Photodynamic Activity of Chlorophyllin and Polyethylenimine on Pseudomonas aeruginosa Planktonic, Biofilm and Persister Cells
Abstract
1. Introduction
2. Results
2.1. Photostability of Chlorophyllin
2.2. Influence of Polyethylenimine on the Eradication of P. aeruginosa Planktonic Cells by Chlorophyllin
2.3. Effect of Chlorophyllin and Polyethylenimine on Sessile P. aeruginosa
2.3.1. Influence on Biofilm
2.3.2. Eradication of P. aeruginosa Cells in Biofilm
2.4. Analysis of Persister Cells
2.4.1. Induction of Persister Cells by the Stringent Response
2.4.2. Effect of Chlorophyllin and Polyethylenimine on P. aeruginosa Persister Cells
3. Discussion
4. Materials and Methods
4.1. Chemicals
4.2. LED-Based Light Source
4.3. Growth Conditions and Photodynamic Inactivation
4.4. Biofilm Formation and Quantification
4.5. Characterization of Bacterial Viability in Established Colony Biofilms
4.6. Induction of Stringent Response
4.7. RNA Preparation and Quantitative RT-PCR
4.8. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Larsson, D.G.J.; Flach, C.F. Antibiotic Resistance in the Environment. Nat. Rev. Microbiol. 2022, 20, 257–269. [Google Scholar] [CrossRef] [PubMed]
- O’ Neil, J. Review on Antibiotic Resisitance. Antimicrobial Resistance: Tackling a Crisis for the Health and Wealth of Nations. Health Wealth Nations 2014, 1–16. [Google Scholar]
- Venkatesan, N.; Perumal, G.; Doble, M. Bacterial Resistance in Biofilm-Associated Bacteria. Future Microbiol. 2015, 10, 1743–1750. [Google Scholar] [CrossRef] [PubMed]
- Macià, M.D.; Rojo-Molinero, E.; Oliver, A. Antimicrobial Susceptibility Testing in Biofilm-Growing Bacteria. Clin. Microbiol. Infect. 2014, 20, 981–990. [Google Scholar] [CrossRef]
- World Health Organization. WHO Antibiotic Resistance. 2020. Available online: https://www.who.int/news-room/fact-sheets/detail/antibiotic-resistance (accessed on 1 June 2023).
- Murray, C.J.; Ikuta, K.S.; Sharara, F.; Swetschinski, L.; Robles Aguilar, G.; Gray, A.; Han, C.; Bisignano, C.; Rao, P.; Wool, E.; et al. Global Burden of Bacterial Antimicrobial Resistance in 2019: A Systematic Analysis. Lancet 2022, 399, 629–655. [Google Scholar] [CrossRef]
- Tacconelli, E.; Carrara, E.; Savoldi, A.; Harbarth, S.; Mendelson, M.; Monnet, D.L.; Pulcini, C.; Kahlmeter, G.; Kluytmans, J.; Carmeli, Y.; et al. Discovery, Research, and Development of New Antibiotics: The WHO Priority List of Antibiotic-Resistant Bacteria and Tuberculosis. Lancet Infect. Dis. 2018, 18, 318–327. [Google Scholar] [CrossRef]
- Rossi, E.; La Rosa, R.; Bartell, J.A.; Marvig, R.L.; Haagensen, J.A.J.; Sommer, L.M.; Molin, S.; Johansen, H.K. Pseudomonas aeruginosa Adaptation and Evolution in Patients with Cystic Fibrosis. Nat. Rev. Microbiol. 2021, 19, 331–342. [Google Scholar] [CrossRef]
- Stoner, S.N.; Baty, J.J.; Scoffield, J.A. Pseudomonas aeruginosa Polysaccharide Psl Supports Airway Microbial Community Development. ISME J. 2022, 16, 1730–1739. [Google Scholar] [CrossRef]
- Serra, R.; Grande, R.; Butrico, L.; Rossi, A.; Settimio, U.F.; Caroleo, B.; Amato, B.; Gallelli, L.; De Franciscis, S. Chronic Wound Infections: The Role of Pseudomonas aeruginosa and Staphylococcus aureus. Expert Rev. Anti. Infect. Ther. 2015, 13, 605–613. [Google Scholar] [CrossRef]
- İnat, G.; Sırıken, B.; Başkan, C.; Erol, İ.; Yıldırım, T.; Çiftci, A. Quorum Sensing Systems and Related Virulence Factors in Pseudomonas aeruginosa Isolated from Chicken Meat and Ground Beef. Sci. Rep. 2021, 11, 15639. [Google Scholar] [CrossRef]
- Raposo, A.; Pérez, E.; de Faria, C.T.; Ferrús, M.A.; Carrascosa, C. Food Spoilage by Pseudomonas Spp.-An Overview. In Foodborne Pathogens and Antibiotic Resistance; John Wiley & Sons, Inc.: Hoboken, NJ, USA, 2017; pp. 41–71. ISBN 9781119139188. [Google Scholar]
- Arslan, S.; Eyi, A.; Özdemir, F. Spoilage Potentials and Antimicrobial Resistance of Pseudomonas spp. Isolated from Cheeses. J. Dairy Sci. 2011, 94, 5851–5856. [Google Scholar] [CrossRef] [PubMed]
- Laborda, P.; Sanz-García, F.; Hernando-Amado, S.; Martínez, J.L. Pseudomonas aeruginosa: An Antibiotic Resilient Pathogen with Environmental Origin. Curr. Opin. Microbiol. 2021, 64, 125–132. [Google Scholar] [CrossRef] [PubMed]
- Soares, A.; Alexandre, K.; Etienne, M. Tolerance and Persistence of Pseudomonas aeruginosa in Biofilms Exposed to Antibiotics: Molecular Mechanisms, Antibiotic Strategies and Therapeutic Perspectives. Front. Microbiol. 2020, 11, 2057. [Google Scholar] [CrossRef]
- Guzmán-Soto, I.; McTiernan, C.; Gonzalez-Gomez, M.; Ross, A.; Gupta, K.; Suuronen, E.J.; Mah, T.F.; Griffith, M.; Alarcon, E.I. Mimicking Biofilm Formation and Development: Recent Progress in in Vitro and in Vivo Biofilm Models. iScience 2021, 24, 102443. [Google Scholar] [CrossRef]
- Cieplik, F.; Deng, D.; Crielaard, W.; Buchalla, W.; Hellwig, E.; Al-Ahmad, A.; Maisch, T. Antimicrobial Photodynamic Therapy–What We Know and What We Don’t. Crit. Rev. Microbiol. 2018, 44, 571–589. [Google Scholar] [CrossRef]
- Rapacka-zdonczyk, A.; Wozniak, A.; Nakonieczna, J.; Grinholc, M. Development of Antimicrobial Phototreatment Tolerance: Why the Methodology Matters. Int. J. Mol. Sci. 2021, 22, 2224. [Google Scholar] [CrossRef] [PubMed]
- Buchovec, I.; Gricajeva, A.; Kalėdienė, L.; Vitta, P. Antimicrobial Photoinactivation Approach Based on Natural Agents for Control of Bacteria Biofilms in Spacecraft. Int. J. Mol. Sci. 2020, 21, 6932. [Google Scholar] [CrossRef]
- Stojiljkovic, I.; Evavold, B.D.; Kumar, V. Antimicrobial Properties of Porphyrins. Expert Opin. Investig. Drugs 2001, 10, 309–320. [Google Scholar] [CrossRef] [PubMed]
- Ndlovu, K.S.; Moloto, M.J.; Sekhosana, K.E.; Nkambule, T.T.I.; Managa, M. Porphyrins Developed for Photoinactivation of Microbes in Wastewater. Environ. Sci. Pollut. Res. 2023, 30, 11210–11225. [Google Scholar] [CrossRef]
- Richter, P.; Krüger, M.; Prasad, B.; Gastiger, S.; Bodenschatz, M.; Wieder, F.; Burkovski, A.; Geißdörfer, W.; Lebert, M.; Strauch, S.M. Using Colistin as a Trojan Horse: Inactivation of Gram-Negative Bacteria with Chlorophyllin. Antibiotics 2019, 8, 158. [Google Scholar] [CrossRef]
- Krüger, M.; Richter, P.; Strauch, S.M.; Nasir, A.; Burkovski, A.; Antunes, C.A.; Meißgeier, T.; Schlücker, E.; Schwab, S.; Lebert, M. What an Escherichia coli Mutant Can Teach Us about the Antibacterial Effect of Chlorophyllin. Microorganisms 2019, 7, 59. [Google Scholar] [CrossRef] [PubMed]
- Buchovec, I.; Lukseviciūtė, V.; Kokstaite, R.; Labeikyte, D.; Kaziukonyte, L.; Luksiene, Z. Inactivation of Gram (−) Bacteria Salmonella enterica by Chlorophyllin-Based Photosensitization: Mechanism of Action and New Strategies to Enhance the Inactivation Efficiency. J. Photochem. Photobiol. B Biol. 2017, 172, 1–10. [Google Scholar] [CrossRef]
- Akif, F.A.; Mahmoud, M.; Prasad, B.; Richter, P.; Azizullah, A.; Qasim, M.; Anees, M.; Krüger, M.; Gastiger, S.; Burkovski, A.; et al. Polyethylenimine Increases Antibacterial Efficiency of Chlorophyllin. Antibiotics 2022, 11, 1371. [Google Scholar] [CrossRef] [PubMed]
- Solymosi, K.; Mysliwa-Kurdziel, B. Chlorophylls and Their Derivatives Used in Food Industry and Medicine. Mini-Rev. Med. Chem. 2016, 17, 1194–1222. [Google Scholar] [CrossRef]
- Queiroz Zepka, L.; Jacob-Lopes, E.; Roca, M. Catabolism and Bioactive Properties of Chlorophylls. Curr. Opin. Food Sci. 2019, 26, 94–100. [Google Scholar] [CrossRef]
- Pucelik, B.; Dąbrowski, J.M. Photodynamic Inactivation (PDI) as a Promising Alternative to Current Pharmaceuticals for the Treatment of Resistant Microorganisms. Adv. Inorg. Chem. 2022, 79, 65–103. [Google Scholar] [CrossRef]
- Sperandio, F.; Huang, Y.-Y.; Hamblin, M. Antimicrobial Photodynamic Therapy to Kill Gram-Negative Bacteria. Recent Pat. Antiinfect. Drug Discov. 2013, 8, 108–120. [Google Scholar] [CrossRef]
- Nie, M.; Deng, D.M.; Wu, Y.; de Oliveira, K.T.; Bagnato, V.S.; Crielaard, W.; de Rastelli, A.N.S. Photodynamic Inactivation Mediated by Methylene Blue or Chlorin E6 against Streptococcus Mutans Biofilm. Photodiagnosis Photodyn. Ther. 2020, 31, 101817. [Google Scholar] [CrossRef]
- Foxley, M.A.; Wright, S.N.; Lam, A.K.; Friedline, A.W.; Strange, S.J.; Xiao, M.T.; Moen, E.L.; Rice, C.V. Targeting Wall Teichoic Acid in Situ with Branched Polyethylenimine Potentiates β-Lactam Efficacy against MRSA. ACS Med. Chem. Lett. 2017, 8, 1083–1088. [Google Scholar] [CrossRef]
- Kaplan, J.B. Antibiotic-Induced Biofilm Formation. Int. J. Artif. Organs 2011, 34, 737–751. [Google Scholar] [CrossRef] [PubMed]
- Ranieri, M.R.; Whitchurch, C.B.; Burrows, L.L. Mechanisms of Biofilm Stimulation by Subinhibitory Concentrations of Antimicrobials. Curr. Opin. Microbiol. 2018, 45, 164–169. [Google Scholar] [CrossRef]
- Nguyen, D.; Joshi-Datar, A.; Lepine, F.; Bauerle, E.; Olakanmi, O.; Beer, K.; McKay, G.; Siehnel, R.; Schafhauser, J.; Wang, Y.; et al. Active Starvation Responses Mediate Antibiotic Tolerance in Biofilms and Nutrient-Limited Bacteria. Science 2011, 334, 982–986. [Google Scholar] [CrossRef] [PubMed]
- Moradali, M.F.; Ghods, S.; Rehm, B.H.A. Pseudomonas aeruginosa Lifestyle: A Paradigm for Adaptation, Survival, and Persistence. Front. Cell. Infect. Microbiol. 2017, 7, 39. [Google Scholar] [CrossRef]
- Lakens, D. Calculating and Reporting Effect Sizes to Facilitate Cumulative Science: A Practical Primer for t-Tests and ANOVAs. Front. Psychol. 2013, 4, 863. [Google Scholar] [CrossRef]
- Cohen, J. Statistical Power Analysis for the Behavioral Sciences, 2nd ed.; Lawrence Erlbaum: Hillsdale, NJ, USA, 1988; ISBN 0805802835. [Google Scholar]
- Li, X.; Gu, N.; Huang, T.Y.; Zhong, F.; Peng, G. Pseudomonas aeruginosa: A Typical Biofilm Forming Pathogen and an Emerging but Underestimated Pathogen in Food Processing. Front. Microbiol. 2023, 13, 1114199. [Google Scholar] [CrossRef]
- Hamblin, M.R.; Abrahamse, H. Oxygen-Independent Antimicrobial Photoinactivation: Type III Photochemical Mechanism? Antibiotics 2020, 9, 53. [Google Scholar] [CrossRef]
- Krieger-Liszkay, A. Singlet Oxygen Production in Photosynthesis. J. Exp. Bot. 2005, 56, 337–346. [Google Scholar] [CrossRef]
- Ochsner, M. Photophysical and Photobiological Processes in the Photodynamic Therapy of Tumours. J. Photochem. Photobiol. B Biol. 1997, 39, 1–18. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Guo, Y.; Gao, J.; Jin, X.; Wang, Z.; Wang, B.; Li, K.; Li, Y. Detection and Comparison of Reactive Oxygen Species (ROS) Generated by Chlorophyllin Metal (Fe, Mg and Cu) Complexes under Ultrasonic and Visible-Light Irradiation. Ultrason. Sonochem. 2011, 18, 1028–1034. [Google Scholar] [CrossRef]
- López-Carballo, G.; Hernández-Muñoz, P.; Gavara, R.; Ocio, M.J. Photoactivated Chlorophyllin-Based Gelatin Films and Coatings to Prevent Microbial Contamination of Food Products. Int. J. Food Microbiol. 2008, 126, 65–70. [Google Scholar] [CrossRef]
- Seow, W.Y.; Liang, K.; Kurisawa, M.; Hauser, C.A.E. Oxidation as a Facile Strategy To Reduce the Surface Charge and Toxicity of Polyethyleneimine Gene Carriers. Biomacromolecules 2013, 14, 2340–2346. [Google Scholar] [CrossRef] [PubMed]
- Tang, M.X.; Szoka, F.C. The Influence of Polymer Structure on the Interactions of Cationic Polymers with DNA and Morphology of the Resulting Complexes. Gene Ther. 1997, 4, 823–832. [Google Scholar] [CrossRef] [PubMed]
- Kafil, V.; Omidi, Y. Cytotoxic Impacts of Linear and Branched Polyethylenimine Nanostructures in A431 Cells. BioImpacts 2011, 1, 23–30. [Google Scholar] [CrossRef] [PubMed]
- Meng, F.; Kwon, S.; Wang, J.; Yeo, Y. Immunoactive Drug Carriers in Cancer Therapy. In Biomaterials for Cancer Therapeutics; Elsevier: Amsterdam, The Netherlands, 2020; pp. 53–94. ISBN 9780081029831. [Google Scholar]
- Vicennati, P.; Giuliano, A.; Ortaggi, G.; Masotti, A. Polyethylenimine In Medicinal Chemistry. Curr. Med. Chem. 2008, 15, 2826–2839. [Google Scholar] [CrossRef]
- Choosakoonkriang, S.; Lobo, B.A.; Koe, G.S.; Koe, J.G.; Middaugh, C.R. Biophysical Characterization of PEI/DNA Complexes. J. Pharm. Sci. 2003, 92, 1710–1722. [Google Scholar] [CrossRef]
- Helander, I.M.; Alakomi, H.L.; Latva-Kala, K.; Koski, P. Polyethyleneimine Is an Effective Permeabilizer of Gram-Negative Bacteria. Microbiology 1997, 143, 3193–3199. [Google Scholar] [CrossRef]
- Wang, A.; Duan, S.; Hu, Y.; Ding, X.; Xu, F.J. Fluorination of Polyethylenimines for Augmentation of Antibacterial Potency via Structural Damage and Potential Dissipation of Bacterial Membranes. ACS Appl. Mater. Interfaces 2022, 14, 44173–44182. [Google Scholar] [CrossRef]
- Panlilio, H.; Neel, A.; Heydarian, N.; Best, W.; Atkins, I.; Boris, A.; Bui, M.; Dick, C.; Ferrell, M.; Gu, T.; et al. Antibiofilm Activity of PEGylated Branched Polyethylenimine. ACS Omega 2022, 7, 44825–44835. [Google Scholar] [CrossRef]
- Rapacka-Zdończyk, A.; Woźniak, A.; Michalska, K.; Pierański, M.; Ogonowska, P.; Grinholc, M.; Nakonieczna, J. Factors Determining the Susceptibility of Bacteria to Antibacterial Photodynamic Inactivation. Front. Med. 2021, 8, 642609. [Google Scholar] [CrossRef]
- Zhang, Z.; Tan, Y.; Huang, C.; Wei, X. Redox Signaling in Drug-Tolerant Persister Cells as an Emerging Therapeutic Target. eBioMedicine 2023, 89, 104483. [Google Scholar] [CrossRef]
- Roy, S.; Bahar, A.A.; Gu, H.; Nangia, S.; Sauer, K.; Ren, D. Persister Control by Leveraging Dormancy Associated Reduction of Antibiotic Efflux. PLoS Pathog. 2021, 17, e1010144. [Google Scholar] [CrossRef] [PubMed]
- Mahieux, S.; Nieto-Bobadilla, M.S.; Houcke, I.; Neut, C. How to Study Antimicrobial Activities of Plant Extracts: A Critical Point of View; Springer: Berlin/Heidelberg, Germany, 2018; pp. 55–71. ISBN 9783319670454. [Google Scholar]
- Harrison, J.J.; Stremick, C.A.; Turner, R.J.; Allan, N.D.; Olson, M.E.; Ceri, H. Microtiter Susceptibility Testing of Microbes Growing on Peg Lids: A Miniaturized Biofilm Model for High-Throughput Screening. Nat. Protoc. 2010, 5, 1236–1254. [Google Scholar] [CrossRef] [PubMed]
- O’Toole, G.A. Microtiter Dish Biofilm Formation Assay. J. Vis. Exp. 2011, 47, e2437. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2-ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Alqarni, B.; Colley, B.; Klebensberger, J.; McDougald, D.; Rice, S.A. Expression Stability of 13 Housekeeping Genes during Carbon Starvation of Pseudomonas aeruginosa. J. Microbiol. Methods 2016, 127, 182–187. [Google Scholar] [CrossRef]
- Savli, H.; Karadenizli, A.; Kolayli, F.; Gundes, S.; Ozbek, U.; Vahaboglu, H. Expression Stability of Six Housekeeping Genes: A Proposal for Resistance Gene Quantification Studies of Pseudomonas aeruginosa by Real-Time Quantitative RT-PCR. J. Med. Microbiol. 2003, 52, 403–408. [Google Scholar] [CrossRef]
- Assaad, H.I.; Zhou, L.; Carroll, R.J.; Wu, G. Rapid Publication-Ready MS-Word Tables for One-Way ANOVA. Springerplus 2014, 3, 474. [Google Scholar] [CrossRef]
- Zheng, S.; Wang, W.; Aldahdooh, J.; Malyutina, A.; Shadbahr, T.; Tanoli, Z.; Pessia, A.; Tang, J. SynergyFinder Plus: Toward Better Interpretation and Annotation of Drug Combination Screening Datasets. Genom. Proteom. Bioinform. 2022, 20, 587–596. [Google Scholar] [CrossRef]
- Duarte, D.; Vale, N. Evaluation of Synergism in Drug Combinations and Reference Models for Future Orientations in Oncology. Curr. Res. Pharmacol. Drug Discov. 2022, 3, 100110. [Google Scholar] [CrossRef]
Gene | Sequence (5′->3′) | Primer Size (b) | Product Size (bp) | Reference |
---|---|---|---|---|
relA | GAGATCCCATCGTCGGCTAC | 20 | 171 | This study |
CATAGGCACGGATCGCGATA | 20 | |||
spoT | CGACAAGGTCGATACCTGCT | 20 | 195 | This study |
TTGGCCATCTCTTCCATCTC | 20 | |||
lon | CCGTGGTGCGTTCCTACATA | 20 | 138 | This study |
GAATGCGCTCCTTGACCTCT | 20 | |||
rpoS | CTCCCCGGGCAACTCCAAAAG | 21 | 200 | [60,61] |
CGATCATCCGCTTCCGACCAG | 21 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mahmoud, M.; Richter, P.; Lebert, M.; Burkovski, A. Photodynamic Activity of Chlorophyllin and Polyethylenimine on Pseudomonas aeruginosa Planktonic, Biofilm and Persister Cells. Int. J. Mol. Sci. 2023, 24, 12098. https://doi.org/10.3390/ijms241512098
Mahmoud M, Richter P, Lebert M, Burkovski A. Photodynamic Activity of Chlorophyllin and Polyethylenimine on Pseudomonas aeruginosa Planktonic, Biofilm and Persister Cells. International Journal of Molecular Sciences. 2023; 24(15):12098. https://doi.org/10.3390/ijms241512098
Chicago/Turabian StyleMahmoud, Mona, Peter Richter, Michael Lebert, and Andreas Burkovski. 2023. "Photodynamic Activity of Chlorophyllin and Polyethylenimine on Pseudomonas aeruginosa Planktonic, Biofilm and Persister Cells" International Journal of Molecular Sciences 24, no. 15: 12098. https://doi.org/10.3390/ijms241512098
APA StyleMahmoud, M., Richter, P., Lebert, M., & Burkovski, A. (2023). Photodynamic Activity of Chlorophyllin and Polyethylenimine on Pseudomonas aeruginosa Planktonic, Biofilm and Persister Cells. International Journal of Molecular Sciences, 24(15), 12098. https://doi.org/10.3390/ijms241512098