetrate into the soil [12,13,14]. Additionally, other hormone signals are also involved in mediating the root response to rhizosphere pressure, leading to various phenotypic changes in roots. Tracy et al. [15] put forward the view that the changes in root structure in compacted soil are related to alterations in endogenous abscisic acid (ABA) contents. Moreover, the active bending in the process of root obstacle avoidance needs the polar transport of auxin to occur [16]. Jasmonic acid (JA) and salicylic acid (SA) contents are also changed when roots are subjected to mechanical impedance [17]. Gibberellin (GA) negatively regulates the radial growth of roots by modulating the development of the apical meristem [18]. Multiple hormone signals also show complex crosstalk in affecting root growth. Huang et al. [19] found that ETH accumulation in the rice rhizosphere could promote ABA and auxin synthesis to achieve radial growth. Furthermore, ETH could mediate lateral root development by enhancing auxin signaling [5] and controlling the deferred elongation of elongation-zone cells [20]. ABA can inhibit root growth by delaying cell elongation and interacting with related signals, such as cytokinins (CKs), auxin, ETH, active oxygen (ROS), Ca2+, and so on [21,22,23]. These findings highlight the roles of plant hormones in root growth regulation. The relationship between the response to rhizosphere pressure in plant roots and specific hormones’ regulation needs to be further explored.
Arrowhead (Sagittaria trifolia L.) is a flowering wetland perennial herb of the Alismataceae family and also is an aquatic vegetable. The tips of the underground stolons of arrowhead grown in paddy fields can expand to form corms, the edible organs (underground storage organs) of arrowheads. Arrowhead corms contain abundant nutrients, such as protein, amino acids, and so on, as well as being rich in vitamins, therefore presenting high market value and being well loved by consumers [24]. At present, some problems have existed in arrowhead production that have profoundly affected the sustainable development of arrowheads. Corm harvesting is relatively difficult and cannot be mechanized since arrowheads are grown in paddy fields, and the labor force is still scarce. Low-efficient fertilizer utilization has also led to the abuse of resources and limited the scale of production. This is not uncommon in aquatic vegetable crop production [25]. Hydroponics is an effective way to address these matters as well as produce high-quality and residue-free vegetables [26]. No attempt has been made to cultivate arrowheads using hydroponics until now. Hence, we proposed a strategy to produce arrowheads via nutrient solution in order to promote the green and sustainable development of arrowheads.
In this study, we found that the corms of arrowheads did not expand over time under hydroponic conditions compared with those in sand-cultured conditions. It is speculated that this phenomenon may be caused by the decreased rhizosphere pressure in hydroponic conditions. In order to explore the potential mechanism of rhizosphere-pressure-induced corm expansion in arrowheads, a comparative analysis between sand-cultured and hydroponic treatments of arrowheads was performed, including transcriptome analysis, endogenous hormone determination, and related gene expression detection. This report provides new insight for exploring the effect of rhizosphere pressure on the formation and expansion of arrowhead corms and also lays a genetic foundation for directing arrowhead hydroponics. It gives the reference significance for subsequent research on rhizosphere pressure and the enlargement of underground storage organs.

2. Results

2.1. Plant Growth Analysis

Comparing the underground growth of arrowheads between the sand culture and hydroponics, we found that the corms expansion of arrowheads in hydroponics was significantly delayed than that in sand culture. The arrowhead corms cultured in sand began to expand 45 d after planting (Figure 1a). It could be seen that there was no significant difference in the average plant height of arrowheads between the two treatments (Figure 1b). The lengths of arrowhead roots and stolons in sand culture conditions were significantly shorter compared with those in hydroponics, indicating that rhizosphere pressure restricted the elongation of underground roots and stolons (Figure 1c,d). Stolons began to emerge approximately 25 d after planting and reached the initial stage of corms expansion 45 d after planting. The stolon apical parts of sand-cultured arrowheads began to expand into corms, whereas corm expansion in stolon apical parts from hydroponics arrowheads was almost undetectable (Figure 1f).

2.2. Anatomical Analysis

In order to further visualize the histological characterization of corm expansion, paraffin-embedded tissue sectioning was conducted. The cross-sections of the corm formation parts in the initial expansion stage under the two conditions are shown in Figure 2. During the corm formation under sand culture conditions, parenchyma cells were significantly expanded in size, whereas the cell size in the unexpanded stolon tips in hydroponic conditions was small. Compared with those under hydroponic treatment, the corm cells in sand culture were larger based on the statistical cell length and width data (Table S4). In expanded corms from sand culture conditions, more starch granules were observed, but not in hydroponic arrowheads. The above results indicate that the formation of arrowhead corms in sand culture conditions derived from the increased cell size as well as being accompanied by starch accumulation.

2.3. DEGs Identification and Functional Annotation

The transcriptome data on samples from the sand culture and hydroponics groups were employed for comparative analysis, and FDR < 0.01 and FC ≥ 2 were used as the screening criteria, yielding a total of 1857 DEGs. A total of 864 and 993 genes were upregulated and downregulated, respectively (Figure 3a). DEGs were clustered, annotated, and enriched. All the functional annotations of DEGs are shown in Figure 3b–d. A total of 1305 DEGs were annotated through GO enrichment and divided into three categories: biological processes, cellular components, and molecular functions (Figure 3b). For cellular components, approximately 42.38% of DEGs were clustered in the cell and cell parts, which account for the highest proportion, followed by 34.87% of DEGs in membranes, organelles, and macromolecular complexes. In terms of molecular function, the highest proportion of DEGs was annotated as binding, followed by catalytic activity, transporter activity, structural molecule activity, and nucleic-acid-binding transcription factor activity, suggesting the DEGs may have widely participated in the synthesis and transport of intracellular substances. For biological processes, metabolic processes enriching 49.04% of DEGs showed the highest proportion, followed by cellular processes and single-organism processes, implying that the DEGs between samples from hydroponics and sand culture were involved in cell metabolism, growth, and signaling.
Based on the COG functional classification of DEGs, a total of 602 DEGs were annotated into 25 functional categories (Figure 3c). Among the DEGs associated with post-translation modification, protein update and chaperones accounted for the highest proportion of 12.29%, followed by carbohydrate transport and metabolism (11.46%), translation, ribosomal structure, and biogenesis (10.47%), and signal transduction mechanisms (10.30%). In addition to basic molecular functions and essential life activities, carbohydrate transport and metabolism may play an important role in the formation of arrowhead corms. The function of proteins related to the signal transduction mechanism in corms is also worthy of attention.
An assay of KEGG pathway enrichment was performed. A total of 587 DEGs were annotated into fifty KEGG metabolic pathways with five categories: cellular process, environmental information processing, genetic information processing, metabolism, and organic systems. The top 20 pathways estimated by KEGG enrichment degree are listed in Figure 3d. Notably, numerous DEGs are annotated as plant hormone signal transduction pathways, suggesting that hormone signaling was critical for corms expansion. A range of genes involved in starch and sucrose metabolism were also identified, indicating that the corm formation was accompanied by starch accumulation, which is consistent with our observed anatomical results.

2.4. Hormone Level Determination

Based on the results of the transcriptome analysis, our follow-up research mainly focused on the role of hormone signaling in corm formation. The contents of seven endogenous hormones, ABA, auxins, CKs, GA, JAs, and the ethylene precursor ACC (l-aminocyclopropane-l-carboxylic acid), in expanded corms and unexpanded stolon tips from sand-cultured and hydroponic arrowheads at 45 d after planting were detected (Figure 4). The content of ABA in sand-cultured arrowhead corms was remarkably higher than that in hydroponics samples. The contents of two types of auxins, ICA and Me-IAA, were higher in hydroponics samples than those in sand culture samples. Accumulations of GA3 and GA7 differed between sand culture and hydroponics samples. The ACC content in both treatment groups was high, and no significant difference was found. The levels of JA were similar in the two treatments and were high overall. More OPDA (12-oxophytodienoic acid), the precursor for JA synthesis, was determined in the samples from hydroponic treatments. High-level salicylic acid (SA) accumulation was detected in sand-cultured corms and not in hydroponic samples. Taken together, the corms expansion induced by rhizosphere pressure seems to be linked to the increased accumulations of ABA and SA. Furthermore, JA may also participate in the process of corm expansion. The high ACC content suggested a considerable amount of ETH existed in the arrowhead rhizosphere.

2.5. Expression Profiles of Hormone-Related Genes in RNA-Seq

In order to further explore the molecular regulatory mechanisms of differences in hormone contents, the expression profiles of genes related to the metabolism of seven hormones (ABA, auxins, GA, ETH, CKs, SA, and JA) were analyzed based on RNA-Seq data (Figure 5). The genes involved in multiple hormones metabolism showed significant or non-significant transcription differences. For ABA metabolism, most genes related to ABA synthesis were highly expressed in hydroponics, and the expression of the StPYL (encoding ABA receptor protein synthesis) and StPP2C (encoding 2C type protein phosphatases) families were also upregulated in hydroponics. The StSRK2 family, the homologous genes of SnRK/SRK (serine/threonine-protein kinase), was also highly expressed in hydroponics. In auxins metabolism, several auxin-synthesis-related genes showed high transcription levels, such as StTSA1 and StYUCCA. The genes encoding StIAA (auxin-responsive protein IAA), StARF (auxin response factor), and many homologous genes were highly expressed in the two treatments. StGA3ox1 catalyzing active GA synthesis was significantly upregulated in sand-cultured corms. In addition, the genes encoding StGIDs and StDELLAs were involved in GA synthesis regulation and showed relatively stable expression in the corm samples. StACS regulating ETH biosynthesis exhibited high transcription levels in both arrowhead samples, whereas the expression levels of genes involved in ETH signal transduction in hydroponic samples were upregulated compared with sand-cultured corms. Genes involved in SA signaling were upregulated in hydroponics, such as the genes encoding the StNPR1 receptor family and the StWRKY transcription factor. StMYC2 family genes, the main regulators of the JA signal transduction pathway, most of all exhibited high expression in hydroponics, and the expression levels of genes (StAOS and StOPRs) related to JA biosynthesis in hydroponics were higher than those in sand culture.

2.6. Verification of Differentially Expressed Genes in Hormone Signaling

To further verify the RNA-Seq results, the relative expression of genes participating in ABA, JA, ETH, and SA metabolism was quantified via RT-qPCR assay. Some genes in the PYL-PP2C-SnRK2 pathway, closely associated with the ABA signaling pathway, were identified from transcriptome data. The RT-qPCR results show that the expression levels of these genes in hydroponics were higher than those in sand culture, which is consistent with the results analyzed using RNA-Seq (Figure 6a). The expression levels of genes encoding allene oxide synthase (AOS) and MYC2 transcription factor in the JA synthesis pathway were verified. The results show that the expression of StMYC2 genes almost matched the expression profiles analyzed with transcriptome, and the expressions of two StAOS genes were downregulated in the samples from hydroponics (Figure 6b). The expression levels of four ethylene insensitive 3 (EIN3) family genes were upregulated in hydroponics (Figure 6c) and shared a similar profile to the RNA-Seq data and ACC content. We also detected the expressions of the StNPR1 and StTGA transcription factor genes encoding the SA receptor protein (Figure 6d). StNPR1 was upregulated in hydroponics samples, while StTGAs were upregulated or downregulated, which may be related to the differential expression of TGA family proteins. The expression changes in hormone-related genes contributed to the differential accumulation of endogenous hormones in arrowhead corms.

3. Discussion

When the rhizosphere pressure from the soil increases, most plants avoid injury by reducing root elongation, increasing the root cross-sectional area, or bending so as to enhance their adaptability to soil resistance [1]. Numerous studies have reported the negative effects of rhizosphere pressure on underground root growth [3,9]. Positive effects of rhizosphere pressure such as increased biomass have also been reported [4,27]. The role of rhizosphere pressure in the development of underground storage organs has not received much attention at present. Crops with underground roots or stems as storage organs, such as potatoes and sweet potatoes, also need the induction of resistance in the soil to achieve a high yield during production [28,29,30]. The rhizosphere pressure exerted on the underground part of plants in sand culture (~1.78 g/cm3) was higher than that in hydroponics (~1.00 g/cm3). Therefore, we speculated that rhizosphere pressure promoted the expansion of underground storage organs in crops. In this study, the effect of rhizosphere pressure on the arrowhead corms expansion in hydroponics and sand culture (simulated soil cultivation) was observed. It was found that the corm formation was significantly delayed under hydroponics conditions compared with sand culture. At 45 d after planting, the cells in the corm formation parts were expanded and accompanied by starch accumulation, which is consistent with the anatomic structural changes related to storage organ expansion described in previous studies [31]. In contrast, the cells in the corm expansion parts of hydroponic arrowheads were small and closely arranged, resulting in no expanded corm being generated. Based on these results, we concluded that rhizosphere pressure was the key factor that induced corms expansion in arrowheads.
What responds to rhizosphere pressure and regulates corms expansion in arrowheads? To preliminary explain this point, we carried out transcriptome sequencing using the expanded corms and unexpanded stolon tips from sand culture and hydroponics. A number of DEGs were identified and annotated through the GO, COG, and KEGG databases. In COG classification, the majority of DEGs were annotated into two categories: carbohydrate transport and metabolism and signal transduction mechanism. The KEGG analysis showed that the DEGs involved in plant hormone signal transduction accounted for the highest proportion, indicating that plant hormones may be vital regulators in modulating arrowhead corm expansion induced by rhizosphere pressure. It is well known that hormones are important chemical messengers in plants that regulate plant growth and development and participate in external environmental responses and transmit certain signals [32,33]. We speculated that rhizosphere pressure regulates the morphological changes in the stolon tip by altering plant hormone accumulation and signal transduction [34,35], thus leading to the formation of corms in sand-cultured arrowheads.
It has been reported that the regulation by rhizosphere pressure of plant root growth involves a variety of hormones, including ETH, auxins, and ABA [14,36]. Under high rhizosphere pressure (soil compaction), a large amount of non-diffusible ETH accumulation activates ABA and auxin signals, leading to changes in root morphology [36,37]. The presence of a water layer also inhibits the diffusion of the gas hormone, ETH, in both hydroponic and sand-cultured arrowheads, resulting in a high accumulation of the ETH precursor ACC [38,39]. ABA is a plant hormone that plays an important role in resisting abiotic stresses [40], and its role in inducing the radial thickening of roots has also been reported [19]. In our work, the ABA content in the arrowhead corms under sand culture conditions was significantly increased, implying that ABA may respond to rhizosphere pressure to promote corms expansion. The auxin content also varied in the arrowhead samples of the two treatment groups and may be regulated by ETH and ABA [41]. In addition, several types of JAs showed differential accumulation in the arrowhead samples from the two treatment groups. When plants were stressed, JA increased and interacted with other hormones, and inhibiting root elongation was also a typical trait [42]. Therefore, we speculated that JA may be involved in the rhizosphere pressure response in the underground parts, which provides new evidence of JA signals mediating rhizosphere pressure to change rhizosphere characteristics. SA has been reported to be associated with plants’ sense of stress [43,44], which could be detected only in expanded corms from sand culture, implying its potential function in facilitating arrowhead corms or interacting with other hormones. Meanwhile, the specific relationship between JA/SA and rhizosphere pressure is still unclear.
In plants, the accumulation of hormones is usually linked to the expression of genes in biosynthesis, degradation, and signal transduction pathways [32]. To further explore the regulation mechanisms of hormones, we retrieved the hormone-metabolism-related genes and verified the expression levels. ABA was highly accumulated in the expanded arrowhead corms from sand culture, and the expression of genes involved in ABA signal transduction was more active in hydroponics, and we speculated that the gene’s expression may be influenced by the feedback regulation of ABA content, and the increased ABA level inhibits the transcription activities of PP2C and SRK2 [15,45]. In hydroponic arrowheads, two highly expressed AOS genes might contribute to the increases in JA and OPDA contents [46,47]. EIN3 exerted a decisive role in the ETH signaling pathway, and it could mediate the interaction between JA and ETH [48]. The genes encoding EIN3 proteins showed high expression in hydroponic arrowhead samples, indicating that ETH signaling was activated in hydroponics conditions. The PAL genes, c85018.graph_c0 and c84792.graph_c2, in the upstream of SA biosynthesis were upregulated in hydroponics, which was contrary to the results of SA accumulation. A possible reason is that the synthesis of SA underwent multiple catalytic steps, and the intermediate products (such as trans-cinnamic acid and shikimic acid) produced during this process were also involved in the synthesis of other secondary metabolites; thus, the expression of upstream genes did not show a direct impact on the accumulation of SA [49,50]. Another interpretation could be that the hormones’ biosynthesis also depended on the post-transcriptional control of genes and the regulation of protein levels [51].
Previous studies have not mentioned the relationship between the corm expansion in underground stolon tips and rhizosphere pressure in arrowheads [52,53]. Herein, we present a model diagram to explain the potential mechanism (Figure 7). The effects of the rhizosphere pressure provided by the sand on the growth of arrowheads are briefly summarized. The mechanism of corms expansion was preliminarily demonstrated via anatomical structure observation and hormone signaling analysis.

4. Materials and Methods

4.1. Plant Materials and Cultivation Conditions

In this experiment, 20 cm high seedlings of S. trifolia. cv. ‘Baimati’ (BMT) were planted in 38 × 25 cm nonporous plastic pots. The plants were divided into two groups to perform the hydroponics and sand-cultured treatments. For the sand-cultured treatment, coarse river sand was used to simulate soil pressure, and a self-developed nutrient solution was added to rise 4 cm above the surface of the sand (Table S1). The same nutrient solution was applied for the hydroponic treatment, and the plants were fixed with a black foam plate with a hole in the center to avoid underground light. Herein, we define the gravity density (weight per unit volume of cultivated medium) to describe the rhizosphere pressure in the two treatments. The gravity density was approximately 1.00 g/cm3 and 1.78 g/cm3 in the hydroponics and sand cultures, respectively. The nutrient solution was supplemented every five days. The growing season was from April to July, and the average temperatures were 27 °C/day and 18 °C/night.
In this study, the growth of arrowheads after planting was divided into three stages: the vegetative growth stage, the stolon development stage (which began 25 d after planting), and the corm expansion stage (which began at 45 d after planting). At 25 d and 45 d, the plant height (an indicator of the above-ground part), root length, and stolon diameters (indicators of the underground growth) were measured using graduated scales and a vernier caliper. At least 10 plants were measured for each indicator. The formation and expansion of corms in the two treatment conditions were observed and recorded. The samples were harvested at the initial stage of corms expansion in the sand culture (45 d after planting) and then stored at −80 °C for subsequent experiments. At least three biological replicates were set for each treatment.

4.2. Observation of Anatomical Structure of Corms

Expanded arrowhead corms in the sand culture and unexpanded stolon apical parts in the hydroponics culture were sampled for paraffin cross-sections to observe the differences in anatomical structure. Firstly, the collected samples were fixed with FAA stationary liquid (5 mL of formalin, 5 mL of glacial acetic acid, and 90 mL of 70% alcohol). Then, the corm tissues were dehydrated and embedded in paraffin. Treated tissues were sliced with HistoCore BIOCUT (Leica, Wetzlar, Germany) and stained with plant saffron fast green dye prepared by FreeThinking (Nanjing FreeThinking Biotechnology Co., Ltd., Nanjing, China). The obtained tissue sections were observed using an Olympus CX23 microscope (Olympus, Tokyo, Japan) and scanned using XZ Sunny HS6 (Sunny Optical Technology (Group) Co., Ltd., Ningbo, China).

4.3. RNA Extraction and Detection

According to the operating instructions, total RNA was extracted from corm samples with the RNAprep Pure Plant Kit (Proteinssci, Shanghai, China). The concentration of extracted RNA was detected using Nanodrop2000 (Thermo Scientific, Wilmington, DE, USA), and the integrity of the RNA was tested using Agient2100 and LabChip GX (PerkinElmer, Waltham, MA, USA). For the evaluation of RNA quality, RNA samples were separated via 1.0% agarose gel electrophoresis, showing that the quality of the RNA was good enough for further analysis (Figure S1).

4.4. Transcriptome Sequencing, Assembly, and Functional Annotation

The VAHTS Universal V6 RNA-seq Library Prep Kit for Illumina® was used for the synthesis of cDNA and construction of the final cDNA library. The sequencing of library products was performed with the Illumina NovaSeq high-throughput sequencing platform (Illumina, San Diego, CA, USA). The generated data were assembled using Trinity (v2.5.1) [54] software. A total of 44.65 Gb of clean data was obtained from six arrowhead samples. The generated data per sample reached 6.60 Gb. The percentage of Q30 bases was more than 94.78%. In total, 50,031 unigenes were obtained after assembly, among which 15,728 unigenes exceeded 1 kb in length (Table S2). The N50 number of unigenes was 1723 with an average length of 2287 bp (Table S3). Unigene sequences with a length greater than 500 bp accounted for 54.32% (Figure S2). Taken together, the assembly was high-quality, and the results could be used for further analysis. DIAMOND (v2.0.4) [55] software was used to blast the unigene sequences with the NR, Swiss-Prot, GO, COG, KOG, eggNOG, and KEGG databases and then, the annotation information on the unigenes was obtained (Table 1).
Bowtie [56] was used to compare the sequenced reads with the unigene library. According to the comparison results, the expression abundance of identified unigenes was estimated with RSEM [57] and expressed as FPKM (fragments per kilobase million) values. Differential expression analysis was conducted with the following screening criteria: FDR (false discovery rate) of <0.01 and FC (fold change) of ≥2.

4.5. Endogenous Hormones Determination

The samples, including expanded corms and unexpanded stolons apical parts, were harvested from the sand culture and hydroponics at the initial stage of corms expansion. Each sample after grinding was added into a 2 mL brown centrifuge tube containing 1 mL of methanol and a mixed internal standard stock solution. The mixture was subjected to ultrasonic extraction for 10 min and then transferred to a metal bath for 4 h. After centrifugation for 10 min under 12,000 rpm/4 °C conditions, the supernatant was collected. The remaining residue was resuspended using 0.5 mL of methanol and continued undergoing oscillating extraction for 2 h in a metal bath. The supernatants obtained from two extractions were mixed, centrifuged, and then filtered through a 0.22 μm filter membrane. The filtered samples were loaded into a high-performance liquid chromatography–electrospray ionization mass spectrometry (LC-MS) system [58] to estimate the levels of seven kinds of endogenous hormones (ABA, auxins, CKs, GA, ETH, JAs, and SA).

4.6. Identification and Analysis of Genes Involved in Various Hormones’ Metabolism Based on RNA-Seq Data

Genes involved in the biosynthesis, degradation, and signal transduction of plant hormones (auxins, CKs, GA, ABA, ETH, SA, and JA) were retrieved from the transcriptome database via sequence homology blast. The heatmap of gene expression levels was drawn using TBtools (v1.120) software, in which the expression per gene was quantified using log2 (FPKM + 1).

4.7. Gene Expression Analysis Using RT-qPCR

In order to further verify the expression results analyzed with the RNA-seq data, the expression levels of 20 target genes in the samples from the sand culture and hydroponics were detected using real-time quantitative PCR (RT-qPCR) with a CFX96 system (Bio-Rad, Hercules, CA, USA). SLEEPER was used as the internal reference gene, and the specific primers for RT-qPCR detection were designed using Primer 6.0 and are listed in Table 2. The specificities of the primers were determined with melting curves (Figure S3). The reaction volume was 10 μL, which contained 4 μL of diluted cDNA, 1 μL of a forward or reverse primer, and 5 μL of the iTaq Universal SYBR Green Supermix Kit (Bio-Rad, Hercules, CA, USA). The reaction steps were as follows: pre-denaturation at 95 °C for 3 min, 95 °C for 10 s, and 60 °C for 5 s, and a total of 39 cyclic reactions. Three technical repetitions were set for each reaction. The relative expression value was calculated using the 2−ΔΔCt method [59].

4.8. Statistical Analysis

The means and standard deviation (SD) of the data were calculated using Excel 2019. The difference significance between treatments was analyzed using a t-test with GraphPad Prism 9 software.

5. Conclusions

The corms expansion of arrowheads is affected by complex regulatory factors involving the signal transduction of various hormones. In this study, we compared the expansion of arrowhead corms under hydroponics (with lower rhizosphere pressure) and sand-culture (with higher rhizosphere pressure) conditions, finding that rhizosphere pressure could induce the formation of arrowhead corms. The endogenous hormones, ABA, JA, ETH, and SA, may respond to rhizosphere pressure, thus regulating corms expansion in sand-cultured arrowheads. Through the observation of anatomical structure, we found that the expansion of corms was inseparable from starch accumulation. Our current works will provide a meaningful reference for further understanding the corm expansion mechanism and exploring the influence of rhizosphere pressure/mechanical impedance on the formation of plant underground storage organs.

Supplementary Materials

The supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms241512345/s1.

Author Contributions

M.M. and E.L., conceptualization. E.L., J.L. and J.T., investigation methodology and data curation. J.T. and E.L., formal analysis. Z.Z., B.H. and J.J., supervision and resources. E.L., writing—original draft. J.L., writing—review and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the Jiangsu Modern Agricultural (Vegetable) Industrial Technology System (JATS [2022]495).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All relevant data can be found within this article and its Supporting Materials.

Conflicts of Interest

The authors declare that they have no conflict of interest associated with this work.

References

  1. Shah, A.N.; Tanveer, M.; Shahzad, B.; Yang, G.; Fahad, S.; Ali, S.; Bukhari, M.A.; Tung, S.A.; Hafeez, A.; Souliyanonh, B. Soil compaction effects on soil health and crop productivity: An overview. Environ. Sci. Pollut. Res. Int. 2017, 24, 10056–10067. [Google Scholar] [CrossRef]
  2. Nawaz, M.F.; Bourrie, G.; Trolard, F. Soil compaction impact and modelling. A review. Agron. Sustain. Dev. 2013, 33, 291–309. [Google Scholar] [CrossRef] [Green Version]
  3. Alameda, D.; Anten, N.P.R.; Villar, R. Soil compaction effects on growth and root traits of tobacco depend on light, water regime and mechanical stress. Soil Tillage Res. 2012, 120, 121–129. [Google Scholar] [CrossRef]
  4. Glab, T. Effect of soil compaction on root system morphology and productivity of alfalfa (Medicago sativa L.). Environ. Sci. Pollut. Res. Int. 2011, 20, 1473–1480. [Google Scholar]
  5. Canher, B.; Lanssens, F.; Zhang, A.; Bisht, A.; Mazumdar, S.; Heyman, J.; Wolf, S.; Melnyk, C.W.; De Veylder, L. The regeneration factors ERF114 and ERF115 regulate auxin-mediated lateral root development in response to mechanical cues. Mol. Plant. 2022, 15, 1543–1557. [Google Scholar] [CrossRef]
  6. Atwell, B.J. Response of roots to mechanical impedance. Environ. Exp. Bot. 1993, 33, 27–40. [Google Scholar] [CrossRef]
  7. Iijima, M.; Kato, J. Combined soil physical stress of soil drying, anaerobiosis and mechanical impedance to seedling root growth of four crop species. Plant Prod. Sci. 2007, 10, 451–459. [Google Scholar] [CrossRef]
  8. Montagu, K.D.; Conroy, J.P.; Atwell, B.J. The position of localized soil compaction determines root and subsequent shoot growth responses. J. Exp. Bot. 2001, 52, 2127–2133. [Google Scholar] [CrossRef]
  9. Bengough, A.G.; McKenzie, B.M.; Hallett, P.D.; Valentine, T.A. Root elongation, water stress, and mechanical impedance: A review of limiting stresses and beneficial root tip traits. J. Exp. Bot. 2011, 62, 59–68. [Google Scholar] [CrossRef] [Green Version]
  10. Feng, X.; Xiong, J.; Hu, Y.; Pan, L.; Liao, Z.; Zhang, X.; Guo, W.; Wu, F.; Xu, J.; Hu, E.; et al. Lateral mechanical impedance rather than frontal promotes cortical expansion of roots. Int. J. Mol. Sci. 2020, 15, 1757918. [Google Scholar] [CrossRef]
  11. Whalen, M.C.; Feldman, L.J. Effects of mechanical impedance on root development. In Rhizosphere Dynamics; CRC Press: Boca Raton, FL, USA, 2019; pp. 260–267. [Google Scholar]
  12. Santisree, P.; Nongmaithem, S.; Sreelakshmi, Y.; Ivanchenko, M.G.; Sharma, R. The root as a drill an ethylene-auxin interaction facilitates root penetration in soil. Plant. Signal. Behav. 2012, 7, 151–156. [Google Scholar] [CrossRef]
  13. Shi, H.; Liu, R.; Xue, C.; Shen, X.; Wei, N.; Deng, X.W.; Zhong, S. Seedlings transduce the depth and mechanical pressure of covering soil using COP1 and ethylene to regulate EBF1/EBF2 for soil emergence. Curr. Biol. 2016, 26, 139–149. [Google Scholar] [CrossRef] [Green Version]
  14. Jacobsen, A.G.R.; Jervis, G.; Xu, J.; Topping, J.F.; Lindsey, K. Root growth responses to mechanical impedance are regulated by a network of ROS, ethylene and auxin signalling in Arabidopsis. New. Phytol. 2021, 231, 225–242. [Google Scholar] [CrossRef]
  15. Tracy, S.R.; Black, C.R.; Roberts, J.A.; Dodd, I.C.; Mooney, S.J. Using X-ray computed tomography to explore the role of abscisic acid in moderating the impact of soil compaction on root system architecture. Environ. Exp. Bot. 2015, 110, 11–18. [Google Scholar] [CrossRef]
  16. Lee, H.J.; Kim, H.S.; Park, J.M.; Cho, H.S.; Jeon, J.H. PIN-mediated polar auxin transport facilitates root-obstacle avoidance. New. Phytol. 2020, 225, 1285–1296. [Google Scholar] [CrossRef]
  17. Kumari, A.; Nongmaithem, S.; Devulapalli, S.; Sreelakshmi, Y.; Sharma, R. Tomato root senses horizontal/vertical mechanical impedance and correspondingly modulates root/shoot metabolome. Environ. Exp. Bot. 2021, 191, 104608. [Google Scholar] [CrossRef]
  18. Niu, S.; Li, W.; Chen, X. Negative regulation of gibberellin on root tip diameter. J. Beijing For. Univ. 2013, 35, 71–76. [Google Scholar]
  19. Huang, G.; Kilic, A.; Karady, M.; Zhang, J.; Mehra, P.; Song, X.; Sturrock, C.J.; Zhu, W.; Qin, H.; Hartman, S.; et al. Ethylene inhibits rice root elongation in compacted soil via ABA- and auxin-mediated mechanisms. Proc. Natl. Acad. Sci. USA 2022, 119, e2201072119. [Google Scholar] [CrossRef]
  20. Stepanova, A.N.; Alonso, J.M. Ethylene signaling and response: Where different regulatory modules meet. Curr. Opin. Plant Biol. 2009, 12, 548–555. [Google Scholar] [CrossRef]
  21. Promchuea, S.; Zhu, Y.; Chen, Z.; Zhang, J.; Gong, Z. ARF2 coordinates with PLETHORAs and PINs to orchestrate ABA-mediated root meristem activity in Arabidopsis. J. Integr. Plant Biol. 2017, 59, 30–43. [Google Scholar] [CrossRef]
  22. Sun, L.R.; Wang, Y.B.; He, S.B.; Hao, F.S. Mechanisms for abscisic acid inhibition of primary root growth. Plant Signal. Behav. 2018, 13, e1500069. [Google Scholar] [CrossRef] [Green Version]
  23. Takatsuka, H.; Umeda, M. ABA inhibits root cell elongation through repressing the cytokinin signaling. Plant Signal. Behav. 2019, 14, e1578632. [Google Scholar] [CrossRef] [Green Version]
  24. Singh, A.V.; Singh, P.K. An account of Sagittaria sagittifolia with special reference to phytochemical studies and its socio-economic relevance. J. Phytol. Res. 2009, 22, 235–246. [Google Scholar]
  25. Heffer, P.; Prud’homme, M. Outlook for world fertilizer demand, supply, and supply/demand balance. Turk. J. Agric. For. 2008, 32, 159–164. [Google Scholar]
  26. Khan, S.; Purohit, A.; Vadsaria, N. Hydroponics: Current and future state of the art in farming. J. Plant Nutr. 2020, 44, 1515–1538. [Google Scholar] [CrossRef]
  27. Alameda, D.; Villar, R. Linking root traits to plant physiology and growth in Fraxinus angustifolia Vahl. seedlings under soil compaction conditions. Environ. Exp. Bot. 2012, 79, 49–57. [Google Scholar] [CrossRef]
  28. Li, M.; Pu, Z.; Tan, W.; Zhang, C.; Yang, S.; Feng, J.; Yan, W. Chlorophyll fluorescence of key stages of storage roots formation in grafted overhead-sweetpotato cultivation system. Southwest China J. Agric. Sci. 2015, 28, 2475–2478. [Google Scholar]
  29. Nhut, D.T.; Nguyen, N.H.; Thuy, D.T.T. A novel in vitro hydroponic culture system for potato (Solanum tuberosum L.) microtuber production. Sci. Hortic. 2006, 110, 230–234. [Google Scholar] [CrossRef]
  30. Lim, H.T.; Yoon, C.S.; Choi, S.P.; Dhital, S.P. Application of gibberellic acid and paclobutrazol for efficient production of potato (Solanum tuberosum L.) minitubers and their dormancy breaking under soilless culture system. J. Jpn. Soc. Hortic. Sci. 2004, 45, 189–193. [Google Scholar]
  31. Masuda, J.I.; Ozaki, Y.; Okubo, H. Regulation in rhizome transition to storage organ in lotus (Nelumbo nucifera Gaertn.) with exogenous gibberellin, gibberellin biosynthesis inhibitors or abscisic acid. J. Jpn. Soc. Hortic. Sci. 2012, 81, 67–71. [Google Scholar] [CrossRef] [Green Version]
  32. Rui, Z.; Xiu-Juan, W.; Wei, G. Regulation mechanism of plant hormones on secondary metabolites. Zhongguo Zhong Yao Za Zhi 2020, 45, 4205–4210. [Google Scholar]
  33. Waadt, R.; Seller, C.A.; Hsu, P.-K.; Takahashi, Y.; Munemasa, S.; Schroeder, J.I. Plant hormone regulation of abiotic stress responses. Nat. Rev. Mol. Cell Biol. 2022, 23, 680–694. [Google Scholar] [CrossRef]
  34. Potocka, I.; Szymanowska-Pulka, J. Morphological responses of plant roots to mechanical stress. Ann. Bot. 2018, 122, 711–723. [Google Scholar] [CrossRef] [Green Version]
  35. De Smet, S.; Cuypers, A.; Vangronsveld, J.; Remans, T. Gene networks involved in hormonal control of root development in Arabidopsis thaliana: A framework for studying its disturbance by metal stress. Int. J. Mol. Sci. 2015, 16, 19195–19224. [Google Scholar] [CrossRef] [Green Version]
  36. Okamoto, T.; Takahashi, T. Ethylene signaling plays a pivotal role in mechanical-stress-induced root-growth cessation in Arabidopsis thaliana. Plant Signal. Behav. 2019, 14, 1669417. [Google Scholar] [CrossRef]
  37. Sarquis, J.I.; Morgan, P.W.; Jordan, W.R. Metabolism of 1-aminocyclopropane-1-carboxylic acid in etiolated maize seedlings grown under mechanical impedance. Plant Physiol. 1992, 98, 1342–1348. [Google Scholar] [CrossRef] [Green Version]
  38. Visser, E.J.W.; Pierik, R. Inhibition of root elongation by ethylene in wetland and non-wetland plant species and the impact of longitudinal ventilation. Plant Cell Environ. 2007, 30, 31–38. [Google Scholar] [CrossRef]
  39. Pandey, B.K.; Huang, G.; Bhosale, R.; Hartman, S.; Sturrock, C.J.; Jose, L.; Martin, O.C.; Karady, M.; Voesenek, L.A.C.J.; Ljung, K.; et al. Plant roots sense soil compaction through restricted ethylene diffusion. Science 2021, 371, 276–280. [Google Scholar] [CrossRef]
  40. Lees, J.; Kim, S.; Yoo, H.Y. Future prospects for industrial application of abscisic acid, a stress-resistant phytohormone. Korean J. Chem. Eng. 2020, 58, 514–523. [Google Scholar]
  41. Wu, Y.; Chang, Y.; Luo, L.; Tian, W.; Gong, Q.; Liu, X. Abscisic acid employs NRP-dependent PIN2 vacuolar degradation to suppress auxin-mediated primary root elongation in Arabidopsis. New Phytol. 2022, 233, 297–312. [Google Scholar] [CrossRef]
  42. Han, X.; Kui, M.; He, K.; Yang, M.; Du, J.; Jiang, Y.; Hu, Y. Jasmonate-regulated root growth inhibition and root hair elongation. J. Exp. Bot. 2023, 74, 1176–1185. [Google Scholar] [CrossRef]
  43. Bagautdinova, Z.Z.; Omelyanchuk, N.; Tyapkin, A.V.; Kovrizhnykh, V.V.; Lavrekha, V.V.; Zemlyanskaya, E.V. Salicylic acid in root growth and development. Int. J. Mol. Sci. 2022, 23, 2228. [Google Scholar] [CrossRef]
  44. Pal, M.; Janda, T.; Szalai, G. Abscisic acid may alter the salicylic acid-related abiotic stress response in maize. J. Agron. Crop. Sci. 2011, 197, 368–377. [Google Scholar] [CrossRef]
  45. Lee, Y.; Heo, S.; Lee, S. Inhibition of type 2C protein phosphatases by ABA receptors in abscisic acid-mediated plant stress responses. In Methods in Molecular Biology; Springer: Berlin/Heidelberg, Germany, 2022; Volume 2462, pp. 1–16. [Google Scholar]
  46. Laudert, D.; Weiler, E.W. Allene oxide synthase: A major control point in Arabidopsis thaliana octadecanoid signalling. Plant J. 1998, 15, 675–684. [Google Scholar] [CrossRef]
  47. Pratiwi, P.; Tanaka, G.; Takahashi, T.; Xie, X.; Yoneyama, K.; Matsuura, H.; Takahashi, K. Identification of jasmonic acid and jasmonoyl-isoleucine, and characterization of AOS, AOC, OPR and JAR1 in the model lycophyte Selaginella moellendorffii. Plant Cell Physiol. 2017, 58, 789–801. [Google Scholar] [CrossRef] [Green Version]
  48. Zhu, Z.; An, F.; Feng, Y.; Li, P.; Xue, L.; Mu, A.; Jiang, Z.; Kim, J.-M.; To, T.K.; Li, W.; et al. Derepression of ethylene-stabilized transcription factors (EIN3/EIL1) mediates jasmonate and ethylene signaling synergy in Arabidopsis. Proc. Natl. Acad. Sci. USA 2011, 108, 12539–12544. [Google Scholar] [CrossRef]
  49. Li, X.; Zhang, L.P.; Zhang, L.; Yan, P.; Ahammed, G.J.; Han, W.Y. Methyl salicylate enhances flavonoid biosynthesis in tea leaves by stimulating the phenylpropanoid pathway. Molecules 2019, 24, 362. [Google Scholar] [CrossRef] [Green Version]
  50. Wang, S.; Liu, Z.; Wang, X.; Liu, R.; Zou, L. Mushrooms do produce flavonoids: Metabolite profiling and transcriptome analysis of flavonoid synthesis in the medicinal mushroom Sanghuangporus baumii. J. Fungi 2022, 8, 582. [Google Scholar] [CrossRef]
  51. Singh, A.; Roychoudhury, A. Gene regulation at transcriptional and post-transcriptional levels to combat salt stress in plants. Physiol. Plant 2021, 173, 1556–1572. [Google Scholar] [CrossRef]
  52. Cheng, L.; Li, S.; Xu, X.; Hussain, J.; Yin, J.; Zhang, Y.; Li, L.; Chen, X. Identification of differentially expressed genes relevant to corm formation in Sagittaria trifolia. PLoS ONE 2013, 8, e54573. [Google Scholar] [CrossRef]
  53. You, Y.; Huang, X.; Liu, H.; Cheng, T.; Zheng, X.; Diao, Y.; Bao, Z.; Dong, C.; Ke, W.; Hu, Z. Leaf transcriptome analysis and development of EST-SSR markers in arrowhead (Sagittaria trifolia L. Var. Sinensis). Trop. Plant Biol. 2020, 13, 189–200. [Google Scholar] [CrossRef]
  54. Grabherr, M.G.; Haas, B.J.; Yassour, M.; Levin, J.Z.; Thompson, D.A.; Amit, I.; Adiconis, X.; Fan, L.; Raychowdhury, R.; Zeng, Q.; et al. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat. Biotechnol. 2011, 29, 644–652. [Google Scholar] [CrossRef] [Green Version]
  55. Buchfink, B.; Xie, C.; Huson, D.H. Fast and sensitive protein alignment using DIAMOND. Nat. Methods 2015, 12, 59–60. [Google Scholar] [CrossRef]
  56. Langmead, B.; Trapnell, C.; Pop, M.; Salzberg, S.L. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 2009, 10, R25. [Google Scholar] [CrossRef] [Green Version]
  57. Li, B.; Dewey, C.N. RSEM: Accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinf. 2011, 12, 323. [Google Scholar] [CrossRef] [Green Version]
  58. Li, Y.; Zhou, C.; Yan, X.; Zhang, J.; Xu, J. Simultaneous analysis of ten phytohormones in Sargassum horneri by high-performance liquid chromatography with electrospray ionization tandem mass spectrometry. J. Sep. Sci. 2016, 39, 1804–1813. [Google Scholar] [CrossRef]
  59. Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
Ijms 24 12345 g001
Figure 1. Morphological comparison of arrowheads in contrasting conditions. (a) Plant growth status of arrowheads 45 d after planting. l: leaf, ls: leafstalk, st: stolon, r: root, and c: corm. Bar represents 10 cm. (b–f) Plant height, root length, stolon length, stolon diameter, and corm diameter of two treatments 25 d and 45 d after planting. T and W represent sand culture and hydroponics, respectively. The error line indicates the standard deviation (SD) of multiple repeated samples. * means the significance of the difference between two treatments with Student’s t-test, ns: no significance, ** p < 0.01, **** p < 0.0001.
Figure 1. Morphological comparison of arrowheads in contrasting conditions. (a) Plant growth status of arrowheads 45 d after planting. l: leaf, ls: leafstalk, st: stolon, r: root, and c: corm. Bar represents 10 cm. (b–f) Plant height, root length, stolon length, stolon diameter, and corm diameter of two treatments 25 d and 45 d after planting. T and W represent sand culture and hydroponics, respectively. The error line indicates the standard deviation (SD) of multiple repeated samples. * means the significance of the difference between two treatments with Student’s t-test, ns: no significance, ** p < 0.01, **** p < 0.0001.
Ijms 24 12345 g001
Ijms 24 12345 g002
Figure 2. Anatomical structures of expanded and unexpanded arrowhead corm parts. Sampling time was 45 d after planting. T and W represent sand culture and hydroponics, respectively. ep: epidermis, pc: parenchyma cell, sg: starch granule; bar represents 100 μm.
Figure 2. Anatomical structures of expanded and unexpanded arrowhead corm parts. Sampling time was 45 d after planting. T and W represent sand culture and hydroponics, respectively. ep: epidermis, pc: parenchyma cell, sg: starch granule; bar represents 100 μm.
Ijms 24 12345 g002
Ijms 24 12345 g003
Figure 3. Transcriptome identification. (a) Volcano map and quantity statistics of DEGs. (b) GO annotation of DEGs. (c) COG functional classification of DEGs. (d) Top 20 KEGG metabolic pathways of DEGs. The pathway circled in red box indicates that it is a significantly enriched pathway that we noticed.
Figure 3. Transcriptome identification. (a) Volcano map and quantity statistics of DEGs. (b) GO annotation of DEGs. (c) COG functional classification of DEGs. (d) Top 20 KEGG metabolic pathways of DEGs. The pathway circled in red box indicates that it is a significantly enriched pathway that we noticed.
Ijms 24 12345 g003
Ijms 24 12345 g004
Figure 4. Contents of hormones in two treatments at the initial stage of corm expansion. (a–g) Hormone contents of ABA (a), auxins (b), CKs (c), GA (d), ETH (e), JAs (f), and SA (g) in corms in contrasting conditions. The dashed boxes indicate the types covered by each hormone. T and W represent sand culture and hydroponics, respectively. Column heights indicate hormone contents. The error line indicates the standard deviation (SD) of three repeated samples. * means the significance of the difference between two treatments analyzed with Student’s t-test, ns: no significance, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
Figure 4. Contents of hormones in two treatments at the initial stage of corm expansion. (a–g) Hormone contents of ABA (a), auxins (b), CKs (c), GA (d), ETH (e), JAs (f), and SA (g) in corms in contrasting conditions. The dashed boxes indicate the types covered by each hormone. T and W represent sand culture and hydroponics, respectively. Column heights indicate hormone contents. The error line indicates the standard deviation (SD) of three repeated samples. * means the significance of the difference between two treatments analyzed with Student’s t-test, ns: no significance, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
Ijms 24 12345 g004
Ijms 24 12345 g005
Figure 5. Expression profiles of genes related to plant hormone metabolism in sand culture and hydroponics. Green, orange, and purple vertical lines indicate biosynthesis, degradation, and signaling genes, respectively (color figure online). The gene with a red dot behind it indicates that it is a differentially expressed gene (DEG). W1–3 and T1–3 represent three biological repeats in hydroponics and sand culture, respectively.
Figure 5. Expression profiles of genes related to plant hormone metabolism in sand culture and hydroponics. Green, orange, and purple vertical lines indicate biosynthesis, degradation, and signaling genes, respectively (color figure online). The gene with a red dot behind it indicates that it is a differentially expressed gene (DEG). W1–3 and T1–3 represent three biological repeats in hydroponics and sand culture, respectively.
Ijms 24 12345 g005
Ijms 24 12345 g006
Figure 6. Relative expressions of ABA, JA, ETH, and SA metabolism-related genes in samples from sand culture and hydroponics. (a–d) Relative expressions of genes related to ABA (a), JA (b), ETH (c), and SA (d). Column height indicates gene expression level. T and W represent sand culture and hydroponics, respectively. The error line indicates the standard deviation (SD) of three replicates. * means the significance of the difference between two treatments analyzed with Student’s t-test, * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001.
Figure 6. Relative expressions of ABA, JA, ETH, and SA metabolism-related genes in samples from sand culture and hydroponics. (a–d) Relative expressions of genes related to ABA (a), JA (b), ETH (c), and SA (d). Column height indicates gene expression level. T and W represent sand culture and hydroponics, respectively. The error line indicates the standard deviation (SD) of three replicates. * means the significance of the difference between two treatments analyzed with Student’s t-test, * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001.
Ijms 24 12345 g006
Ijms 24 12345 g007
Figure 7. Model diagram of rhizosphere pressure response of arrowheads. In ‘hormone signaling’ the ‘?’ means that the interaction mechanism may exist, but not yet clear.
Figure 7. Model diagram of rhizosphere pressure response of arrowheads. In ‘hormone signaling’ the ‘?’ means that the interaction mechanism may exist, but not yet clear.
Ijms 24 12345 g007
Table 1. Unigenes functional annotation.
Table 1. Unigenes functional annotation.
Annotation DatabaseNumber of Annotated GenesPercentage of Annotated Genes (%)
COG Annotation592611.85
GO Annotation17,69935.38
KEGG Annotation13,81627.62
KOG Annotation11,76523.52
Pfam Annotation15,92431.83
Swissprot Annotation13,67327.33
TrEMBL Annotation21,01642.01
eggNOG Annotation18,22336.42
Nr Annotation21,05342.08
All Annotated22,05044.07
Table 2. The specific primers used for RT-qPCR assay.
Table 2. The specific primers used for RT-qPCR assay.
Gene IDPrimer Sequences (5′→3′)
ForwardReverse
c50546.graph_c0 (PYL2)GTCTGGTCCATCGTCCGTAGCTTTGGTGTCCTCCTCGCTGTTCC
c75622.graph_c1 (PP2C)TCCCTGAGCCAGAGGTGAGATTTGGAGTGCAAGCCTGGATAGGT
c78291.graph_c0 (PP2C)CCAACCAGGACTCCGCCATACTCGGTCATTGCCTTGGTCGTCAT
c73208.graph_c0 (SRK2)GCATTCACAGCCTAAGTCAACAGTTCCGCAGAGATGGATTGCCAACAA
c79182.graph_c0 (SRK2)CCGCTTCTTCTTCCAGCAACTCCACACGACCATACATCCGCAAT
c73758.graph_c0 (SRK2)ACTCCAAGTCCTCCGTGCTTCACAGACTGGGCTGCTTCGGTTAG
c76208.graph_c1 (AOS)CCTCTTCGCCACCTGCTTCAACGCCTCGTAGACCACCGACTTCA
c77328.graph_c0 (AOS)AGGACCGCCTTGACTACTTCTACCTTGACGGCATGTAGGTTCCTGTGA
c59897.graph_c0 (AOS)ATCGAGGAGCAGATCGCCAAGGTGAAGCCGCCGAAGGAGTTGA
c65009.graph_c0 (MYC2)AGGACCATATCATCGCCGAGAGGACTTCTTAACCAGGACAACCGACTC
c78587.graph_c0 (MYC2)CCAACCTGCACAACAACCTCTGAAGCGGCGTCTTCGTGTAGC
c83991.graph_c0 (MYC2)TCACGCTCCCTACTGGCAAAGAACCCTCACTTGGCGGACTATCA
c83806.graph_c0 (EIN3)CATCCACCACCGCCTCAATCCTCTGCTGCTGCCGTTGCTGTT
c75860.graph_c0 (EIN3)GCAGCAGCAGCAGTTCAATCCCGGAAGTCACCAGCGGCATT
c84962.graph_c0 (EIN3)CGAACCTCAAGTGCGTGTCCTTGCGTTGCCCATCACCCAGAA
c82967.graph_c1 (EIN3)AGCACAGTGGTGAGAAGCAGGAAACTTCCGTTGTCGCTCCCTCT
c57604.graph_c0 (NPR1)TGCGAGAAGTTGCTGGACAAGTGCGTATGCGTCATCCAAGGTTG
c81388.graph_c0 (NPR1)TGGCAGCGGTGTACTGGTCAAACGGTGAGAGGTGAGCATGGAA
c74812.graph_c0 (TGA)CGCTGCTTCATGTGGCTTGGTCGGTTGTGGTACTCGCCTATGG
c57673.graph_c0 (TGA)CGCCAGAGAATGAGGTGAGGTTAGTCCTTGCGAGAGTGAATCCT
c76930.graph_c0 (SLEEPER)CCTGTATTGCTTGGAAGTGGTATCCGTCGTCTTGATTGAATGGAT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, E.; Tang, J.; Liu, J.; Zhang, Z.; Hua, B.; Jiang, J.; Miao, M. The Roles of Hormone Signals Involved in Rhizosphere Pressure Response Induce Corm Expansion in Sagittaria trifolia. Int. J. Mol. Sci. 2023, 24, 12345. https://doi.org/10.3390/ijms241512345

AMA Style

Li E, Tang J, Liu J, Zhang Z, Hua B, Jiang J, Miao M. The Roles of Hormone Signals Involved in Rhizosphere Pressure Response Induce Corm Expansion in Sagittaria trifolia. International Journal of Molecular Sciences. 2023; 24(15):12345. https://doi.org/10.3390/ijms241512345

Chicago/Turabian Style

Li, Enjiao, Jing Tang, Jiexia Liu, Zhiping Zhang, Bing Hua, Jiezeng Jiang, and Minmin Miao. 2023. "The Roles of Hormone Signals Involved in Rhizosphere Pressure Response Induce Corm Expansion in Sagittaria trifolia" International Journal of Molecular Sciences 24, no. 15: 12345. https://doi.org/10.3390/ijms241512345

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop