The Host E3-Ubiquitin Ligase TRIM28 Impedes Viral Protein GP4 Ubiquitination and Promotes PRRSV Replication
Abstract
1. Introduction
2. Results
2.1. TRIM28 Is Induced by PRRSV Infection
2.2. TRIM28 Overexpression Facilitates PRRSV Replication
2.3. TRIM28 Knockdown Inhibits PRRSV Replication
2.4. TRIM28 Targets PRRSV GP4
2.5. TRIM28 Inhibits the Degradation of PRRSV GP4 by Impeding Its Ubiquitination
3. Discussion
4. Materials and Methods
4.1. Cells and Virus Strain
4.2. Virus Infection
4.3. Antibodies and Reagents
4.4. Expression Vector Construction and Plasmid Transfection
4.5. RNA Interference
4.6. RNA Isolation and RT-qPCRs
4.7. Western Blotting
4.8. Immunofluorescence Assay (IFA)
4.9. Co-Immunoprecipitation (Co-IP)
4.10. Ubiquitination Assays
4.11. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Lunney, J.K.; Fang, Y.; Ladinig, A.; Chen, N.; Li, Y.; Rowland, B.; Renukaradhya, G.J. Porcine Reproductive and Respiratory Syndrome Virus (PRRSV): Pathogenesis and Interaction with the Immune System. Annu. Rev. Anim. Biosci. 2016, 4, 129–154. [Google Scholar] [CrossRef] [PubMed]
- Walker, P.J.; Siddell, S.G.; Lefkowitz, E.J.; Mushegian, A.R.; Adriaenssens, E.M.; Alfenas-Zerbini, P.; Davison, A.J.; Dempsey, D.M.; Dutilh, B.E.; Garcia, M.L.; et al. Changes to virus taxonomy and to the International Code of Virus Classification and Nomenclature ratified by the International Committee on Taxonomy of Viruses (2021). Arch. Virol. 2021, 166, 2633–2648. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Tas, A.; Sun, Z.; Snijder, E.J.; Fang, Y. Proteolytic processing of the porcine reproductive and respiratory syndrome virus replicase. Virus Res. 2015, 202, 48–59. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Treffers, E.E.; Napthine, S.; Tas, A.; Zhu, L.; Sun, Z.; Bell, S.; Mark, B.L.; van Veelen, P.A.; van Hemert, M.J.; et al. Transactivation of programmed ribosomal frameshifting by a viral protein. Proc. Natl. Acad. Sci. USA 2014, 111, E2172–E2181. [Google Scholar] [CrossRef] [PubMed]
- Meulenberg, J.J.; van Nieuwstadt, A.P.; van Essen-Zandbergen, A.; Langeveld, J.P. Posttranslational processing and identification of a neutralization domain of the GP4 protein encoded by ORF4 of Lelystad virus. J. Virol. 1997, 71, 6061–6067. [Google Scholar] [CrossRef] [PubMed]
- Costers, S.; Vanhee, M.; Van Breedam, W.; Van Doorsselaere, J.; Geldhof, M.; Nauwynck, H.J. GP4-specific neutralizing antibodies might be a driving force in PRRSV evolution. Virus Res. 2010, 154, 104–113. [Google Scholar] [CrossRef] [PubMed]
- Kimpston-Burkgren, K.; Correas, I.; Osorio, F.A.; Steffen, D.; Pattnaik, A.K.; Fang, Y.; Vu, H.L.X. Relative contribution of porcine reproductive and respiratory syndrome virus open reading frames 2-4 to the induction of protective immunity. Vaccine 2017, 35, 4408–4413. [Google Scholar] [CrossRef]
- An, C.H.; Nazki, S.; Park, S.C.; Jeong, Y.J.; Lee, J.H.; Park, S.J.; Khatun, A.; Kim, W.I.; Park, Y.I.; Jeong, J.C.; et al. Plant synthetic GP4 and GP5 proteins from porcine reproductive and respiratory syndrome virus elicit immune responses in pigs. Planta 2018, 247, 973–985. [Google Scholar] [CrossRef]
- Du, Y.; Pattnaik, A.K.; Song, C.; Yoo, D.; Li, G. Glycosyl-phosphatidylinositol (GPI)-anchored membrane association of the porcine reproductive and respiratory syndrome virus GP4 glycoprotein and its co-localization with CD163 in lipid rafts. Virology 2012, 424, 18–32. [Google Scholar] [CrossRef]
- Das, P.B.; Dinh, P.X.; Ansari, I.H.; de Lima, M.; Osorio, F.A.; Pattnaik, A.K. The minor envelope glycoproteins GP2a and GP4 of porcine reproductive and respiratory syndrome virus interact with the receptor CD163. J. Virol. 2010, 84, 1731–1740. [Google Scholar] [CrossRef]
- Hage, A.; Rajsbaum, R. To TRIM or not to TRIM: The balance of host-virus interactions mediated by the ubiquitin system. J. Gen. Virol. 2019, 100, 1641–1662. [Google Scholar] [CrossRef]
- Mandell, M.A.; Jain, A.; Arko-Mensah, J.; Chauhan, S.; Kimura, T.; Dinkins, C.; Silvestri, G.; Munch, J.; Kirchhoff, F.; Simonsen, A.; et al. TRIM proteins regulate autophagy and can target autophagic substrates by direct recognition. Dev. Cell. 2014, 30, 394–409. [Google Scholar] [CrossRef]
- Sparrer, K.M.J.; Gack, M.U. TRIM proteins: New players in virus-induced autophagy. PLoS Pathog. 2018, 14, e1006787. [Google Scholar] [CrossRef]
- Khan, R.; Khan, A.; Ali, A.; Idrees, M. The interplay between viruses and TRIM family proteins. Rev. Med. Virol. 2019, 29, e2028. [Google Scholar] [CrossRef]
- Versteeg, G.A.; Rajsbaum, R.; Sanchez-Aparicio, M.T.; Maestre, A.M.; Valdiviezo, J.; Shi, M.; Inn, K.S.; Fernandez-Sesma, A.; Jung, J.; Garcia-Sastre, A. The E3-ligase TRIM family of proteins regulates signaling pathways triggered by innate immune pattern-recognition receptors. Immunity. 2013, 38, 384–398. [Google Scholar] [CrossRef]
- van Tol, S.; Hage, A.; Giraldo, M.I.; Bharaj, P.; Rajsbaum, R. The TRIMendous Role of TRIMs in Virus-Host Interactions. Vaccines 2017, 5, 23. [Google Scholar] [CrossRef]
- Bharaj, P.; Atkins, C.; Luthra, P.; Giraldo, M.I.; Dawes, B.E.; Miorin, L.; Johnson, J.R.; Krogan, N.J.; Basler, C.F.; Freiberg, A.N.; et al. The Host E3-Ubiquitin Ligase TRIM6 Ubiquitinates the Ebola Virus VP35 Protein and Promotes Virus Replication. J. Virol. 2017, 91, e00833-17. [Google Scholar] [CrossRef]
- Giraldo, M.I.; Xia, H.; Aguilera-Aguirre, L.; Hage, A.; van Tol, S.; Shan, C.; Xie, X.; Sturdevant, G.L.; Robertson, S.J.; McNally, K.L.; et al. Envelope protein ubiquitination drives entry and pathogenesis of Zika virus. Nature. 2020, 585, 414–419. [Google Scholar] [CrossRef]
- Ivanov, A.V.; Peng, H.; Yurchenko, V.; Yap, K.L.; Negorev, D.G.; Schultz, D.C.; Psulkowski, E.; Fredericks, W.J.; White, D.E.; Maul, G.G.; et al. PHD domain-mediated E3 ligase activity directs intramolecular sumoylation of an adjacent bromodomain required for gene silencing. Mol. Cell. 2007, 28, 823–837. [Google Scholar] [CrossRef]
- McAvera, R.M.; Crawford, L.J. TIF1 Proteins in Genome Stability and Cancer. Cancers 2020, 12, 2094. [Google Scholar] [CrossRef]
- Bacon, C.W.; Challa, A.; Hyder, U.; Shukla, A.; Borkar, A.N.; Bayo, J.; Liu, J.; Wu, S.Y.; Chiang, C.M.; Kutateladze, T.G.; et al. KAP1 Is a Chromatin Reader that Couples Steps of RNA Polymerase II Transcription to Sustain Oncogenic Programs. Mol. Cell. 2020, 78, 1133–1151.e14. [Google Scholar] [CrossRef] [PubMed]
- Randolph, K.; Hyder, U.; D’Orso, I. KAP1/TRIM28: Transcriptional Activator and/or Repressor of Viral and Cellular Programs? Front. Cell Infect Microbiol. 2022, 12, 834636. [Google Scholar] [CrossRef] [PubMed]
- Laurent-Rolle, M.; Morrison, J.; Rajsbaum, R.; Macleod, J.M.L.; Pisanelli, G.; Pham, A.; Ayllon, J.; Miorin, L.; Martinez, C.; tenOever, B.R.; et al. The interferon signaling antagonist function of yellow fever virus NS5 protein is activated by type I interferon. Cell Host Microbe. 2014, 16, 314–327. [Google Scholar] [CrossRef] [PubMed]
- Burck, C.; Mund, A.; Berscheminski, J.; Kieweg, L.; Muncheberg, S.; Dobner, T.; Schreiner, S. KAP1 Is a Host Restriction Factor That Promotes Human Adenovirus E1B-55K SUMO Modification. J. Virol. 2016, 90, 930–946. [Google Scholar] [CrossRef] [PubMed]
- Hale, B.G. Antiviral immunity triggered by infection-induced host transposable elements. Curr. Opin. Virol. 2022, 52, 211–216. [Google Scholar] [CrossRef]
- Rauwel, B.; Jang, S.M.; Cassano, M.; Kapopoulou, A.; Barde, I.; Trono, D. Release of human cytomegalovirus from latency by a KAP1/TRIM28 phosphorylation switch. Elife 2015, 4, e06068. [Google Scholar] [CrossRef]
- Sun, R.; Liang, D.; Gao, Y.; Lan, K. Kaposi’s sarcoma-associated herpesvirus-encoded LANA interacts with host KAP1 to facilitate establishment of viral latency. J. Virol. 2014, 88, 7331–7344. [Google Scholar] [CrossRef]
- Siebels, S.; Czech-Sioli, M.; Spohn, M.; Schmidt, C.; Theiss, J.; Indenbirken, D.; Gunther, T.; Grundhoff, A.; Fischer, N. Merkel Cell Polyomavirus DNA Replication Induces Senescence in Human Dermal Fibroblasts in a Kap1/Trim28-Dependent Manner. mBio. 2020, 11, e00142-20. [Google Scholar] [CrossRef]
- Iyengar, S.; Farnham, P.J. KAP1 protein: An enigmatic master regulator of the genome. J. Biol. Chem. 2011, 286, 26267–26276. [Google Scholar] [CrossRef]
- Imbeault, M.; Helleboid, P.Y.; Trono, D. KRAB zinc-finger proteins contribute to the evolution of gene regulatory networks. Nature. 2017, 543, 550–554. [Google Scholar] [CrossRef]
- Zhang, L.; Zhu, C.; Guo, Y.; Wei, F.; Lu, J.; Qin, J.; Banerjee, S.; Wang, J.; Shang, H.; Verma, S.C.; et al. Inhibition of KAP1 enhances hypoxia-induced Kaposi’s sarcoma-associated herpesvirus reactivation through RBP-Jkappa. J. Virol. 2014, 88, 6873–6884. [Google Scholar] [CrossRef]
- Li, X.; Burton, E.M.; Bhaduri-McIntosh, S. Chloroquine triggers Epstein-Barr virus replication through phosphorylation of KAP1/TRIM28 in Burkitt lymphoma cells. PLoS Pathog. 2017, 13, e1006249. [Google Scholar] [CrossRef]
- Allouch, A.; Di Primio, C.; Alpi, E.; Lusic, M.; Arosio, D.; Giacca, M.; Cereseto, A. The TRIM family protein KAP1 inhibits HIV-1 integration. Cell Host Microbe 2011, 9, 484–495. [Google Scholar] [CrossRef]
- Nishitsuji, H.; Abe, M.; Sawada, R.; Takaku, H. ZBRK1 represses HIV-1 LTR-mediated transcription. FEBS. Lett. 2012, 586, 3562–3568. [Google Scholar] [CrossRef]
- Nishitsuji, H.; Sawada, L.; Sugiyama, R.; Takaku, H. ZNF10 inhibits HIV-1 LTR activity through interaction with NF-kappaB and Sp1 binding motifs. FEBS. Lett. 2015, 589, 2019–2025. [Google Scholar] [CrossRef]
- Yuan, P.; Yan, J.; Wang, S.; Guo, Y.; Xi, X.; Han, S.; Yin, J.; Peng, B.; He, X.; Bodem, J.; et al. Trim28 acts as restriction factor of prototype foamy virus replication by modulating H3K9me3 marks and destabilizing the viral transactivator Tas. Retrovirology. 2021, 18, 38. [Google Scholar] [CrossRef]
- Yang, Y.; Fiskus, W.; Yong, B.; Atadja, P.; Takahashi, Y.; Pandita, T.K.; Wang, H.G.; Bhalla, K.N. Acetylated hsp70 and KAP1-mediated Vps34 SUMOylation is required for autophagosome creation in autophagy. Proc. Natl. Acad. Sci. USA 2013, 110, 6841–6846. [Google Scholar] [CrossRef]
- Li, M.; Xu, X.; Chang, C.W.; Liu, Y. TRIM28 functions as the SUMO E3 ligase for PCNA in prevention of transcription induced DNA breaks. Proc. Natl. Acad. Sci. USA 2020, 117, 23588–23596. [Google Scholar] [CrossRef]
- Liang, Q.; Deng, H.; Li, X.; Wu, X.; Tang, Q.; Chang, T.H.; Peng, H.; Rauscher, F.J., 3rd; Ozato, K.; Zhu, F. Tripartite motif-containing protein 28 is a small ubiquitin-related modifier E3 ligase and negative regulator of IFN regulatory factor 7. J. Immunol. 2011, 187, 4754–4763. [Google Scholar] [CrossRef]
- Rossitto, M.; Dejardin, S.; Rands, C.M.; Le Gras, S.; Migale, R.; Rafiee, M.R.; Neirijnck, Y.; Pruvost, A.; Nguyen, A.L.; Bossis, G.; et al. TRIM28-dependent SUMOylation protects the adult ovary from activation of the testicular pathway. Nat. Commun. 2022, 13, 4412. [Google Scholar] [CrossRef]
- Qin, Y.; Li, Q.; Liang, W.; Yan, R.; Tong, L.; Jia, M.; Zhao, C.; Zhao, W. TRIM28 SUMOylates and stabilizes NLRP3 to facilitate inflammasome activation. Nat. Commun. 2021, 12, 4794. [Google Scholar] [CrossRef] [PubMed]
- Burkard, C.; Opriessnig, T.; Mileham, A.J.; Stadejek, T.; Ait-Ali, T.; Lillico, S.G.; Whitelaw, C.B.A.; Archibald, A.L. Pigs Lacking the Scavenger Receptor Cysteine-Rich Domain 5 of CD163 Are Resistant to Porcine Reproductive and Respiratory Syndrome Virus 1 Infection. J. Virol. 2018, 92, e00415-18. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Li, W.; Sun, Y.; Kong, L.; Xu, P.; Xia, P.; Zhang, G. Antibody-Mediated Porcine Reproductive and Respiratory Syndrome Virus Infection Downregulates the Production of Interferon-alpha and Tumor Necrosis Factor-alpha in Porcine Alveolar Macrophages via Fc Gamma Receptor I and III. Viruses 2020, 12, 187. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Sun, Y.; Zhao, S.; Cui, Z.; Chen, Y.; Xu, P.; Chen, J.; Zhang, Y.; Xia, P. Differences in Humoral Immune Response against the Type 2 Porcine Reproductive and Respiratory Syndrome Virus via Different Immune Pathways. Viruses 2022, 14, 1435. [Google Scholar] [CrossRef]
Primer Name | Sequence (5′–3′) | Purpose |
---|---|---|
Flag/Myc/HA-TRIM28-For | CAAGCTTATGGCGGCCTCGGCG | Protein expression |
Flag/Myc/HA-TRIM28-Rev | GGAATTCTTATCAGGGGCCATCACCAGGG | |
TRIM28-RING-For | CCATGGAGGCCCGAATTCGGATGGCGGCCTCGGCGGCG | |
TRIM28-RING-Rev | GCCGCGGTACCTCGAGTTATTGCTTGCACACGGGACAG | |
TRIM28-BBOX + CC-For | GGAATTCGGATGCAGTGCTTCTCCAAAGACATCG | |
TRIM28-BBOX + CC-Rev | CCTCGAGTTAGGTGGCACTGTCATCCAGGGTT | |
TRIM28-PHD + BR-For | GGAATTCGGATGATTTGCCGTGTCTGCCAGAAG | |
TRIM28-PHD + BR-Rev | CCTCGAGTTATCAGGGGCCATCACCAGGG | |
Swine-TRIM28-For | CAGTGCGAGTTCTGCTTCC | RT-qPCR |
Swine-TRIM28-Rev | TGCTGTCTCCACCGTCAA | |
Swine-β-actin-For | CGGGACATCAAGGAGAAGC | [43] |
Swine-β-actin- Rev | CTCGTTGCCGATGGTGATG | |
Monkey-TRIM28-For | GAGCCTCTGTGTGAGACCTGTG | |
Monkey-TRIM28-Rev | CAAAACAGCACAAGGGGTT | |
Monkey-β-actin-For | GGCACCACACCTTCTACAAT | |
Monkey-β-actin- Rev | AACATGATCTGGGTCATCTTCTC | |
PRRSV-ORF7-For | AAACCAGTCCAGAGGCAAGG | [44] |
PRRSV-ORF7-Rev | GCAAACTAAACTCCACAGTGTAA |
siRNA | Sequence (5′–3′) |
---|---|
NC-For | UUCUCCGAACGUGUCACGUTT |
NC-Rev | ACGUGACACGUUCGGAGAATT |
siRNA-1-For | CACUAGCUGUGAGGAUAAUTT |
siRNA-1-Rev | AUUAUCCUCACAGCUAGUGTT |
siRNA-2-For | GGCGAGAUGAAGUUUCAGUTT |
siRNA-2-Rev | ACUGAAACUUCAUCUCGCCTT |
siRNA-3-For | CUGAGGACUACAACCUUAUTT |
siRNA-3-Rev | AUAAGGUUGUAGUCCUCAGTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cui, Z.; Zhou, L.; Zhao, S.; Li, W.; Li, J.; Chen, J.; Zhang, Y.; Xia, P. The Host E3-Ubiquitin Ligase TRIM28 Impedes Viral Protein GP4 Ubiquitination and Promotes PRRSV Replication. Int. J. Mol. Sci. 2023, 24, 10965. https://doi.org/10.3390/ijms241310965
Cui Z, Zhou L, Zhao S, Li W, Li J, Chen J, Zhang Y, Xia P. The Host E3-Ubiquitin Ligase TRIM28 Impedes Viral Protein GP4 Ubiquitination and Promotes PRRSV Replication. International Journal of Molecular Sciences. 2023; 24(13):10965. https://doi.org/10.3390/ijms241310965
Chicago/Turabian StyleCui, Zhiying, Likun Zhou, Shijie Zhao, Wen Li, Jiahui Li, Jing Chen, Yina Zhang, and Pingan Xia. 2023. "The Host E3-Ubiquitin Ligase TRIM28 Impedes Viral Protein GP4 Ubiquitination and Promotes PRRSV Replication" International Journal of Molecular Sciences 24, no. 13: 10965. https://doi.org/10.3390/ijms241310965
APA StyleCui, Z., Zhou, L., Zhao, S., Li, W., Li, J., Chen, J., Zhang, Y., & Xia, P. (2023). The Host E3-Ubiquitin Ligase TRIM28 Impedes Viral Protein GP4 Ubiquitination and Promotes PRRSV Replication. International Journal of Molecular Sciences, 24(13), 10965. https://doi.org/10.3390/ijms241310965