Transcriptome Analysis Reveals the Effect of Stocking Density on Energy Metabolism in the Gills of Cherax quadricarinatus under Rice-Crayfish Co-Culture
Abstract
1. Introduction
2. Results
2.1. Changes in Oxidative Stress Parameters
2.2. Transcriptome Sequencing and Analysis of Differently Expressed Genes (DEGs) in Gills
2.3. Gene Ontology (GO) Enrichment Analysis of DEGs
2.4. Kyoto Encyclopedia of Genes and Genomes (KEGG) Enrichment Analysis of DEGs
2.5. DEGs in the Oxidative Phosphorylation and ATP Metabolic Process
2.6. Changes in Lipid Metabolism-Related Pathways
2.7. Validation via RT-qPCR
3. Discussion
4. Materials and Methods
4.1. Crayfish, Experimental Design and Sampling
4.2. Measurement of Oxidative Stress Parameters
4.3. Transcriptome Sequencing and Analysis
4.4. Quantitative Real-Time PCR (RT-qPCR) Analysis
4.5. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Liu, D.; Tang, R.; Xie, J.; Tian, J.; Shi, R.; Zhang, K. Valuation of ecosystem services of rice-fish coculture systems in Ruyuan County, China. Ecosyst. Serv. 2020, 41, 101054. [Google Scholar] [CrossRef]
- Liu, D.; Feng, Q.; Zhang, J.; Zhang, K.; Tian, J.; Xie, J. Ecosystem services analysis for sustainable agriculture expansion: Rice-fish co-culture system breaking through the Hu Line. Ecol. Indic. 2021, 133, 108385. [Google Scholar] [CrossRef]
- Arunrat, N.; Sereenonchai, S. Assessing Ecosystem Services of Rice-Fish Co-Culture and Rice Monoculture in Thailand. Agronomy 2022, 12, 1241. [Google Scholar] [CrossRef]
- Yu, X.; Hao, X.; Dang, Z.; Yang, L. Report on the Development of Integrated Rice-Fish Farming Industry in China (2022). China Fish. 2023, 566, 39–46. [Google Scholar]
- Xu, P. Development and Prospect of Integrated Rice-Fish Farming in China. J. Dalian Ocean. Univ. 2021, 36, 717–726. [Google Scholar]
- Xu, Q.; Peng, X.; Guo, H.; Che, Y.; Dou, Z.; Xing, Z.; Hou, J.; Styles, D.; Gao, H.; Zhang, H. Rice-crayfish coculture delivers more nutrition at a lower environmental cost. Sustain. Prod. Consum. 2022, 29, 14–24. [Google Scholar] [CrossRef]
- Si, G.; Peng, C.; Xu, X.; Zhao, S.; Xu, D.; Yuan, J.; Jia, P.; Liu, J. Effects of rice-crayfish integrated mode on soil microbial functional diversity and fertility in waterlogged paddy field. Soils 2016, 48, 503–509. [Google Scholar]
- Xu, X.; Zhang, M.; Peng, C.; Si, G.; Zhou, J.; Xie, Y.; Yuan, J. Effect of ricecrayfish co-culture on greenhouse gases emission in strawpuddled paddy fields. Chin. J. Eco-Agric. 2017, 25, 1591–1603. [Google Scholar]
- Xiao, Q. Effects of Rice-Crayfish Farming on Biodiverity of Paddy Field. Master’s Thesis, Huazhong Agricultural University, Wuhan, China, 2017. [Google Scholar]
- Merino, G.E.; Piedrahita, R.H.; Conklin, D.E. The effect of fish stocking density on the growth of California halibut (Paralichthys californicus) juveniles. Aquaculture 2007, 265, 176–186. [Google Scholar] [CrossRef]
- Toko, I.; Fiogbe, E.D.; Koukpode, B.; Kestemont, P. Rearing of African catfish (Clarias gariepinus) and vundu catfish (Heterobranchus longifilis) in traditional fish ponds (whedos): Effect of stocking density on growth, production and body composition. Aquaculture 2007, 262, 65–72. [Google Scholar] [CrossRef]
- Refaey, M.M.; Li, D.; Tian, X.; Zhang, Z.; Zhang, X.; Li, L.; Tang, R. High stocking density alters growth performance, blood biochemistry, intestinal histology, and muscle quality of channel catfish Ictalurus punctatus. Aquaculture 2018, 492, 73–81. [Google Scholar] [CrossRef]
- Mugwanya, M.; Dawood, M.A.O.; Kimera, F.; Sewilam, H. A review on recirculating aquaculture system: Influence of stocking density on fish and crustacean behavior, growth performance, and immunity. Ann. Anim. Sci. 2022, 22, 873–884. [Google Scholar] [CrossRef]
- Wyban, J.A.; Lee, C.S.; Sato, V.T.; Sweeney, J.N.; Richards, W.K. Effect of stocking density on shrimp growth rates in manure-fertilized ponds. Aquaculture 1987, 61, 23–32. [Google Scholar] [CrossRef]
- Xiao, M.; Xiao, Y.; Wu, Z.; Hu, X. Effects of stocking density on growth, digestive enzyme activities and biochemical indices of juvenile Procambarus clarkii. J. Fish. China 2012, 36, 1088–1093. [Google Scholar] [CrossRef]
- Zheng, J.B.; Mao, Y.; Su, Y.Q.; Wang, J. Effects of stocking density on the survival, growth and physical injury of Marsupenaeus japonicus juveniles in a flowing water aquaculture system. Aquac. Res. 2020, 51, 1500–1506. [Google Scholar] [CrossRef]
- Gao, Y.; He, Z.L.; Vector, H.; Zhao, B.; Li, Z.W.; He, J.; Lee, J.Y.; Chu, Z.J. Effect of Stocking Density on Growth, Oxidative Stress and HSP 70 of Pacific White Shrimp Litopenaeus vannamei. Turk. J. Fish. Aquat. Sci. 2017, 17, 877–884. [Google Scholar] [CrossRef]
- Deng, Y.L.; Xu, X.Y.; Yin, X.W.; Lu, H.F.; Chen, G.S.; Yu, J.H.; Ruan, Y.J. Effect of stock density on the microbial community in biofloc water and Pacific white shrimp (Litopenaeus vannamei) gut microbiota. Appl. Microbiol. Biotechnol. 2019, 103, 4241–4252. [Google Scholar] [CrossRef]
- Henry, R.P.; Lucu, C.; Onken, H.; Weihrauch, D. Multiple functions of the crustacean gill: Osmotic/ionic regulation, acid-base balance, ammonia excretion, and bioaccumulation of toxic metals. Front. Physiol. 2012, 3, 431. [Google Scholar] [CrossRef]
- Ikerd, J.L.; Burnett, K.G.; Burnett, L.E. Effects of salinity on the accumulation of hemocyte aggregates and bacteria in the gills of Callinectes sapidus, the Atlantic blue crab, injected with Vibrio campbellii. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2015, 183, 97–106. [Google Scholar] [CrossRef]
- El Deen, A.I.E.N.; Shalaby, S.I.A.; Zaki, M.S. Field study on Cadmium pollution in water and Crustacean gill parasites in cultured Tilapia zilli at Lower Egypt fish farms. Life Sci. J.-Acta Zhengzhou Univ. Overseas Ed. 2011, 8, 599–605. [Google Scholar]
- Wang, G.-Z.; Kong, X.-H.; Wang, K.-J.; Li, S.-J. Variation of specific proteins, mitochondria and fatty acid composition in gill of Scylla serrata (Crustacea, Decapoda) under low temperature adaptation. J. Exp. Mar. Biol. Ecol. 2007, 352, 129–138. [Google Scholar] [CrossRef]
- Roab, C.; Rp, D.; Jsab, C.; Fjm, G.; Jlpm, E.; Rj, F.; Jmm, F.; Vca, C. Stocking density affects the growth performance, intermediary metabolism, osmoregulation, and response to stress in Patagonian blennie Eleginops maclovinus. Aquaculture 2020, 515, 734565. [Google Scholar]
- Beydemir, S.; Aksakal, E.; Alim, Z.; Erdogan, O.; Ceyhun, S.B. The effects of stocking density on cyp 450 1a gene expression and carbonic anhydrase enzyme activity in rainbow trout (Oncorhynchus mykiss). Fresenius Environ. Bull. 2011, 20, 1452–1457. [Google Scholar]
- Crosbie, P.B.B.; Bridle, A.R.; Leef, M.J.; Nowak, B.F. Effects of different batches of Neoparamoeba perurans and fish stocking densities on the severity of amoebic gill disease in experimental infection of Atlantic salmon, Salmo salar L. Aquac. Res. 2010, 41, e505–e516. [Google Scholar] [CrossRef]
- Zhang, H.; Tu, J.; Lin, F.; Guo, J.; Lu, D.; Guo, M. An initial exploration of the integrated rice-fish farming technology for red claw crayfish. Sci. Fish Farming 2019, 3, 28–29. [Google Scholar]
- Dong, Y.; Jia, R.; Hou, Y.; Diao, W.; Li, B.; Zhu, J. Effects of stocking density on the growth performance, mitophagy, endocytosis and metabolism of Cherax quadricarinatus in integrated rice-crayfish farming systems. Front. Physiol. 2022, 13, 1040712. [Google Scholar] [CrossRef] [PubMed]
- Jørgensen, E.H.; Christiansen, J.S.; Jobling, M. Effects of stocking density on food intake, growth performance and oxygen consumption in Arctic charr (Salvelinus alpinus). Aquaculture 1993, 110, 191–204. [Google Scholar] [CrossRef]
- Liu, B.; Jia, R.; Zhao, K.; Wang, G.; Lei, J.; Huang, B. Stocking density effects on growth and stress response of juvenile turbot (Scophthalmus maximus) reared in land-based recirculating aquaculture system. Acta Oceanol. Sin. 2017, 36, 31–38. [Google Scholar] [CrossRef]
- Jia, R.; Liu, B.L.; Han, C.; Huang, B.; Lei, J. Influence of Stocking Density on Growth Performance, Antioxidant Status, and Physiological Response of Juvenile Turbot, Scophthalmus maximu, Reared in Land-based Recirculating Aquaculture System. J. World Aquac. Soc. 2016, 47, 587–599. [Google Scholar] [CrossRef]
- Sahin, K.; Yazlak, H.; Orhan, C.; Tuzcu, M.; Akdemir, F.; Sahin, N. The effect of lycopene on antioxidant status in rainbow trout (Oncorhynchus mykiss) reared under high stocking density. Aquaculture 2014, 418–419, 132–138. [Google Scholar] [CrossRef]
- Choi, C.Y.; Choi, J.Y.; Choi, Y.J.; Kim, B.-S.; Kim, J.-W. Effects of green wavelength light on antioxidant and non-specific immune responses of the olive flounder Paralichthys olivaceus maintained at different stocking densities. Aquac. Eng. 2019, 84, 23–28. [Google Scholar] [CrossRef]
- Wang, X.M.; Dai, W.; Xu, M.; Pan, B.P.; Li, X.Q.; Chen, Y.T. Effects of Stocking Density on Growth, Nonspecific Immune Response, and Antioxidant Status in African Catfish (Clarias gariepinus). Isr. J. Aquac. Bamidgeh 2013, 65, 830. [Google Scholar]
- Dorothy, M.S.; Harikrishna, V.; Arun, S.; Appidi, R.; Babitha, R.A.M. Growth, body composition and antioxidant status of Litopenaeus vannamei juveniles reared at different stocking densities in the biofloc system using inland saline groundwater. Aquac. Res. 2021, 52, 6299–6307. [Google Scholar] [CrossRef]
- Teppner, M.; Böss, F.; Ernst, B.; Pähler, A. Application of lipid peroxidation products as biomarkers for flutamide-induced oxidative stress in vitro. Toxicol. Lett. 2015, 238, 53–59. [Google Scholar] [CrossRef]
- Niki, E. Lipid peroxidation products as oxidative stress biomarkers. BioFactors 2008, 34, 171–180. [Google Scholar] [CrossRef]
- Wang, Y.; Ni, J.; Nie, Z.; Gao, J.; Sun, Y.; Shao, N.; Li, Q.; Hu, J.; Xu, P.; Xu, G. Effects of stocking density on growth, serum parameters, antioxidant status, liver and intestine histology and gene expression of largemouth bass (Micropterus salmoides) farmed in the in-pond raceway system. Aquac. Res. 2020, 51, 5228–5240. [Google Scholar] [CrossRef]
- Hoseini, S.M.; Yousefi, M.; Taheri Mirghaed, A.; Paray, B.A.; Hoseinifar, S.H.; Van Doan, H. Effects of rearing density and dietary tryptophan supplementation on intestinal immune and antioxidant responses in rainbow trout (Oncorhynchus mykiss). Aquaculture 2020, 528, 735537. [Google Scholar] [CrossRef]
- Zhang, H.; He, Y.; Li, J.; Hu, S.; Han, X. Effects of density stress on growth, antioxidant system function and water quality indexes of juvenile Penaeus chinensis. Prog. Fish. Sci. 2020, 41, 140–149. [Google Scholar]
- Santos, G.A.; Schrama, J.W.; Capelle, J.; Rombout, J.H.W.M.; Verreth, J.A.J. Effects of dissolved carbon dioxide on energy metabolism and stress responses in European seabass (Dicentrarchus labrax). Aquac. Res. 2013, 44, 1370–1382. [Google Scholar] [CrossRef]
- Elston, T.; Wang, H.; Oster, G. Energy transduction in ATP synthase. Nature 1998, 391, 510–513. [Google Scholar] [CrossRef]
- Ishibashi, Y.; Ekawa, H.; Hirata, H.; Kumai, H. Stress response and energy metabolism in various tissues of Nile tilapia Oreochromis niloticus exposed to hypoxic conditions. Fish. Sci. 2010, 68, 1374–1383. [Google Scholar] [CrossRef]
- Tseng, Y.-C.; Hwang, P.-P. Some insights into energy metabolism for osmoregulation in fish. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2008, 148, 419–429. [Google Scholar] [CrossRef] [PubMed]
- Tseng, Y.C.; Lee, J.R.; Chang, J.C.H.; Kuo, C.H.; Lee, S.J.; Hwang, P.P. Regulation of lactate dehydrogenase in tilapia (Oreochromis mossambicus) gills during acclimation to salinity challenge. Zool. Stud. 2008, 47, 473–480. [Google Scholar]
- Jiang, W.W.; Tian, X.L.; Fang, Z.H.; Li, L.; Dong, S.L.; Li, H.D.; Zhao, K. Metabolic responses in the gills of tongue sole (Cynoglossus semilaevis) exposed to salinity stress using NMR-based metabolomics. Sci. Total Environ. 2019, 653, 465–474. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.H.; Zhong, L.Q.; Mu, W.N.; Wu, Y.H. Alteration of parameters of energy metabolism and ATPase enzymatic system in juvenile common carp (Cyprinus carpio) chronically exposed to tributyltin. Czech J. Anim. Sci. 2016, 61, 326–332. [Google Scholar] [CrossRef]
- Baldissera, M.D.; Souza, C.F.; Val, A.L.; Baldisserotto, B. Participation of phosphoryl transfer network on branchial energetic imbalance of matrinxa (Brycon amazonicus) exposed to air: Notable involvement of creatine kinase. Aquaculture 2020, 518, 734863. [Google Scholar] [CrossRef]
- Wang, T.; Li, W.H.; Shan, H.W.; Ma, S. Responses of energy homeostasis and lipid metabolism in Penaeus vannamei exposed to ammonia stress. Aquaculture 2021, 544, 737092. [Google Scholar] [CrossRef]
- Hatefi, Y. The mitochondrial electron transport and oxidative phosphorylation system. Annu. Rev. Biochem. 1985, 54, 1015–1069. [Google Scholar] [CrossRef]
- Nolfi-Donegan, D.; Braganza, A.; Shiva, S. Mitochondrial electron transport chain: Oxidative phosphorylation, oxidant production, and methods of measurement. Redox Biol. 2020, 37, 101674. [Google Scholar] [CrossRef]
- Li, E.C.; Wang, S.L.; Li, C.; Wang, X.D.; Chen, K.; Chen, L.Q. Transcriptome sequencing revealed the genes and pathways involved in salinity stress of Chinese mitten crab, Eriocheir sinensis. Physiol. Genom. 2014, 46, 177–190. [Google Scholar] [CrossRef]
- Xiao, J.; Luo, S.-S.; Du, J.-H.; Liu, Q.-Y.; Huang, Y.; Wang, W.-F.; Chen, X.-L.; Chen, X.-H.; Liu, H.; Zhou, X.-Y.; et al. Transcriptomic analysis of gills in nitrite-tolerant and -sensitive families of Litopenaeus vannamei. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2022, 253, 109212. [Google Scholar] [CrossRef]
- Sun, S.; Xuan, F.; Fu, H.; Zhu, J.; Ge, X.; Gu, Z. Transciptomic and histological analysis of hepatopancreas, muscle and gill tissues of oriental river prawn (Macrobrachium nipponense) in response to chronic hypoxia. BMC Genom. 2015, 16, 491. [Google Scholar] [CrossRef] [PubMed]
- Schönfeld, P.; Wojtczak, L. Short- and medium-chain fatty acids in energy metabolism: The cellular perspective. J. Lipid Res. 2016, 57, 943–954. [Google Scholar] [CrossRef]
- Montero, D.; Izquierdo, M.S.; Tort, L.; Robaina, L.; Vergara, J.M. High stocking density produces crowding stress altering some physiological and biochemical parameters in gilthead seabream, Sparus aurata, juveniles. Fish Physiol. Biochem. 1999, 20, 53–60. [Google Scholar] [CrossRef]
- Qiang, J.; Bao, J.W.; He, J.; Tao, Y.F.; Habte-Tsion, H.M.; Xu, P. Growth, biochemical, fatty acid composition, and mRNA levels of hepatic enzymes in genetically improved farmed tilapia (GIFT, Oreochromis niloticus) (Linnaeus, 1758) at different stocking densities. J. Appl. Ichthyol. 2017, 33, 757–766. [Google Scholar] [CrossRef]
- He, Y.; Yu, H.; Zhao, H.; Zhu, H.; Zhang, Q.; Wang, A.; Shen, Y.; Xu, X.; Li, J. Transcriptomic analysis to elucidate the effects of high stocking density on grass carp (Ctenopharyngodon idella). BMC Genom. 2021, 22, 620. [Google Scholar] [CrossRef]
- Liu, Y.; Liu, H.; Wu, W.; Yin, J.; Mou, Z.; Hao, F. Effects of stocking density on growth performance and metabolism of juvenile Lenok (Brachymystax lenok). Aquaculture 2019, 504, 107–113. [Google Scholar] [CrossRef]
- Jia, R.; Wang, L.; Hou, Y.; Feng, W.; Li, B.; Zhu, J. Effects of Stocking Density on the Growth Performance, Physiological Parameters, Redox Status and Lipid Metabolism of Micropterus salmoides in Integrated Rice-Fish Farming Systems. Antioxidants 2022, 11, 1215. [Google Scholar] [CrossRef]
- Li, D.; Miao, J.; Pan, L.; Zhou, Y.; Gao, Z.; Bi, Y.; Tang, J. Integrated lipidomics and transcriptomics analysis reveal lipid metabolism disturbance in scallop (Chlamys farreri) exposure to benzo[a]pyrene. Chemosphere 2023, 331, 138787. [Google Scholar] [CrossRef]
- Liu, H.; Tian, X.; Gong, X.; Han, D.; Ren, L.; Cui, Y.; Jiang, F.; Zhao, J.; Chen, J.; Jiang, L.; et al. Analyzing toxicological effects of AsIII and AsV to Chlamys farreri by integrating transcriptomic and metabolomic approaches. Mar. Pollut. Bull. 2023, 186, 114385. [Google Scholar] [CrossRef]
- Yang, E.-J.; Amenyogbe, E.; Zhang, J.-D.; Wang, W.-Z.; Huang, J.-S.; Chen, G. Integrated transcriptomics and metabolomics analysis of the intestine of cobia (Rachycentron canadum) under hypoxia stress. Aquac. Rep. 2022, 25, 101261. [Google Scholar] [CrossRef]
- Blüthgen, N.; Meili, N.; Chew, G.; Odermatt, A.; Fent, K. Accumulation and effects of the UV-filter octocrylene in adult and embryonic zebrafish (Danio rerio). Sci. Total Environ. 2014, 476–477, 207–217. [Google Scholar] [CrossRef] [PubMed]
- Zhu, X.W.; Hao, R.J.; Tian, C.X.; Zhang, J.P.; Zhu, C.H.; Li, G.L. Integrative Transcriptomics and Metabolomics Analysis of Body Color Formation in the Leopard Coral Grouper (Plectropomus leopardus). Front. Mar. Sci. 2021, 8, 726102. [Google Scholar] [CrossRef]
- Xu, Y.; Li, X.G.; Deng, Y.F.; Lu, Q.P.; Yang, Y.J.; Pan, J.L.; Ge, J.C.; Xu, Z.Q. Comparative transcriptome sequencing of the hepatopancreas reveals differentially expressed genes in the precocious juvenile Chinese mitten crab, Eriocheir sinensis (Crustacea: Decapoda). Aquac. Res. 2017, 48, 3645–3656. [Google Scholar] [CrossRef]
- Zhang, Y.T.; Chen, R.; Wang, F.; Huang, Z.; He, S.; Chen, J.; Mu, J. Potential involvement of the microbiota-gut-brain axis in the neurotoxicity of triphenyl phosphate (TPhP) in the marine medaka (Oryzias melastigma) larvae. Sci. Total Environ. 2022, 817, 152945. [Google Scholar] [CrossRef]
- Fan, Q.X.; Shi, K.P.; Zhan, M.; Xu, Q.; Liu, X.B.; Li, Z.J.; Liu, H.N.; Xia, Y.T.; Chen, Y.D.; Shi, X.Y.; et al. Acute damage from the degradation of Ulva prolifera on the environmental microbiota, intestinal microbiota and transcriptome of Japanese flounder Paralichthys olivaceus. Environ. Pollut. 2022, 302, 119022. [Google Scholar] [CrossRef]
- Xiong, N.X.; Kuang, X.Y.; Fang, Z.X.; Ou, J.; Li, S.Y.; Zhao, J.H.; Huang, J.F.; Li, K.X.; Wang, R.; Fan, L.F.; et al. Transcriptome analysis and co-expression network reveal the mechanism linking mitochondrial function to immune regulation in red crucian carp (Carassius auratus red var) after Aeromonas hydrophila challenge. J. Fish Dis. 2022, 45, 1491–1509. [Google Scholar] [CrossRef]
- Ouyang, P.; Feng, Y.; Xiong, G.; Liu, R.; Fan, W.; Wang, K.; Geng, Y.; Huang, X.; Chen, D.; Yang, S.; et al. Potential mechanism of the PDE-cAMP-related network action on hepatopancreatic necrosis syndrome of Chinese mitten crab (Eriocheir sinensis). Aquaculture 2021, 531, 735982. [Google Scholar] [CrossRef]
- Kong, Y.; Li, M.; Xia, C.; Liu, X.; Wang, G. A novel model construction of lithocholic acid-induced cholestasis and transcriptome analysis in snakehead fish (Channa argus). Aquaculture 2021, 543, 737014. [Google Scholar] [CrossRef]
- Jin, G.X.; Zhang, L.; Mai, K.S.; Chen, X.R.; Xu, S.D.; Ai, Q.H. Effects of different dietary lipid sources on growth performance, hepatic lipid deposition and transcriptome response in spotted sea bass (Lateolabrax maculatus). Aquaculture 2023, 566, 739143. [Google Scholar] [CrossRef]
- Huang, W.L.; Shi, X.L.; Chen, Y.Q.; Zhang, Q.; Peng, J.J.; Zheng, S.K.; Wu, K.S. Comparative pharyngeal cartilage developmental toxicity of bisphenol A, bisphenol S and bisphenol AF to zebrafish (Danio rerio) larvae: A combination of morphometry and global transcriptome analyses. Sci. Total Environ. 2023, 868, 161702. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.-C.; Liu, G.-H.; Xu, Y.-H.; Zhao, T.; Zheng, H.; Tan, X.-Y. Physiological and transcriptomic analyses reveal the toxicological mechanism and risk assessment of environmentally-relevant waterborne tetracycline exposure on the gills of tilapia (Oreochromis niloticus). Sci. Total Environ. 2022, 806, 151290. [Google Scholar] [CrossRef] [PubMed]
- Xiao, Y.; Zhang, Y.-M.; Xu, W.-B.; Chen, D.-Y.; Li, B.-W.; Cheng, Y.-X.; Guo, X.-L.; Dong, W.-R.; Shu, M.-A. The effects of salinities stress on histopathological changes, serum biochemical index, non-specific immune and transcriptome analysis in red swamp crayfish Procambarus clarkii. Sci. Total Environ. 2022, 840, 156502. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Zhang, P.; Yu, P.; Shang, X.; Lu, Y.; Li, Y. Transcriptome analysis reveals the mechanism of common carp brain injury after exposure to lead. Sci. Total Environ. 2020, 743, 140796. [Google Scholar] [CrossRef]
- Szollosi, R.; Varga, I.S. Total antioxidant power in some species of Labiatae (Adaptation of FRAP method). Acta Biol. Szeged. 2002, 46, 125–127. [Google Scholar]
- Peskin, A.V.; Winterbourn, C.C. A microtiter plate assay for superoxide dismutase using a water-soluble tetrazolium salt (WST-1). Clin. Chim. Acta 2000, 293, 157–166. [Google Scholar] [CrossRef] [PubMed]
- Ohkawa, H.; Wakatsuki, A.; Kaneda, C. Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal. Biochem. 1979, 95, 351–358. [Google Scholar] [CrossRef]
- Anderson, M.E. Determination of glutathione and glutathione disulfide in biological samples. Methods Enzymol. 1985, 113, 548–555. [Google Scholar]
- Matthews, R. Methods of Enzymatic Analysis. J. Clin. Pathol. 1987, 40, 934. [Google Scholar] [CrossRef]
- Smith, P.K.; Krohn, R.I.; Hermanson, G.T. Measurement of protein using bicinchoninic acid. Anal. Biochem. 1985, 150, 76–85. [Google Scholar] [CrossRef]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef] [PubMed]
- Grabherr, M.G.; Haas, B.J.; Yassour, M.; Levin, J.Z.; Thompson, D.A.; Amit, I.; Adiconis, X.; Fan, L.; Raychowdhury, R.; Zeng, Q. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat. Biotechnol. 2011, 29, 644–652. [Google Scholar] [CrossRef] [PubMed]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.; Schmittgen, T. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Samples | Raw Reads | Clean Reads | Q20 (%) | Q30 (%) | GC (%) | Total Mapping Ratio (%) |
---|---|---|---|---|---|---|
LD-1 | 42,902,116 | 42,656,312 (99.43%) | 97.56% | 93.09% | 41.17% | 90.45% |
LD-2 | 47,083,210 | 46,816,068 (99.43%) | 97.89% | 93.87% | 41.33% | 91.42% |
LD-3 | 42,388,836 | 41,955,622 (98.98%) | 97.45% | 92.75% | 40.67% | 93.92% |
HD-1 | 42,661,940 | 42,553,024 (99.74%) | 97.73% | 93.28% | 38.01% | 94.14% |
HD-2 | 43,082,230 | 42,968,088 (99.74%) | 97.69% | 93.18% | 37.27% | 95.16% |
HD-3 | 39,407,166 | 39,311,670 (99.76%) | 97.84% | 93.50% | 37.44% | 94.97% |
Gene | Primer Sequence (5′-3′) | Efficiency (%) |
---|---|---|
ras-related protein Rab-7A (rab7a) | F: TTTGGGATACAGCCGGTCAA R: CTCGCTTTGTTGATACCGCC | 98.7 |
ras-like GTP-binding protein (rho1) | F: TGATAGACTGCGACCCCTCT R: ACTGGCTCTTGTTTCATCTTCTGA | 99.2 |
ras-related protein Rab-11A-like protein (rab11a) | F: GTCAGCAGTAGGGAGAGAGC R: TTGTTGGAGGAAGATCCGCTA | 98.6 |
sorting nexin-12 (snx12) | F: GCCTCGTCTCCAAGAAACAA R: AACCACAATCTTGCTGTCCCT | 99.1 |
casein kinase II subunit alpha (csnk2a1) | F: ATAGATTGGGGGTTGGCGGA R: TGAAGTATCTGGAGGCCACTCT | 98.9 |
β-actin | F: ATCACTGCTCTGGCTCCTGCTACC R: CGGACTCGTCGTACTCCTCCTTGG | 98.7 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jia, R.; Dong, Y.; Hou, Y.; Feng, W.; Li, B.; Zhu, J. Transcriptome Analysis Reveals the Effect of Stocking Density on Energy Metabolism in the Gills of Cherax quadricarinatus under Rice-Crayfish Co-Culture. Int. J. Mol. Sci. 2023, 24, 11345. https://doi.org/10.3390/ijms241411345
Jia R, Dong Y, Hou Y, Feng W, Li B, Zhu J. Transcriptome Analysis Reveals the Effect of Stocking Density on Energy Metabolism in the Gills of Cherax quadricarinatus under Rice-Crayfish Co-Culture. International Journal of Molecular Sciences. 2023; 24(14):11345. https://doi.org/10.3390/ijms241411345
Chicago/Turabian StyleJia, Rui, Yin Dong, Yiran Hou, Wenrong Feng, Bing Li, and Jian Zhu. 2023. "Transcriptome Analysis Reveals the Effect of Stocking Density on Energy Metabolism in the Gills of Cherax quadricarinatus under Rice-Crayfish Co-Culture" International Journal of Molecular Sciences 24, no. 14: 11345. https://doi.org/10.3390/ijms241411345
APA StyleJia, R., Dong, Y., Hou, Y., Feng, W., Li, B., & Zhu, J. (2023). Transcriptome Analysis Reveals the Effect of Stocking Density on Energy Metabolism in the Gills of Cherax quadricarinatus under Rice-Crayfish Co-Culture. International Journal of Molecular Sciences, 24(14), 11345. https://doi.org/10.3390/ijms241411345