Next Article in Journal
Glass Fiber Reinforced Epoxy-Amine Thermosets and Solvate IL: Towards New Composite Polymer Electrolytes for Lithium Battery Applications
Previous Article in Journal
Endothelial Dysfunction in Diabetes Mellitus: New Insights
Previous Article in Special Issue
Phytochemical, Morphological, and Physiological Variation in Different Ajowan (Trachyspermum ammi L.) Populations as Affected by Salt Stress, Genotype × Year Interaction and Pollination System
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Simultaneous Application of Red and Blue Light Regulate Carbon and Nitrogen Metabolism, Induces Antioxidant Defense System and Promote Growth in Rice Seedlings under Low Light Stress

1
College of Agronomy, Hunan Agricultural University, Changsha 410128, China
2
College of Horticulture, Shanxi Agricultural University, Taigu 030801, China
3
College of Agronomy, Henan Agricultural University, Zhengzhou 450046, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Int. J. Mol. Sci. 2023, 24(13), 10706; https://doi.org/10.3390/ijms241310706
Submission received: 19 May 2023 / Revised: 23 June 2023 / Accepted: 26 June 2023 / Published: 27 June 2023
(This article belongs to the Special Issue Response to Environmental Stress in Plants)

Abstract

The purpose of this study is to determine the effect of light quality on growth, carbon and nitrogen metabolism, and antioxidant defense system of rice seedlings. Six light conditions were employed, including white (W), red (R), blue (B), combined LED of R and B at 3:1 (R3B1), combined LED of R and B at 1:1 (R1B1), as well as combined LED of R and B at 1:3 (R1B3). Combined application of red light and blue light could promote the growth of rice seedling leaves and roots under low light stress to varying degrees, increase the photosynthetic area by increasing the leaf area, improve the root characteristics by increasing the root volume, and increase the dry matter accumulation of rice seedlings. In addition, the combination of red light and blue light could increase carbon and nitrogen metabolites in rice seedling leaves, regulate the expression of genes related to carbon and nitrogen metabolism and enzyme activity, and enhance the antioxidant enzyme activity of rice seedlings. These results indicate that red light and blue light directly have synergistic effects which can regulate the carbon and nitrogen metabolism of rice seedlings, promote the morphogenesis of rice seedlings under low light stress, and promote growth, which has never been reported in previous studies. This study is a new discovery in the application of light quality in crop production and provides new avenues to enhance crop stress resistance. However, further study is needed to explore the physio-biochemical and molecular mechanisms of light quality in crop production.

1. Introduction

Rice (Oryza sativa L.) is the most important crop in the world and the staple food for more than half of the population. The middle and lower reaches of the Yangtze River are the main rice-producing areas in China. However, in recent years, sunshine duration and total radiation in the middle and lower reaches of the Yangtze River have been decreasing, and the frequency of occurrence of extreme rainy weather has increased significantly, which has a great impact on rice production [1,2]. In particular, early rice in the middle and lower reaches of the Yangtze River was susceptible to low temperature rainy weather such as “late spring coldness”, which resulted in low light stress of rice seedling growth [3].
Generally, light is an essential environmental factor for crop growth and has a very important effect on crop growth, yield, and quality [4,5,6]. Low light stress often results in carbon and nitrogen metabolism disorders and disruption of nutrient transport, growth inhibition, and other biochemical and physiological processes. These effects lead to seedling emaciation, low rates of transpiration and photosynthesis, and ultrastructural damage [7,8,9]. This ultimately leads to decreased rice resistance, easy occurrence of disease and insect pests, and decrease yield and quality of the crops [10,11]. It is of great significance for national food security to study the mechanism of low light stress on rice and how to regulate and eliminate the adverse effects of low light stress on rice growth.
The photoenvironment is an important ecological environmental factors for crop growth and development that mainly affects crop growth and development through photoperiod, optical density, light distribution, and light quality [12,13]. Light quality is an important regulatory factor that affects crop growth and development in the photoenvironment [14]. Light quality is a trigger signal factor which can trigger seed germination, tissue differentiation, and flower bud differentiation [15,16]. Different wavelengths of light carry different levels of energy, which can affect plant growth and development by regulating photoreceptors, transcription factors, and plant hormones [17,18]. Light quality can affect the antioxidant capacity of crops, regulate carbon and nitrogen metabolism, and adapt crops to different abiotic stress environments [19,20]. Red light wavelength is consistent with the peak value of pigment absorption in crop leaves, which can promote cell division and expand cell volume. Blue light can improve photosynthetic capacity per unit leaf area by increasing stomatal opening and quantum yield, and the combination of red and blue light can effectively regulate crop growth. In early rice production in the middle and lower reaches of the Yangtze River, weak seedlings are often caused by low light intensity. Raising seedlings in agricultural facilities requires artificial light to enhance light intensity, and a reasonable combination of effective red light and blue light is necessary to save energy. It is necessary to study the response of rice seedlings to different red and blue light under low light stress. However, little is known about the study of low light stress in plants, especially how light quality enhances low light stress resistance in rice. Therefore, this study aims to investigate the role and mechanism by which light quality regulates rice response to low light stress.
In the present study, two rice varieties, Xiangzaoxian24 (XZX24, conventional indica type rice) and Huazheyou261 (HZY261, hybrid indica type rice), were used as plant materials to study the effects of different light qualities on carbon and nitrogen metabolism and antioxidant defense system under low light stress. The objectives of the present study were to evaluate the influence of different light qualities on the growth of rice seedlings in order to select optimal light proportions of red and blue light to improve seedling quality. The findings not only broaden our understanding of the light-quality-induced low light stress tolerance of rice seedlings, but also shed some light on how light quality regulates the response of rice seedlings to low light stress, thereby improving seedling quality and fostering robust seedlings.

2. Results

2.1. Morphogenesis

Significant variations in morphogenesis were observed between varieties and light quality treatments (Table 1). The plant height and first leaf sheath length of XZX24 and HZY261 showed a trend of rising with the increase in the red light content. Nevertheless, the stem width showed a downwards trend (Table 1). Plant height and first leaf sheath length of XZX24 and HZY261 all had maximum values in R treatment and were significantly higher than other treatments. Compared with W, significant increases of 27.18% and 25.27% (16.46% and 5.41%) in plant height and first leaf sheath length of XZX24 (HZY261) for R treatment were observed. The stem width of XZX24 and HZY261 all had maximum values in B treatment and was significantly higher than W (R). Compared with W, a significant increase of 29.29% (23.26%) in the stem width of XZX24 (HZY261) for B treatment was observed, respectively. The stem widths of XZX24 and HZY261 were higher than W in some of the treatments (R1B1, R1B3). Nevertheless, the stem widths of XZX24 and HZY261 were higher than R in W treatment. The leaf areas of XZX24 and HZY261 had maximum values in R treatment and were as significantly higher than other treatments. Compared with W, a significant increase of 20.18% (4.12%) in the leaf areas of XZX24 (HZY261) for R treatment was observed. The root volumes of XZX24 and HZY261 showed maximum values in R3B1 treatment and were higher than W. Compared with W, a significant increase of 30.98% (43.69%) in the leaf area of XZX24 (HZY261) for R3B1 treatment was observed. The root growth parameters of XZX24 and HZY261 under combined-light (R3B1, R1B1, R1B3) treatment were significantly higher than that of single-light (R, B) treatment. XZX24 and HZY261 also showed higher root growth parameters in R than B.

2.2. Fresh Weight, Dry Weight

The effects of different light qualities on fresh weight of rice seedlings are summarized in Figure 1A, and the fresh weight of XZX24 was better than HZY261 on the whole. The total fresh weights of XZX24 and HZY261 all had maximum values in R3B1 treatment and were significantly higher than other treatments. Compared with W, a significant increase of 32.04% (24.99%) in the total fresh weight of XZX24 (HZY261) for R3B1 treatment was observed (Figure 1A). The total fresh weight of XZX24 and HZY261 under combined-light (R3B1, R1B1, R1B3) treatment was significantly higher than that of the B treatment. XZX24 and HZY261 also showed higher total fresh weight in R than B.
Significant variations in dry weight were observed between varieties and light quality treatments (Figure 1B). The total dry weight of XZX24 and HZY261 all had maximum values in R3B1 treatment and were higher than in other treatments. Compared with W, a significant increase of 33.03% (45.21%) in the total dry weight of XZX24 (HZY261) for R3B1 treatment was observed (Figure 1B), respectively. The dry weight of XZX24 and HZY261 under combined-light (R3B1, R1B1, R1B3) treatment was higher than that of the B treatment. XZX24 and HZY261 also showed higher dry weight in R than B.

2.3. Antioxidant Enzyme Activities, MDA Content

Data of the rice seedlings antioxidant enzyme activities (SOD activity, POD activity, CAT activity) along with MDA content are presented in Figure 2. SOD activity, POD activity, and CAT activity of rice seedlings all had maximum values in the R3B1 treatment and were significantly higher than the single-light (R, B) treatment and W treatment. Compared with W, significant increases of 8.29%, 17.71%, and 10.07% (25.65%, 68.33%, and 10.27%), respectively, in SOD activity, POD activity, and CAT activity of XZX24 (HZY261) for R3B1 treatment were observed (Figure 2A–C). In addition, the SOD activity, POD activity, and CAT activity of rice seedlings treated by the combined-light (R3B1, R1B1, R1B3) treatment were higher than that of the single-light (R, B) treatment, and XZX24 and HZY261 also showed higher antioxidant enzyme activities in R than B. The MDA content of rice seedlings all had maximum values in the B treatment and was significantly higher than in other treatments. Compared with W, an increase of 16.59% (22.06%) in MDA content of XZX24 (HZY261) for the B treatment was observed. In addition, the MDA content of rice seedlings treated by the combined-light (R3B1, R1B1, R1B3) treatment was lower than the single-light (R, B) treatment. It can be clearly deduced that a red and blue combination improved seedling antioxidant enzyme activities in the rice plants. At the same time, the combined application of R3B1 treatment was better.

2.4. Carbon Metabolite

The changes in carbon metabolites of the two rice varieties’ (XZX24 and HZY261) rice seedlings under light quality treatments regarding fructose, sucrose, soluble sugar, and starch are shown in Figure 3. The carbon metabolites (fructose, sucrose, soluble sugar, and starch) of rice seedlings all had maximum values in the R3B1 treatment. Compared with W, significant increases of 8.47%, 10.50%, 40.52%, and 13.86% (18.07%, 2.60%, 6.83%, and 13.91%), respectively, in fructose, sucrose, soluble sugar, and starch of XZX24 (HZY261) for R3B1 treatment were observed (Figure 3A–D). In addition, the carbon metabolites (fructose, sucrose, soluble sugar, and starch) of rice seedlings treated by the combined-light (R3B1, R1B1, R1B3) treatment were higher than the single-light (R, B) treatment, except for the sucrose content of HZY261. XZX24 and HZY261 also showed higher carbon metabolites in R than B. Compared with B, increases of 20.32%, 14.51%, 12.68%, and 15.56% (12.90%, 8.38%, 14.36%, and 6.45%), respectively, in fructose, sucrose, soluble sugar, and starch of XZX24 (HZY261) for R treatment were observed.

2.5. Soluble Acid Invertase (SAI), Neutral Invertase (NI), Sucrose Synthase (SS), Sucrose Phosphate Synthase (SPS)

The SAI of rice seedlings all had maximum values in W treatment (Figure 4A). The SAIs of rice seedlings treated by the combined-light (R3B1, R1B1, R1B3) treatment were higher than the single-light (R, B) treatment, but lower than that of W treatment. XZX24 also showed higher SAI in R than B. Nevertheless, HZY261 also showed higher SAI in B than R, but the differences were not significant. The NI of rice seedlings all had maximum values in R1B3 treatment and was significantly higher than in other treatments. Compared with W treatment, a significant increase of 120.03% (83.87%) in NI of XZX24 (HZY261) for R1B3 treatment was observed (Figure 4B). The NIs of two rice seedling leaves treated with the combined-light (R3B1, R1B1, R1B3) treatment increased with the increase in blue light proportion. In addition, XZX24 and HZY261 also showed higher NIs in B than R.
The SS and SPS of rice seedlings all had maximum values in B treatment (Figure 4C,D). Compared with W, significant increases of 19.51% and 38.11% (13.38% and 37.38%), respectively, in the SS and SPS of XZX24 (HZY261) for B treatment were observed. The SS and SPS of rice seedlings all had maximum values in R3B1 treatment in the combined-light (R3B1, R1B1, R1B3) treatment. Compared with W, significant increases of 7.28% and 19.17% (9.18% and 31.97%), respectively, in the SS and SPS of XZX24 (HZY261) for B treatment were observed. In addition, XZX24 and HZY261 showed higher SS and SPS in B than R, and the difference reached a significant level.

2.6. Key Gene Expression Related to Carbon Metabolism

The changes in key gene expression related to carbon metabolism of the two rice varieties (XZX24 and HZY261) rice seedlings under light quality treatments regarding relative expression level of VIN1, NIN1, SUS1, and SPS1 are shown in Figure 5. Varying degrees of upregulation of VIN1 expression of XZX24 were observed under the R3B1 and R1B1 treatment relative to the W treatment; varying degrees of upregulation of VIN1 expression of HZY261 were observed under the R1B1, R1B3, R3B1, and B treatments relative to the W treatment (Figure 5A). In addition, varying degrees of upregulation of NIN1 expression of XZX24 were observed under the R3B1 and R1B3 treatment relative to the W treatment; varying degrees of upregulation of NIN1 expression of HZY261 were observed under the R1B1 and B treatment relative to the W treatment (Figure 5B). Varying degrees of upregulation of SUS1 expression of XZX24 were observed under the R, R3B1, and R1B3 treatment relative to the W treatment (Figure 5C), and the upregulation of SUS1 expression of HZY261 was observed under the R3B1 treatment. Upregulation of SPS1 expression of XZX24 was observed under the R3B1 treatment relative to the W (Figure 5D). Nevertheless, upregulation of SPS1 expression of HZY261 was observed under the R treatment. Relative to W, VIN1, and NIN1 expressions of XZX24 were downregulated by 98.36% and 6.98%, respectively, under single blue light (B) treatment; however, VIN1 and NIN1 expressions of HZY261 were upregulated by 257.34% and 69.79%. In addition, SUS1 and SPS1 expressions of XZX24 (HZY261) were downregulated by 99.13% and 26.85% (38.00% and 10.42%). Relative to W, VIN1 and NIN1 expressions of XZX24 (HZY261) were downregulated by 99.84% and 52.54% (38.56% and 4.17%) under single red light (R) treatment.

2.7. Nitrogen Metabolite

The nitrogen metabolite (nitrate nitrogen, ammonium nitrogen, free amino acid, and soluble protein) of XZX24 and HZY261 was focused on in Figure 6, and significant variations in the nitrogen metabolite were observed between varieties and light quality treatments. The nitrate nitrogen and ammonium nitrogen of rice seedlings all had maximum values in the W treatment (Figure 6A,B). Nevertheless, the ammonium nitrogen of rice seedlings all had maximum values in the R1B3 treatment in the combined-light (R3B1, R1B1, R1B3) treatment. The ammonium nitrogen of two rice seedling leaves treated with the combined-light (R3B1, R1B1, R1B3) treatment increased with the increase of blue light proportion. In addition, XZX24 and HZY261 showed higher nitrate nitrogen in R than B, and the difference reached a significant level; however, XZX24 and HZY261 showed higher ammonium nitrogen in B than R.
The free amino acid of XZX24 rice seedlings had maximum values in the R1B3 treatment (Figure 6C); however, HZY261 rice seedlings had maximum values in the B treatment. Compared with W, a significant increase of 33.95% (65.73%) in the free amino acid of XZX24 (HZY261) for R1B3 (B) treatment was observed. In addition, the soluble protein of rice seedlings all had maximum values in R1B3 treatment (Figure 6D). Compared with W, a significant increase of 101.40% (54.46%) in the soluble protein of XZX24 (HZY261) for R1B3 treatment was observed. Nevertheless, the free amino acid and soluble protein of rice seedlings all had maximum values in R1B3 treatment in the combined-light (R3B1, R1B1, R1B3) treatment, and the free amino acid and soluble protein of two rice seedling leaves treated with the combined-light (R3B1, R1B1, R1B3) treatment increased with the increased of blue light proportion. In addition, XZX24 and HZY261 showed higher free amino acid and soluble protein in B than R. Compared with R, significant increases of 26.46% and 172.14% (65.73% and 161.61%) in the free amino acid and soluble protein of XZX24 (HZY261) for B treatment were observed.

2.8. Nitrate Reductase (NR), Asparagine Synthetase (AS), Glutamate Synthetase (GOGAT), Glutamine Synthesis (GS)

The changes in activities of nitrogen metabolism enzymes of the two rice varieties (XZX24 and HZY261) rice seedlings under light quality treatments regarding nitrate reductase (NR), asparagine synthetase (AS), glutamate synthetase (GOGAT) and glutamine synthesis (GS) are shown in Figure 7. The NR of rice seedlings all had maximum values in the B treatment (Figure 7A). Compared with the W treatment, a significant increase of 12.78% (14.61%) in the NR of XZX24 (HZY261) for the B treatment were observed. The AS of XZX24 rice seedlings had maximum values in the B treatment (Figure 7B); however, HZY261 rice seedlings had maximum values in the R1B1 treatment. Compared with the W treatment, a significant increase of 14.41% (47.40%) in the free amino acid of XZX24 (HZY261) for B (R1B1) treatment was observed. The NR of rice seedlings all had maximum values in R1B3 treatment in the combined-light (R3B1, R1B1, R1B3) treatment, and the NR of two rice seedling leaves treated with the combined-light (R3B1, R1B1, R1B3) treatment increased with the increased of blue light proportion. Nevertheless, the NR of rice seedlings all had maximum values in R3B1 treatment in the combined-light (R3B1, R1B1, R1B3) treatment. However, the AS of XZX24 rice seedlings had maximum values in the R3B1 treatment in the combined-light (R3B1, R1B1, R1B3) treatment; HZY261 rice seedlings had maximum values in the R1B1 treatment. In addition, XZX24 and HZY261 showed higher NR and AS in B than R. Compared with R, significant increases of 12.78% and 13.25% (5.22% and 4.48%) in the NR and AS of XZX24 (HZY261) for B treatment were observed.
The GOGAT of XZX24 rice seedlings had maximum values in the R3B1 treatment (Figure 7C); however, HZY261 rice seedlings had maximum values in the B treatment. Compared with W, a significant increase of 13.21% (1.42%) in the free amino acid of XZX24 (HZY261) for the R3B1 (B) treatment was observed. The GSs of rice seedlings all had maximum values in the R1B3 treatment (Figure 7D). Compared with the W treatment, a significant increase of 20.37% (18.84%) in the GS of XZX24 (HZY261) for the R1B3 treatment was observed. However, the GOGAT of XZX24 rice seedlings had maximum values in R3B1 treatment in the combined-light (R3B1, R1B1, R1B3) treatment; HZY261 rice seedlings had maximum values in the R1B1 treatment. Nevertheless, the GSs of rice seedlings all had maximum values in the R1B3 treatment in the combined-light (R3B1, R1B1, R1B3) treatment. In addition, XZX24 and HZY261 showed higher GOGAT and GS in B than R. Compared with R, significant increases of 37.52% and 31.96% (8.16% and 31.14%) in the GOGAT and GS of XZX24 (HZY261) for B treatment were observed.

2.9. Key Gene Expression Related to Nitrogen Metabolism

The changes in key gene expression related to nitrogen metabolism of the two rice varieties (XZX24 and HZY261) rice seedlings under light quality treatments regarding relative expression levels of AS1, NIA1, NADHGOGAT1, and GS11 are shown in Figure 8. Herein, varying degrees of upregulation of AS1 expression of XZX24 and HZY261 were observed under the light quality treatments relative to the W (Figure 8A) treatment, except for the R3B1 treatment of XZX24. Nevertheless, varying degrees of downregulation of NIA1 expression of XZX24 and HZY261 were observed under the light quality treatments relative to the W (Figure 8B) treatment, except for the B treatment of HZY261. Varying degrees of upregulation of NADHGOGAT1 expression of XZX24 and HZY261 were observed under the R, R3B1, and R1B1 treatments relative to the W treatment (Figure 8C). Varying degrees of downregulation of GS11 expression of XZX24 were observed under the light quality treatments relative to the W treatment (Figure 8D). Nevertheless, varying degrees upregulation of GS11 expression of HZY261 were observed under the R, R3B1, and R1B1 treatments relative to the W treatment. Relative to the W treatment, AS1 and NADHGOGAT1 expression of XZX24 (HZY261) were upregulated by 532.93% and 53.21% (738.75% and 112.58%), respectively, under the single red light (R) treatment. Relative to W, AS1 expression of XZX24 (HZY261) was upregulated by 804.04% (707.46%) under the single blue light (B) treatment; however, GS11 expression of XZX24 (HZY261) was downregulated by 31.31% (35.90%).

2.10. Heat Map Analysis

A heat map synthesizing the response of the measured parameters provided an integrated view of the effect of light quality on the photomorphogenesis, carbon, and nitrogen metabolism of rice seedlings (Figure 9). Most of the measured parameters of XZX24 and HZY261 under R3B1 treatment were significantly higher than of single-light (R, B) treatment. In addition, monochromatic red light and monochromatic blue light treatments showed opposite responses differing in most of the measured parameters.
Among the XZX24 variety, the W and R1B3 clusters are the closest to each other in terms of measured parameter responses, and the R3B1 and R1B1 clusters are the closest to each other in terms of measured parameter responses (Figure 9A). In addition, the W and R1B3 clusters are equidistant from cluster R, and the W, R1B3, and R clusters are equidistant from clusters R3B1 and R1B1. At the same time, cluster R is considerably separated from the other two clusters (W, R1B3): red light reduced SS, SPS, GS, soluble protein, NI, starch, SOD, CAT, ammonium nitrogen, and AI and increased gene (SPS1, AS1, GS11) expression, leaf fresh weight, leaf area, plant height, and first leaf sheath length, contributing to separate the R cluster from the others. Furthermore, cluster B has the furthest distance from clusters W, R1B3, R3B1, R1B1, and R. Cluster B is considerably separated from the other five clusters: blue light reduced gene (GS11) expression, sucrose, dry weight (total, root, stem, leaf), fresh weight (total, root, stem, leaf), starch, soluble sugar, fructose, CAT, POD, SOD, root volume, AI, plant height, and first leaf sheath length, and increased gene (NIA1, NIN1, AS1) expression, GOGAT, SS, SPS, NR, MDA and stem width compared to other five treatments, contributing to separate the B cluster from the others.
Among the HZY261 variety, the W and R1B3 clusters are the closest to each other in terms of measured parameter responses, and the R3B1 and R1B1 clusters are the closest to each other in terms of measured parameter responses (Figure 9B). In addition, the W and R1B3 clusters are equidistant from cluster R, and the W, R1B3, and R clusters are equidistant from cluster R3B1 (R1B1). At the same time, cluster R is considerably separated from the other two clusters (W, R1B3): red light reduced gene (NIN1) expression, SS, SPS, ammonium nitrogen, GOGAT, GS, NI, soluble protein, stem width, AI, and CAT, and increased gene (AS1, GS11, NADHGOGAT1) expression, leaf area, plant height, and first leaf sheath length, contributing to separate the R cluster from the others. Furthermore, clusters B have the furthest distance from cluster W, R1B3, R3B1, R1B1, and R, and cluster B is considerably separated from the other five clusters: blue light reduced gene (SUS1, NADHGOGAT1) expression, dry weight (total, root, stem, leaf), fresh weight (total, root, stem, leaf), soluble sugar, starch, sucrose, fructose, CAT, POD, SOD, root volume, leaf area, plant height, and first leaf sheath length, and increased gene (AS1) expression, AS, SS, SPS, MDA, NR, free amino acid, GS, NI, and stem width, compared to other five treatments, contributing to separate the B cluster from the others.

3. Discussion

3.1. Red and Blue Light Can Regulate the Early Morphogenesis in Rice

Light quality is one of the most important light factors in a crop growth environment. Light quality plays an important role in regulating crop seed germination, cell growth and differentiation, photosynthesis, and carbon and nitrogen metabolism. Therefore, the external morphological characteristics of crops are the most intuitive manifestation of their adaptability to the light environment. In this study, the effects of different light quality treatments on seedling growth of two rice varieties (XZX24 and HZY261) were investigated. The results of the present study are consistent with the previous research [14,21] and report that the plant height, first leaf sheath length, leaf area, and root volume of XZX24 and HZY261 under the R treatment were higher than those under the B treatment (Table 1); these indexes of XZX24 and HZY261 were significantly weaker than those of the monochrome R treatment. Compared with previous research results [14,21], although the degree of promoting cell elongation is different, it can confirm that red light can promote the longitudinal development of crop cells. However, the stem width of XZX24 and HZY261 under B treatment were higher than those under R treatment (Table 1) [22,23]. Meanwhile, the fresh weight and dry weight of XZX24 and HZY261 under R treatment were also greater than those under B treatment (Figure 1). This indicated that red light could promote the elongation growth and dry matter accumulation of rice seedlings, which was consistent with results in Gossypium hirutum [24] and Chrysanthemum morifolium [25]. The differences between research might be attributed to different spectrum absorption range in different plant materials and varieties and other factors including temperature, irrigate, O2 content, CO2 content, relative air humidity, and fertilizer and crop management. The effects of comprehensive environmental factors on the morphogenesis characteristics of rice seedlings need to be further studied.
Compared with single-light, combined-light is more conducive to plant morphogenesis [26,27]. When approximately 25% of the red light in R treatment was replaced by blue light, the fresh weight, dry weight, and root volume of XZX24 and HZY261 all increased statistically in R3B1 treatment (Table 1, Figure 1). When approximately 75% of the red light in the R treatment was replaced by blue light, the plant height, first leaf sheath length, leaf area, fresh weight, and dry weight of XZX24 and HZY261 all decreased statistically in the R1B3 treatment (Table 1, Figure 1). Our experimental results showed that an appropriate proportion of blue light was helpful to promote the main effect of red light. Nevertheless, an excessive proportion of blue light counteracts the function of red light. Previous studies has reported that red light promotes stem elongation in tomatoes; this effect can be reversed by adding a certain proportion of blue light [28,29]. This result also revealed the complexity of light quality regulation in plant morphogenesis [30,31]. For rice seedlings, leaves are an important part of photosynthesis; roots absorb nutrients and water; and plant height and stem width are related to the stress resistance of the plant. Generally speaking, in the case of the same stem width, the higher the plant height, the higher the plant stress resistance may be; similarly, in the case of the same plant height, the larger the stem width, the higher the plant stress resistance may be. This also indicates that our experiment provides a suitable light quality value ratio for rice seedling growth. In addition, the values of morphogenesis, fresh weight, and dry weight of XZX24 were higher than HZY261, which showed that XZX24 has better light quality adaptability than HZY261.

3.2. Red and Blue Light Can Regulate Carbon Metabolism of Rice Seedlings

Carbohydrates are important organic metabolites in plants. As the products of plant photosynthesis, carbohydrates are the main energy substances to maintain plant life activities. Photosynthetic pigments in plant leaves can absorb, transfer, and transform light energy, which is the basis of plant photosynthesis. The composition and content of photosynthetic pigments have an important effect on leaf photosynthesis, and light quality will affect the formation and accumulation of photosynthetic pigments in plants [32,33]. The photosynthesis process is divided into light reaction and dark reaction, in which the light reaction stage is mainly composed of photosystem I (PSI) and photosynthetic system II (PSII). PSI is before PSII, but electron transfer first starts from PSII. Light quality affects the activity of PSII and thus affects plant photosynthesis [34,35]. Hamdani et al. [36] found that blue light induction significantly reduced Fv/Fm of rice photosynthetic performance, and the larger the initial rate of NPQ induction, the higher the NPQ, corresponding to the qE component of NPQ. The lower the maximum mass subyield of PSII, however, under long-term red light treatment of rice, decreased PSII and increased NPQ; Fv/Fm did not change. In this study, the effects of light quality on photosynthetic products (carbohydrates) of rice seedlings were introduced. Further studies on photosynthetic pigments, light receptors, and functional activity of the photosynthetic apparatus are still needed.
The higher the content of carbohydrates, the more beneficial it is to the growth of plants. The level of carbohydrate content can be used as one of the main markers of carbon metabolism in plants. Light quality affects the accumulation of photosynthetic products (carbohydrates) and the activities of carbon metabolizing enzymes (SAI, NI, SS, SPS) [37,38,39]. The results of the present study were that the fructose, sucrose, soluble sugar, and starch of XZX24 and HZY261 under the R treatment were higher than those under the B treatment (Figure 3) [40,41]. At the same time, it was found in the study that 25% blue light replacement of red light resulted in higher carbohydrate content than other treatments, indicating that the addition of blue light on the basis of red light was beneficial to carbohydrate accumulation [42]. In order to regulate the production, transport, and accumulation of carbohydrates, crops need a reasonable proportion of red light and blue light during the growth process. In addition, the combined treatment of red light and blue light also improved enzyme activity related to carbon metabolism and the expression of key genes to varying degrees (Figure 3 and Figure 4). The combination of red light and blue light can regulate the expression of genes related to carbon metabolism and further improve or reduce the activity of carbon metabolism enzymes to regulate the process of carbon metabolism [43,44]. However, the regulation of carbon metabolism gene expression and carbon metabolism enzyme activity by the combination of red and blue light is caused by the complex physiological mechanism of plant carbon metabolism, rather than simple additive effects. In this study, the expression of some genes differs greatly among different rice varieties: The expression of SUS1 in R3B1-treated HZY261 is exceptionally high compared to XZX24 and other light quality treated HZ261, which may be the reason of the difference of photoreceptors in different rice varieties, which still needs to be further studied.

3.3. Red and Blue Light Can Regulate Nitrogen Metabolism of Rice Seedlings

Nitrogen metabolism is an important physiological activity of plant growth and development. Plants absorb nitrogen through nitrogen assimilation and provide nitrogen for growth and development. Plants mainly absorb and utilize nitrogen in soil (mainly nitrate nitrogen and ammonium nitrogen) through roots, so the development of roots directly affects plant nitrogen metabolism, and light quality can indirectly regulate plant nitrogen metabolism by affecting root growth [37]. At the same time, light quality will also directly participate in other aspects of plant nitrogen metabolism, affecting the content of physiological activities related to nitrogen metabolism (nitrate nitrogen, ammonium nitrogen, free amino acid, and soluble protein) and the activities of related nitrogen metabolism enzymes (NR, AS, GOGAT, GS) [45,46]. The results of the present study are that the nitrate nitrogen of XZX24 and HZY261 under the R treatment was higher than those under the B treatment (Figure 6A); nevertheless, ammonium nitrogen, free amino acid, and soluble protein of XZX24 and HZY261 under the B treatment were higher than those under the R treatment (Figure 6B–D). As the ratio of red and blue light changes, so do nitrogen metabolites. The content of ammonium nitrogen, free amino acid, and soluble protein in rice seedling was increased by increasing the proportion of blue light. In addition, the combined treatment of red light and blue light also improved the enzyme activity related to nitrogen metabolism and the expression of key genes (NIN1) to varying degrees (Figure 7 and Figure 8). The combination of red light and blue light can regulate the expression of genes related to nitrogen metabolism and further improve or reduce the activity of nitrogen metabolism enzymes to regulate the process of nitrogen metabolism [47,48].
Physiological changes of plant carbon and nitrogen metabolism can regulate the photosynthesis of plant leaves [49] and affect the absorption of mineral elements by plant roots and the synthesis of related proteins and enzymes. Nitrogen metabolism depends on carbon metabolism to provide energy and carbon source. At the same time, nitrogen metabolism provides photosynthetic pigments and related enzymes necessary for carbon metabolism. These two metabolic activities require common reducing power and the carbon skeleton and carbon and nitrogen metabolism coordinate, promote each other, and have a close relationship. Jointly, plant growth and development is regulated. However, the molecular mechanism of the combination of red light and blue light to further regulate crop growth by regulating carbon and nitrogen metabolism remains to be further studied.

3.4. The Combination of Red Light and Blue Light Can Improve the Low Light Tolerance of Rice Seedlings

The light environment is one of the important ecological environmental factors for plant growth and development. It mainly affects plant growth and development through photoperiod, light density, light distribution, and light quality. Under low light stress, the rice plant height increased, the stem base width decreased, the leaf thinned, photosynthetic pigment content decreased, and net photosynthetic rate decreased; this disrupted the accumulation, transport, and distribution of photosynthetic products and led to the decline of rice low light resistance. Studies have shown that light quality can regulate plant carbon and nitrogen metabolism and enhance plant low light resistance. In this study, it was found that light quality can affect the low light resistance of rice, and the combination of red and blue light can significantly improve the antioxidant enzyme activity of rice seedlings (Figure 2), reduce the content of MDA, and eliminate more reactive oxygen species. Under low light stress, the antioxidant system of different rice varieties treated with light quality is different. For example, the POD content of XZX24 and HZY261 was found to be very different in the study (Figure 2B), which may be caused by the different adaptability of different rice varieties to low light. The combined treatment of red and blue light significantly increased the content of soluble solids (soluble sugar and soluble protein) in rice seedlings (Figure 3 and Figure 6) and enhanced the low light resistance of rice seedlings. We found that the combination of red and blue light can regulate the physiological metabolism of rice and enhance the resistance to low light by regulating the expression of genes related to carbon and nitrogen metabolism under low light (Figure 5 and Figure 8), which has never been reported in previous studies. Nevertheless, further study are needed to explore the physio-biochemical and molecular mechanisms of red–blue light combination in crop production in enhancing low light resistance.

4. Materials and Methods

4.1. Plant Materials and Description of Experiment

The seeds of two rice varieties (XZX24 and HZY261) used in this study were collected from Hunan Jinse Nongfeng Seed Industry Co., Ltd., Changsha, China and Hunan Jinjian Seed Industry Technology Co., Ltd., Changsha, China. Experiments were conducted in an artificial climate chamber at Hunan Agriculture University, Changsha, China. The germinated rice (XZX24 and HZY261) seeds (n = 3 per hole) were sown in 106-hole (Bottom diameter/calibre/height: 10 mm/17 mm/20 mm) seedling trays with nutrient soil (Hunan Xianghui Agricultural Technology Development Co., Ltd., Shaoyang, China) and placed in an artificial climate chamber (YHMR-1000, Ningbo Yanghui Instrument Co., Ltd., Ningbo, China).
When the rice seedlings’ first true leaves were expanded and after 1 day of preculture under white LED illumination with 12 h of photoperiod (100 μmol m−2 s−1), 25 °C/15 °C (daytime/night), and 70%/80% (daytime/night) relative humidity, continued culture was carried out under different light quality conditions. The seedlings were subjected to six experimental illumination treatments. The six light treatments growth conditions are as follows: (1) W, white light; (2) R, red light; (3) R3B1, 75% red + 25% blue light; (4) R1B1, 50% red + 50% blue light; (5) R1B3, 25% red + 75% blue light; (6) B, blue light, and average relative humidity = 70%/80% (daytime/night), temperature = 25 °C/15 °C (day/night), light intensity = 100 μmol m−2 s−1, and photoperiod = 12 h/12 h (day/night). Photon fluxes were measured with a spectroradiometer (PLA-30, Everfine Optoelectronic Information Co., Ltd., Hangzhou, China). The light intensity was adjusted on the basis of the distance between the light source and the rice seedlings canopy. The center wavelength of each light was as follows: red light, 665 nm; blue light, 450 nm. The spectral values of the four treatments are shown in Figure 10.
The rice seedlings were organized in a complete randomized block design with four replicates per treatment. After 21 days of cultivation, the rice seedlings plants under different treatments were sampled, and the related indexes were determined. The sample parts were immediately frozen in liquid nitrogen and stored at −80 °C until analysis.

4.2. Morphological Indicators

Twenty-one days after treatment, the rice seedlings were harvested. The plant height, first leaf sheath length, and stem width were examined using a rectilinear scale (vernier caliper). Five rice seedlings were selected for each replicate, and the root system and the leaf were analyzed by scanner (Epson Perfection V850 Pro, Epson China Co., Ltd., Shanghai, China) and LA-S analyzer system (LA-S, Hangzhou Wanshen Testing Technology Co., Ltd., Hangzhou, China) to obtain the related data of root volume and leaf area. The plants, root, stem, leaf fresh weight, and dry weight were examined using an electronic balance. Fifty plants were then randomly selected from each replicate; for dry weight, they were deactivated at 110 °C and then dried at 70 °C for 96 h.

4.3. Antioxidant Enzyme Activities and MDA Content

Extracts of Antioxidant Enzyme Activity: To prepare the tissue homogenate, 0.5 g of rice seedlings leaves was accurately weighed and ground in 5 mL of distilled water in a mortar until homogenized. The resulting homogenate was centrifuged at 4000× g for 15 min, and 1 mL of the supernatant was taken and made up to a final volume of 100 mL with distilled water in a volumetric flask.
Superoxide Dismutase (SOD) Assay: The supernatant was mixed with methamphetamine buffer (100 mM, pH 7.4), EDTA/MnCl2 (100 mM/50 mM, pH 7.4), 2-mercaptoethanol (10 mM), and NADH (7.5 mM). The SOD activity was determined by a spectrophotometer (Hitachi, U-2900, Tokyo, Japan) at 340 nm. In this study, one unit of SOD was defined as the enzyme activity that inhibits 50% of the NADH oxidation rate in blank samples [50].
Peroxidase (POD) Assay: The supernatant was mixed with titanium chloride (0.1% v/v dissolved in 20% (v/v) H2SO4) and centrifuged at 4000× g at room temperature for 30 min. The POD activity was determined by a spectrophotometer (Hitachi, U-2900, Tokyo, Japan) at 410 nm [50].
Catalase (CAT) Assay: The supernatant was mixed with enzyme reaction solution (pH 7.8, 0.98 M H2O2), the reaction solution was replaced by extraction solution, and the reaction solution was adjusted to zero. The CAT activity was determined by a spectrophotometer (Hitachi, U-2900, Tokyo, Japan) at 240 nm. In this study, one unit of CAT (U·g−1·min−1) was defined as the enzyme activity is expressed as the rate of H2O2 decline per unit mass per minute.
Malondialdehyde (MDA) Assay: The leaf samples were ground in trichloroacetic acid (TCA, 5% w/v) before being centrifuged at 10,000× g under 20 °C for 5 min. The supernatant was mixed with barbiturate acid (0.5% w/v, containing 20% w/v TCA) and placed in a water bath at 95 °C for 30 min before centrifuging at 3000× g under room temperature for 10 min. The MDA activity was determined by a spectrophotometer (Hitachi, U-2900, Tokyo, Japan) at 532 and 600 nm [50].

4.4. Carbon Metabolite

The carbon metabolism content of the leaves was determined using the anthrone colorimetric method [50]. Samples (0.1 g fresh rice leaves) were put into a test tube, to which 2 mL of 80% ethanol solution was added and mixed. After 3 h in a water bath at 85 °C, the supernatant was collected. This step was repeated three times, and then, distilled water was added to a volume of 10 mL. The fructose, sucrose, and soluble sugar contents were determined with the sulfuric acid anthrone method at a wavelength of 620 nm.
Fructose Content: 4 mL of 0.2% anthranone reagent was added to a test tube containing 1 mL of soluble sugar extract and mixed well. Distilled water replaced the soluble sugar extract as a blank control and was placed on ice for operation. After the reaction at room temperature for 2 h, the fructose content was determined by a spectrophotometer (Hitachi, U-2900, Tokyo, Japan) at 620 nm. The fructose content = CT × V/M, CT was the sugar concentration corresponding to 620 nm detected on the standard curve: V was the total volume of soluble sugar extract, and M was the sample weight.
Sucrose Content: 0.1 mL of 30% KOH solution was added into a test tube containing 1 mL of soluble sugar extract and mixed well. Distilled water replaced the soluble sugar extract as a blank control. After 10 min in a boiling water bath, it was cooled to room temperature. A total of 4 mL of 0.2% anthranone reagent was added and mixed well. A total of 5 mL was held in distilled water and kept at 40 °C for 20 min. The sucrose content was determined by a spectrophotometer (Hitachi, U-2900, Tokyo, Japan) at 620 nm. The sucrose content = CT × V/M, CT was the sugar concentration corresponding to 620 nm detected on the standard curve: V was the total volume of soluble sugar extract, and M was the sample weight.
Soluble Sugar Content: 4 mL of 0.2% anthranone reagent (now in use) was added to a test tube containing 1 mL of soluble sugar extract and mixed well. Distilled water replaced the soluble sugar extract as a blank control and was placed on ice for operation. After 10 min in a boiling water bath, the ice was cooled to room temperature. The soluble sugar content was determined by a spectrophotometer (Hitachi, U-2900, Tokyo, Japan) at 620 nm. The soluble sugar content = CT × V/M: CT was the sugar concentration corresponding to 620 nm detected on the standard curve, V was the total volume of soluble sugar extract, and M was the sample weight.
Starch Content: After 2 mL of distilled water was added to the residue, it was gelatinized in a water bath at 100 °C for 15 min. After cooling, 2 mL of cold perchloric acid (9.2 mol·L−1) was added and shaken well. After 2 mL of distilled water was added, the residue was centrifuged (6000× g, 5 min). A volume of 4 mL of supernatant was transferred to a 100 mL volumetric bottle. Then, 2 mL of perchloric acid (4.6 mol·L−1) was added into the centrifugal tube for shock. It was extracted for 15 min, 2 mL of distilled water was added, and the system was centrifuged (6000× g, 5 min). A volume of 4 mL of supernatant was transferred to the same volumetric bottle, and distilled water was used to hold 100 mL. The starch was determined with the sulfuric acid anthrone method at a wavelength of 620 nm.

4.5. Soluble Acid Invertase (SAI), Neutral Invertase (NI), Sucrose Synthase (SS), Sucrose Phosphate Synthase (SPS)

Soluble acid invertase (SAI), neutral invertase (NI), sucrose synthase (SS), and sucrose phosphate synthase (SPS) were extracted using assay kits (ZC-S0509, ZC-S0510, ZC-S0507, ZC-S0508, Shanghai ZCIBIO Technology Co., Ltd., Shanghai, China). SAI (NI) activity was measured at 480 (540) nm with the ultraviolet spectrophotometer, and the catalytic production of 1 μg reducing sugar per g tissue per minute was defined as a unit of enzyme activity. The SS and SPS activity was measured at 480 nm with the ultraviolet spectrophotometer, and the catalytic production of 1 μg sucrose per g tissue per minute was defined as a unit of enzyme activity.

4.6. Nitrogen Metabolite

Nitrate nitrogen: The nitrate analysis was measured by the Cataldo [51] method. A volume of 1 mL of deionized water was added to 0.1 g of fresh rice leaves. They were ground, transferred to a 2 mL centrifuge tube, placed in boiling water bath for 10 min, cooled to a constant volume, and centrifuged at 15,000× g for 10 min. A volume of 0.1 mL of supernatant was taken, 0.4 mL of a salicylic acid and sulfuric acid solution (5%) was added, and the system was mixed well and placed at 20 °C for 20 min. Then, 9.5 mL of NaOH solution (8%) was slowly added and cooled to room temperature. The nitrate nitrogen content was determined by a spectrophotometer (Hitachi, U-2900, Tokyo, Japan) at 410 nm.
Ammonium nitrogen: Ammonium nitrogen was measured by the Konishi [52] method. A volume of 1 mL H2SO4 (pH = 1) was added to 0.1 g of fresh rice leaves; they were ground and centrifuged at 3500× g for 20 min. A total of 0.1 mL of supernatant was taken, distilled water was used to fix the system to 9 mL, and 0.2 mL of sodium potassium tartrate reagent (500 g·L−1) and 0.3 mL of Nasi’s reagent were added, mixed, and placed at 20 °C for 30 min. The ammonium nitrogen content was determined by a spectrophotometer (Hitachi, U-2900, Tokyo, Japan) at 420 nm.
Soluble protein: Soluble protein was measured by the Ren [46] method. Samples (0.1 g fresh rice leaves) were ground up in a mortar with liquid nitrogen, to which 6 mL of a phosphate buffer (pH 7.0) was added. The extract was centrifuged at 15,000× g for 20 min at 4 °C, and 0.2 mL of the supernatant was combined with 9.8 mL of a coomassie brilliant blue G-250 solution (0.1 g·L−1). After 5 min, the soluble protein content was determined at a wavelength of 595 nm.
Free Amino Acid Content: Free amino acid was extracted using assay kits (ZC-S0653, Shanghai ZCIBIO Technology Co., Ltd., Shanghai, China), and the free amino acid content was measured at 570 nm by the ultraviolet spectrophotometer.

4.7. Nitrate Reductase (NR), Asparagine Synthetase (AS), Glutamate Synthetase (GOGAT), Glutamine Synthesis (GS)

Nitrate reductase (NR), asparagine synthetase (AS), glutamate synthetase (GOGAT), and glutamine synthesis (GS) were extracted using assay kits (AC-S0643, ZC-S0925, ZC-S0644 ZC-S0377, Shanghai ZCIBIO Technology Co., Ltd., Shanghai, China). The NR and GOGAT activity was measured at 340 nm by the ultraviolet spectrophotometer. Consumption of 1 µmol NADH per g fresh weight sample per hour was one unit of enzyme activity. The AS activity was measured at 420 nm by the ultraviolet spectrophotometer. Catalytic generation of glutamine to 1 nmol per g tissue per minute was defined as a unit of enzyme activity. The GS activity was measured at 540 nm by the ultraviolet spectrophotometer. A change of 0.01 per minute absorbance value per g tissue in the reaction system was defined as one unit of enzyme activity.

4.8. Gene Expression of Carbon and Nitrogen Metabolism

We examined the expression levels of carbon metabolism related genes (VIN1, NIN1, SUS1 and SPS1) and nitrogen metabolism related genes (AS1, NIA1, GS11 and NADHGOGAT1) in leaves under different light qualities. Details of the gene-specific primers and internal reference gene OsActin3 were provided in Table 2. According to the manufacturer’s instructions, after 21 d of growth with different light qualities, the total RNA was extracted from fresh rice seedlings leaf (0.1 g) by using the RNA prep Pure Plant Kit: Polysaccharides and Polyphenolics-rich (Vazyme, China). The concentration of the RNA samples was determined using the NanoPhotometer (IMPLEN, USA). According to the manufacturer’s guidelines, the first-strand cDNA was synthesized from 2.0 μg of total RNA using the HiScript ® III AII-in-one SuperMix Perfect for qPCR (Vazyme, China). The reaction volume was 10 μL, including 2 μL of cDNA, 5 μL of Hieff® qPCR SYBR Green Master Mix (Vazyme, China), 0.2 μL of forward primer, 0.2 μL of reverse primer, and 2.6 μL of ddH2O. For the fluorescent quantitative PCR (RT-PCR, BIORAD CFX96 Touch) analysis of the gene expression, the sequences of carbon and nitrogen metabolism related genes were amplified with primers designed on the basis of the sequences obtained from NCBI (Table 2). The relative expression levels for each sample were calculated as 2−△△Ct (Ct represents cycle numbers when fluorescence signal in each reaction reaches threshold). Measurement of all samples were repeated three times.

4.9. Statistical Analysis

Origin2018 was used to draw the cluster heat map, and Z-score was used to standardize the data in some way. A one-way analysis of variance was conducted to test the effects of different light qualities in rice early morphogenesis, carbon and nitrogen metabolism, and the antioxidant defense system, IBM SPSS Statistics 20 (IBM, Inc., Chicago, IL, USA). Different alphabetical letters are used in figures and tables for showing significant differences.

5. Conclusions

Combined application of red light and blue light could promote the growth of rice seedling leaves and roots under low light stress to varying degrees, increase the photosynthetic area by increasing the leaf area, improve the root characteristics by increasing the root volume, and increase the dry matter accumulation of rice seedlings. In addition, the combination of red light and blue light could increase carbon and nitrogen metabolites in rice seedling leaves, regulate the expression of genes related to carbon and nitrogen metabolism and enzyme activity, and enhance the antioxidant enzyme activity of rice seedlings. These results indicate that red light and blue light directly have synergistic effects, which can regulate the carbon and nitrogen metabolism of rice seedlings, promote the morphogenesis of rice seedlings under low light stress, and promote the growth, which have never been reported in previous studies. This study is a new discovery in the application of light quality in crop production and provides new avenues to enhance crop stress resistance. However, further study are needed to explore the physio-biochemical and molecular mechanisms of light quality in crop production.

Author Contributions

M.R., S.L. and G.M. have made substantial contributions to the conception, design of the work, drafting the work, revising it critically for important intellectual content. M.R., C.T., G.M., P.G. and X.G. contributed to the acquisition, analysis, and interpretation of data for the work. W.W., H.Z. and Q.T. contributed to the agreement to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Project for China Agriculture Research System (CARS-01-27); the National Natural Science Foundation of China (32201897); the Natural Science Foundation of Hunan Province, China (2021JJ40248).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data used to support the findings of this study are available from the corresponding author upon request.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Guo, D.; Luo, C.; Xiang, J.; Cai, S. Evaluation and Application of Reanalyzed Combined Data under Extreme Climate Conditions: A Case Study of a Typical Flood Event in the Jinsha River. Atmosphere 2022, 13, 263. [Google Scholar] [CrossRef] [Scilit]
  2. Huang, J.; Zhang, F.; Zhou, L.; Hu, Z.; Li, Y. Regional changes of climate extremes and its effect on rice yield in Jiangsu province, southeast China. Environ. Earth Sci. 2018, 77, 106. [Google Scholar] [CrossRef] [Scilit]
  3. Wang, H.; Zhong, L.; Fu, X.; Huang, S.; Fu, H.; Shi, X.; Chen, X. Physiological and Transcriptomic Analyses Reveal the Mechanisms of Compensatory Growth Ability for Early Rice after Low Temperature and Weak Light Stress. Plants 2022, 11, 2523. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Budiastuti, M.T.S.; Purnomo, D.; Supriyono; Pujiasmanto, B.; Setyaningrum, D. Effect of light intensity on growth, yield and indigo content of Indigofera tinctoria L. Earth Environ. Sci. 2021, 724, 012085. [Google Scholar] [CrossRef] [Scilit]
  5. Morello, V.; Vincent, D.B.; Wu, N.; Bo-Sen, W.; MacPherson, S.; Lefsrud, M. Light Quality Impacts Vertical Growth Rate, Phytochemical Yield and Cannabinoid Production Efficiency in Cannabis sativa. Plants 2022, 11, 2982. [Google Scholar] [CrossRef] [Scilit]
  6. Zha, L.; Liu, W. Effects of light quality, light intensity, and photoperiod on growth and yield of cherry radish grown under red plus blue LEDs. Hortic. Environ. Biotechnol. 2018, 59, 511–518. [Google Scholar] [CrossRef] [Scilit]
  7. Kumar, A.; Panda, D.; Biswal, M.; Dey, P.; Behera, L.; Baig, M.J.; Sharma, S. Low light stress influences resistant starch content and Glycemic index of rice (O. sativa L). Starch 2019, 71, 1800216. [Google Scholar] [CrossRef] [Scilit]
  8. Yangxuan, L.; Pan, T.; Tang, Y.; Yong, Z.; Liu, Z.; Penghui, L.; Songhu, W. Proteomic analysis of rice subjected to low light stress and overexpression of OsGAPB increases the stress tolerance. Rice 2020, 13. [Google Scholar] [CrossRef] [Scilit]
  9. Li, D.; Yu, F.; Zhang, Y.; Hu, K.; Dai, D.; Song, S.; Sheng, Y. Integrative analysis of different low-light-tolerant cucumber lines in response to low-light stress. Front. Plant Sci. 2022, 13, 1093859. [Google Scholar] [CrossRef] [Scilit]
  10. Li, Y.; Liang, L.; Fu, X.; Gao, Z.; Liu, H.; Tan, J.; Mo, Z. Light and water treatment during the early grain filling stage regulates yield and aroma formation in aromatic rice. Sci. Rep. 2020, 10, 14830. [Google Scholar] [CrossRef] [Scilit]
  11. Liu, Q.; Bo-cong, C.; Jia-qing, M.; Gao, J.; Wu, X. Effects of Low Light on Agronomic and Physiological Characteristics of Rice Including Grain Yield and Quality. Rice Sci. 2014, 21, 243–251. [Google Scholar] [CrossRef] [Scilit]
  12. Kharshiing, E.V.; Mawphlang, O.I.L.; Lama, V.; Bhattacharjee, R.; Sahoo, L. Manipulation of light environment for optimising photoreceptor activity towards enhancing plant traits of agronomic and horticultural importance in crops. J. Hortic. Sci. Biotechnol. 2022, 97, 535–551. [Google Scholar] [CrossRef] [Scilit]
  13. Paradiso, R.; Simona, P. Light-Quality Manipulation to Control Plant Growth and Photomorphogenesis in Greenhouse Horticulture: The State of the Art and the Opportunities of Modern LED Systems. J. Plant Growth Regul. 2022, 41, 742–780. [Google Scholar] [CrossRef] [Scilit]
  14. Di, Q.H.; Li, J.; Yufen, D.; Wei, M.; Shi, Q.; Li, Y.; Fengjuan, Y. Combination of Red and Blue Lights Improved the Growth and Development of Eggplant (Solanum melongena L.) Seedlings by Regulating Photosynthesis. J. Plant Growth Regul. 2020, 40, 1477–1492. [Google Scholar] [CrossRef] [Scilit]
  15. Lee, H.; Gyu, H.I.; Cheong, E.J. Effect of different treatments and light quality on Ulmus pumila L. germination and seedling growth. For. Sci. Technol. 2021, 17, 162–168. [Google Scholar] [CrossRef] [Scilit]
  16. Cioć, M.; Dziurka, M.; Pawłowska, B. Changes in Endogenous Phytohormones of Gerbera jamesonii Axillary Shoots Multiplied under Different Light Emitting Diodes Light Quality. Molecules 2022, 27, 1804. [Google Scholar] [CrossRef] [Scilit]
  17. Mao, R.; Guo, S. Performance of the mixed LED light quality on the growth and energy efficiency of Arthrospira platensis. Appl. Microbiol. Biotechnol. 2018, 102, 5245–5254. [Google Scholar] [CrossRef] [Scilit]
  18. Roeber, V.M.; Bajaj, I.; Rohde, M.; Schmuelling, T.; Cortleven, A. Light acts as a stressor and influences abiotic and biotic stress responses in plants. Plant Cell Environ. 2021, 44, 645–664. [Google Scholar] [CrossRef] [Scilit]
  19. Han, P.; Dong-xue, Z.; Rong-jun, G.; Rong-rong, Y.; Shi-gang, S.; Shi-ru, J.; Yi-kai, W. ROS Is a Factor Regulating the Increased Polysaccharide Production by Light Quality in the Edible Cyanobacterium Nostoc flagelliforme. J. Agric. Food Chem. 2019, 67, 2235–2244. [Google Scholar] [CrossRef] [Scilit]
  20. Dou, H.; Niu, G.; Gu, M.; Masabni, J.G. Effects of Light Quality on Growth and Phytonutrient Accumulation of Herbs under Controlled Environments. Horticulturae 2017, 3, 36. [Google Scholar] [CrossRef] [Scilit]
  21. Frąszczak, B.; Kula-Maximenko, M. The Biometric Parameters of Microgreen Crops Grown under Various Light Conditions. Agriculture 2022, 12, 576. [Google Scholar] [CrossRef] [Scilit]
  22. Graham, T.; Yorio, N.; Zhang, P.; Massa, G.; Wheeler, R. Early seedling response of six candidate crop species to increasing levels of blue light. Life Sci. Space Res. 2019, 21, 40–48. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Fantini, E.; Facella, P. Cryptochromes in the field: How blue light influences crop development. Physiol. Plant. 2020, 169, 336–346. [Google Scholar] [CrossRef] [Scilit]
  24. Li, H.; Xu, Z.; Tang, C. Effect of light-emitting diodes on growth and morphogenesis of upland cotton (Gossypium hirsutum L.) plantlets in vitro. Plant Cell Tissue Organ Cult. 2010, 103, 155–163. [Google Scholar] [CrossRef] [Scilit]
  25. Simlat, M.; Ptak, A.; Skrzypek, E.; Moś, M.; Warchoł, M.; Patrycja, Ś. The effect of light quality on seed germination, seedling growth and selected biochemical properties of Stevia rebaudiana Bertoni. Sci. Hortic. 2016, 211, 295–304. [Google Scholar] [CrossRef] [Scilit]
  26. Jae, W.S.; Shiva, R.B.; Shin, Y.K.; Lee, J.G. The Influence of Red and Blue Light Ratios on Growth Performance, Secondary Metabolites, and Antioxidant Activities of Centella asiatica (L.) Urban. Horticulturae 2022, 8, 601. [Google Scholar] [CrossRef] [Scilit]
  27. Stefański, P.; Siedlarz, P.; Matysik, P.; Rybka, K. Usefulness of LED lightings in cereal breeding on example of wheat, barley and oat seedlings. Int. J. Agric. Biol. Eng. 2019, 12, 32–37. [Google Scholar] [CrossRef]
  28. Kaiser, E.; Ouzounis, T.; Giday, H.; Schipper, R.; Heuvelink, E.; Marcelis, L.F.M. Adding Blue to Red Supplemental Light Increases Biomass and Yield of Greenhouse-Grown Tomatoes, but Only to an Optimum. Front. Plant Sci. 2018, 9, 2002. [Google Scholar] [CrossRef] [Scilit]
  29. Muthusamy, M.; Kim, J.A.; Mi-Jeong, J.; Lee, S.I. Blue and red light upregulate α-expansin 1 (EXPA1) in transgenic Brassica rapa and its overexpression promotes leaf and root growth in Arabidopsis. Plant Growth Regul. 2020, 91, 75–87. [Google Scholar] [CrossRef] [Scilit]
  30. Fan, C.; Manivannan, A.; Hao, W. Light Quality-Mediated Influence of Morphogenesis in Micropropagated Horticultural Crops: A Comprehensive Overview. BioMed Res. Int. 2022, 2022, 4615079. [Google Scholar] [CrossRef] [Scilit]
  31. Park, Y.G.; Jeong, B.R. Both the Quality and Positioning of the Night Interruption Light are Important for Flowering and Plant Extension Growth. J. Plant Growth Regul. 2020, 39, 583–593. [Google Scholar] [CrossRef] [Scilit]
  32. Bercel, T.L.; Kranz, S.A. Effects of spectral light quality on the growth, productivity, and elemental ratios in differently pigmented marine phytoplankton species. J. Appl. Phycol. 2022, 34, 185–202. [Google Scholar] [CrossRef] [Scilit]
  33. Naif, A.E.; Yousef, A.F.; Lin, K.; Zhang, X.; Ali, M.M.; Lamlom, S.F.; Kalaji, H.M.; Kowalczyk, K.; Xu, Y. Photosynthetic performance of rocket (Eruca sativa. Mill.) grown under different regimes of light intensity, quality, and photoperiod. PLoS ONE 2021, 16, e0257745. [Google Scholar] [CrossRef] [Scilit]
  34. Riichi, O.; Ichiro, T.; Chow, W.S. The effect of different spectral light quality on the photoinhibition of Photosystem I in intact leaves. Photosynth. Res. 2021, 149, 83–92. [Google Scholar] [CrossRef] [Scilit]
  35. Kumiko, O.; Yoshifumi, U.; Makio, Y.; Jian-Ren, S.; Ryo, N.; Seiji, A. Adaptation of light-harvesting and energy-transfer processes of a diatom Phaeodactylum tricornutum to different light qualities. Photosynth. Res. 2020, 146, 227–234. [Google Scholar] [CrossRef] [Scilit]
  36. Hamdani, S.; Khan, N.; Perveen, S.; Qu, M.; Jiang, J.; Govindjee; Zhu, X.-G. Changes in the photosynthesis properties and photoprotection capacity in rice (Oryza sativa) grown under red, blue, or white light. Photosynth. Res. 2019, 139, 107–121. [Google Scholar] [CrossRef] [Scilit]
  37. Zhou, C.; Zhang, Y.; Liu, W. Light Quality Affected the Growth and Root Organic Carbon and Autotoxin Secretions of Hydroponic Lettuce. Plants 2020, 9, 1542. [Google Scholar] [CrossRef] [Scilit]
  38. Ren, Y.; Sun, H.; Deng, J.; Zhang, Y.; Li, Y.; Huang, J.; Chen, F. Coordinating Carbon Metabolism and Cell Cycle of Chlamydomonasreinhardtii with Light Strategies under Nitrogen Recovery. Microorganisms 2021, 9, 2480. [Google Scholar] [CrossRef] [Scilit]
  39. Tarakanov, I.G.; Tovstyko, D.A.; Lomakin, M.P.; Shmakov, A.S.; Sleptsov, N.N.; Shmarev, A.N.; Ivlev, A.A. Effects of Light Spectral Quality on Photosynthetic Activity, Biomass Production, and Carbon Isotope Fractionation in Lettuce, Lactuca sativa L., Plants. Plants 2022, 11, 441. [Google Scholar] [CrossRef] [Scilit]
  40. Zheng, L.; Ceusters, J.; Marie-Christine, V.L. Light quality affects light harvesting and carbon sequestration during the diel cycle of crassulacean acid metabolism in Phalaenopsis. Photosynth. Res. 2019, 141, 195–207. [Google Scholar] [CrossRef] [Scilit]
  41. Zhang, T.; Shi, Y.; Piao, F.; Sun, Z. Effects of different LED sources on the growth and nitrogen metabolism of lettuce. Plant Cell Tissue Org. 2018, 134, 231–240. [Google Scholar] [CrossRef] [Scilit]
  42. Chen, X.-L.; Qi-chang, Y. Effects of intermittent light exposure with red and blue light emitting diodes on growth and carbohydrate accumulation of lettuce. Sci. Hortic. 2018, 234, 220–226. [Google Scholar] [CrossRef] [Scilit]
  43. Liu, J.; Liu, W. Regulation of accumulation and metabolism circadian rhythms of starch and sucrose in two leaf-color lettuces by red:blue ratios of LED continuous light. Environ. Exp. Bot. 2022, 196. [Google Scholar] [CrossRef] [Scilit]
  44. Tang, Z.; Yu, J.; Xie, J.; Lyu, J.; Feng, Z.; Dawuda, M.M.; Hu, L. Physiological and Growth Response of Pepper (Capsicum annum L.) Seedlings to Supplementary Red/Blue Light Revealed through Transcriptomic Analysis. Agronomy 2019, 9, 139. [Google Scholar] [CrossRef] [Scilit]
  45. Zhang, Y.; Zha, L.; Liu, W.; Zhou, C.; Shao, M.; Yang, Q. LED Light Quality of Continuous Light before Harvest Affects Growth and AsA Metabolism of Hydroponic Lettuce Grown under Increasing Doses of Nitrogen. Plants 2021, 10, 176. [Google Scholar] [CrossRef] [Scilit]
  46. He, J.; Gan, J.H.S.; Qin, L. Productivity, photosynthetic light-use efficiency, nitrogen metabolism and nutritional quality of C4 halophyte Portulaca oleracea L. grown indoors under different light intensities and durations. Front. Plant Sci. 2023, 14, 1106394. [Google Scholar] [CrossRef] [Scilit]
  47. Li, Z.; Chen, Q.; Xin, Y.; Mei, Z.; Gao, A.; Liu, W.; Wang, N. Analyses of the photosynthetic characteristics, chloroplast ultrastructure, and transcriptome of apple (Malus domestica) grown under red and blue lights. BMC Plant Biol. 2021, 21, 1–14. [Google Scholar] [CrossRef] [Scilit]
  48. Zhou, X.; Huang, J.; Gan, Y.; Li, Z.; Su, L.; He, Z.; Zheng, W. Transcriptome Mechanisms of Tomato Seedlings Induced by Low-Red to Far-Red Light Ratio under Calcium Nitrate Stress. Int. J. Mol. Sci. 2023, 24, 3738. [Google Scholar] [CrossRef] [Scilit]
  49. Chen, R.; Hu, X.; Chen, D.; Song, T.; Wang, W.; Lv, M.; Hansen, N.C. Nitrogen Modulates the Effects of Short-Term Heat, Drought and Combined Stresses after Anthesis on Photosynthesis, Nitrogen Metabolism, Yield, and Water and Nitrogen Use Efficiency of Wheat. Water 2022, 14, 1407. [Google Scholar] [CrossRef] [Scilit]
  50. Ren, M.; Mao, G.; Zheng, H.; Wang, W.; Tang, Q. Growth changes of tomato seedlings responding to sodium salt of α-naphthalene acetic acid and potassium salt of fulvic acid. Sci. Rep. 2023, 13, 4024. [Google Scholar] [CrossRef] [Scilit]
  51. Cataldo, D.A.; Haroon, M.; Schrader, L.E.; Youngs, V.L. Rapid colorimetric determination of nitrate in plant tissue by nitration of salicylic acid. Commun. Soil Sci. Plant 1975, 6, 71–80. [Google Scholar] [CrossRef] [Scilit]
  52. Konishi, N.; Ma, J.F. Three polarly localized ammonium transporter 1 members are cooperatively responsible for ammonium uptake in rice under low ammonium condition. New Phytol. 2021, 232, 1778–1792. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Effects of different light qualities on fresh weight, dry weight of rice seedlings. (A): Fresh Weight, (B): Dry Weight, XZX24: Xiangzaoxian24, HZY261: Huazheyou261, W: white, R: red, R3B1: 75% red + 25% blue, R1B1: 50% red + 50% blue, R1B3: 25% red + 75% blue, B: blue. Different lowercase letters (capital letters) denote statistical differences among treatments of a cultivar root weight, stem weight and leaf weight (total weight) at the 5% level according to LSD test. Error bars above mean indicate standard error (n = 3).
Figure 1. Effects of different light qualities on fresh weight, dry weight of rice seedlings. (A): Fresh Weight, (B): Dry Weight, XZX24: Xiangzaoxian24, HZY261: Huazheyou261, W: white, R: red, R3B1: 75% red + 25% blue, R1B1: 50% red + 50% blue, R1B3: 25% red + 75% blue, B: blue. Different lowercase letters (capital letters) denote statistical differences among treatments of a cultivar root weight, stem weight and leaf weight (total weight) at the 5% level according to LSD test. Error bars above mean indicate standard error (n = 3).
Ijms 24 10706 g001
Figure 2. Effects of different light qualities on antioxidant enzyme activities and MDA content of rice seedlings. (A): Superoxide Dismutase (SOD), (B): Peroxidase (POD), (C): Catalase (CAT), (D): Malondialdehyde (MDA), XZX24: Xiangzaoxian24, HZY261: Huazheyou261, W: white, R: red, R3B1: 75% red + 25% blue, R1B1: 50% red + 50% blue, R1B3: 25% red + 75% blue, B: blue. Different lowercase letters denote statistical differences among treatments of a cultivar at the 5% level according to LSD test. Error bars above mean indicate standard error (n = 3).
Figure 2. Effects of different light qualities on antioxidant enzyme activities and MDA content of rice seedlings. (A): Superoxide Dismutase (SOD), (B): Peroxidase (POD), (C): Catalase (CAT), (D): Malondialdehyde (MDA), XZX24: Xiangzaoxian24, HZY261: Huazheyou261, W: white, R: red, R3B1: 75% red + 25% blue, R1B1: 50% red + 50% blue, R1B3: 25% red + 75% blue, B: blue. Different lowercase letters denote statistical differences among treatments of a cultivar at the 5% level according to LSD test. Error bars above mean indicate standard error (n = 3).
Ijms 24 10706 g002
Figure 3. Effects of different light qualities on carbon metabolite of rice seedlings. (A): Fructose, (B): Sucrose, (C): Soluble sugar, (D): Starch, XZX24: Xiangzaoxian24, HZY261: Huazheyou261, W: white, R: red, R3B1: 75% red + 25% blue, R1B1: 50% red + 50% blue, R1B3: 25% red + 75% blue, B: blue. Different lowercase letters denote statistical differences among treatments of a cultivar at the 5% level according to LSD test. Error bars above mean indicate standard error (n = 3).
Figure 3. Effects of different light qualities on carbon metabolite of rice seedlings. (A): Fructose, (B): Sucrose, (C): Soluble sugar, (D): Starch, XZX24: Xiangzaoxian24, HZY261: Huazheyou261, W: white, R: red, R3B1: 75% red + 25% blue, R1B1: 50% red + 50% blue, R1B3: 25% red + 75% blue, B: blue. Different lowercase letters denote statistical differences among treatments of a cultivar at the 5% level according to LSD test. Error bars above mean indicate standard error (n = 3).
Ijms 24 10706 g003
Figure 4. Effects of different light qualities on activities of carbon metabolism enzymes of rice seedlings. (A): Soluble acid invertase (SAI), (B): Neutral invertase (NI), (C): Sucrose synthase (SS), (D): Sucrose phosphate synthase (SPS), XZX24: Xiangzaoxian24, HZY261: Huazheyou261, W: white, R: red, R3B1: 75% red + 25% blue, R1B1: 50% red + 50% blue, R1B3: 25% red + 75% blue, B: blue. Different lowercase letters denote statistical differences among treatments of a cultivar at the 5% level according to LSD test. Error bars above mean indicate standard error (n = 3).
Figure 4. Effects of different light qualities on activities of carbon metabolism enzymes of rice seedlings. (A): Soluble acid invertase (SAI), (B): Neutral invertase (NI), (C): Sucrose synthase (SS), (D): Sucrose phosphate synthase (SPS), XZX24: Xiangzaoxian24, HZY261: Huazheyou261, W: white, R: red, R3B1: 75% red + 25% blue, R1B1: 50% red + 50% blue, R1B3: 25% red + 75% blue, B: blue. Different lowercase letters denote statistical differences among treatments of a cultivar at the 5% level according to LSD test. Error bars above mean indicate standard error (n = 3).
Ijms 24 10706 g004
Figure 5. Effects of different light qualities on key gene expression related to carbon metabolism of rice seedlings. (A): Relative expression level of VIN1, (B): Relative expression level of NIN1, (C): Relative expression level of SUS1, (D): Relative expression level of SPS1, XZX24: Xiangzaoxian24, HZY261: Huazheyou261, W: white, R: red, R3B1: 75% red + 25% blue, R1B1: 50% red + 50% blue, R1B3: 25% red + 75% blue, B: blue. Different lowercase letters denote statistical differences among treatments of a cultivar at the 5% level according to LSD test. Error bars above mean indicate standard error (n = 3).
Figure 5. Effects of different light qualities on key gene expression related to carbon metabolism of rice seedlings. (A): Relative expression level of VIN1, (B): Relative expression level of NIN1, (C): Relative expression level of SUS1, (D): Relative expression level of SPS1, XZX24: Xiangzaoxian24, HZY261: Huazheyou261, W: white, R: red, R3B1: 75% red + 25% blue, R1B1: 50% red + 50% blue, R1B3: 25% red + 75% blue, B: blue. Different lowercase letters denote statistical differences among treatments of a cultivar at the 5% level according to LSD test. Error bars above mean indicate standard error (n = 3).
Ijms 24 10706 g005
Figure 6. Effects of different light qualities on nitrogen metabolite of rice seedlings. (A): Nitrate nitrogen, (B): Ammonium nitrogen, (C): Free amino acid, (D): Soluble protein, XZX24: Xiangzaoxian24, HZY261: Huazheyou261, W: white, R: red, R3B1: 75% red + 25% blue, R1B1: 50% red + 50% blue, R1B3: 25% red + 75% blue, B: blue. Different lowercase letters denote statistical differences among treatments of a cultivar at the 5% level according to LSD test. Error bars above mean indicate standard error (n = 3).
Figure 6. Effects of different light qualities on nitrogen metabolite of rice seedlings. (A): Nitrate nitrogen, (B): Ammonium nitrogen, (C): Free amino acid, (D): Soluble protein, XZX24: Xiangzaoxian24, HZY261: Huazheyou261, W: white, R: red, R3B1: 75% red + 25% blue, R1B1: 50% red + 50% blue, R1B3: 25% red + 75% blue, B: blue. Different lowercase letters denote statistical differences among treatments of a cultivar at the 5% level according to LSD test. Error bars above mean indicate standard error (n = 3).
Ijms 24 10706 g006
Figure 7. Effects of different light qualities on activities of nitrogen metabolism enzymes of rice seedlings. (A): Nitrate reductase (NR), (B): Asparagine synthetase (AS), (C): Glutamate synthetase (GOGAT), (D): Glutamine synthesis (GS), XZX24: Xiangzaoxian24, HZY261: Huazheyou261, W: white, R: red, R3B1: 75% red + 25% blue, R1B1: 50% red + 50% blue, R1B3: 25% red + 75% blue, B: blue. Different lowercase letters denote statistical differences among treatments of a cultivar at the 5% level according to LSD test. Error bars above mean indicate standard error (n = 3).
Figure 7. Effects of different light qualities on activities of nitrogen metabolism enzymes of rice seedlings. (A): Nitrate reductase (NR), (B): Asparagine synthetase (AS), (C): Glutamate synthetase (GOGAT), (D): Glutamine synthesis (GS), XZX24: Xiangzaoxian24, HZY261: Huazheyou261, W: white, R: red, R3B1: 75% red + 25% blue, R1B1: 50% red + 50% blue, R1B3: 25% red + 75% blue, B: blue. Different lowercase letters denote statistical differences among treatments of a cultivar at the 5% level according to LSD test. Error bars above mean indicate standard error (n = 3).
Ijms 24 10706 g007
Figure 8. Effects of different light qualities on key gene expression related to nitrogen metabolism of rice seedlings. (A): Relative expression level of AS1, (B): Relative expression level of NIA1, (C): Relative expression level of NADHGOGAT1, (D): Relative expression level of GS11, XZX24: Xiangzaoxian24, HZY261: Huazheyou261, W: white, R: red, R3B1: 75% red + 25% blue, R1B1: 50% red + 50% blue, R1B3: 25% red + 75% blue, B: blue. Different lowercase letters denote statistical differences among treatments of a cultivar at the 5% level according to LSD test. Error bars above mean indicate standard error (n = 3).
Figure 8. Effects of different light qualities on key gene expression related to nitrogen metabolism of rice seedlings. (A): Relative expression level of AS1, (B): Relative expression level of NIA1, (C): Relative expression level of NADHGOGAT1, (D): Relative expression level of GS11, XZX24: Xiangzaoxian24, HZY261: Huazheyou261, W: white, R: red, R3B1: 75% red + 25% blue, R1B1: 50% red + 50% blue, R1B3: 25% red + 75% blue, B: blue. Different lowercase letters denote statistical differences among treatments of a cultivar at the 5% level according to LSD test. Error bars above mean indicate standard error (n = 3).
Ijms 24 10706 g008
Figure 9. Cluster heat map analysis summarizing rice seedlings responses to light quality treatments in two varieties. (A): XZX24 (Xiangzaoxian24), (B): HZY261 (Huazheyou261), W: white, R: red, R3B1: 75% red + 25% blue, R1B1: 50% red + 50% blue, R1B3: 25% red + 75% blue, B: blue. Results are visualized using a false color scale with blue indicating an increase and red a decrease of the response parameters.
Figure 9. Cluster heat map analysis summarizing rice seedlings responses to light quality treatments in two varieties. (A): XZX24 (Xiangzaoxian24), (B): HZY261 (Huazheyou261), W: white, R: red, R3B1: 75% red + 25% blue, R1B1: 50% red + 50% blue, R1B3: 25% red + 75% blue, B: blue. Results are visualized using a false color scale with blue indicating an increase and red a decrease of the response parameters.
Ijms 24 10706 g009
Figure 10. Relative spectral value of six treatments. (A): W, 100% white, (B): R, 100% red, (C): R3B1, 75% red + 25% blue, (D): R1B1, 50% red + 50% blue, (E): R1B3, 25% red + 75% blue, (F): B, 100% blue.
Figure 10. Relative spectral value of six treatments. (A): W, 100% white, (B): R, 100% red, (C): R3B1, 75% red + 25% blue, (D): R1B1, 50% red + 50% blue, (E): R1B3, 25% red + 75% blue, (F): B, 100% blue.
Ijms 24 10706 g010
Table 1. Effects of different light qualities on morphogenesis of rice seedlings.
Table 1. Effects of different light qualities on morphogenesis of rice seedlings.
VarietyTreatmentsPlant Height
(cm)
First Leaf Sheath Length (cm)Stem Width
(mm)
Leaf Area
(mm2)
Root Volume
(mm3)
XZX24W24.36 ± 0.38 b5.46 ± 0.11 b0.99 ± 0.02 cd973.09 ± 16.55 c204.64 ± 2.02 c
R30.98 ± 0.21 a6.84 ± 0.21 a0.95 ± 0.02 d1169.46 ± 6.57 a186.12 ± 0.83 d
R3B124.26 ± 0.36 b5.50 ± 0.16 b1.04 ± 0.02 c925.41 ± 5.28 cd268.04 ± 3.04 a
R1B123.46 ± 0.70 b5.28 ± 0.07 b1.22 ± 0.02 b946.09 ± 12.53 c259.41 ± 4.68 a
R1B319.26 ± 0.54 c4.64 ± 0.04 c1.22 ± 0.01 b1036.45 ± 31.09 b231.24 ± 3.14 b
B16.50 ± 0.25 d4.30 ± 0.08 c1.28 ± 0.01 a871.43 ± 30.7 d156.32 ± 2.55 e
HZY261W24.18 ± 0.84 b5.84 ± 0.29 b0.86 ± 0.02 bc901.13 ± 6.83 ab146.68 ± 1.94 c
R28.16 ± 0.97 a6.74 ± 0.15 a0.82 ± 0.01 c937.32 ± 5.10 a127.52 ± 3.41 d
R3B123.58 ± 0.29 b4.88 ± 0.15 c0.84 ± 0.01 c812.18 ± 1.77 c210.77 ± 3.90 a
R1B122.52 ± 0.82 bc4.20 ± 0.30 d0.92 ± 0.01 b865.44 ± 6.77 b195.13 ± 3.78 b
R1B321.08 ± 0.38 cd4.08 ± 0.12 d1.04 ± 0.04 a900.61 ± 15.23 ab185.32 ± 6.74 b
B19.32 ± 0.85 d3.92 ± 0.14 d1.06 ± 0.02 a867.78 ± 25.80 b108.09 ± 0.89 e
Note: The data were presented as mean value ± standard error (SE) of three replicates. Different lowercase letters denote statistical differences between light quality treatments of a variety at the 5% level according to LSD test. XZX24: Xiangzaoxian24, HZY261: Huazheyou261, W white, R: red, R3B1: 75% red + 25% blue, R1B1: 50% red + 50% blue, R1B3: 25% red + 75% blue, B: blue.
Table 2. Accessions of gene and sequence of RT-PCR Primers.
Table 2. Accessions of gene and sequence of RT-PCR Primers.
Gene NameAccession No.Up-Primer (5′-3′)Down-Primer (5′-3′)
OsActin3Os03g0718100CCACTATGTTCCCTGGCATTGTACTCAGCCTTGGCAATCC
GS11Os02g0735200CACCAACAAGAGGCACAATGACTCCCACTGTCCTGGCAT
NADHGOGAT1Os01g0681900GTGCAGCCTGTTGCAGCATAACGGCATTTCACCATGCAAATC
SUS1Os03g0401300CATCTCAGGCTGAGACTCTGACAAATTCAATCGACCTTACTT
SPS1Os01g0919400TAGCAATGGGAAGCTGGTCTGATCTGCTCCAGCTTGTTCC
AS1Os03g0291500TCGCAGGCGAAGAGGGCTCACGTCCTCAGCGGGGAGACGATGGCGAGACGCTGC
NIA1Os08g0468100TTACAAGGACAACCGCGTCCGGCGTATCCCTTCATGGTGT
NIN1Os03g0314800TGCCACTCAAGATATGCTACCCCACAAGATTGCCAAAATAACC
VIN1Os04g0535600TGGAGCAGCAGCATACAGCCGGATGTAAGCAGAGTTCAGC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ren, M.; Liu, S.; Mao, G.; Tang, C.; Gai, P.; Guo, X.; Zheng, H.; Wang, W.; Tang, Q. Simultaneous Application of Red and Blue Light Regulate Carbon and Nitrogen Metabolism, Induces Antioxidant Defense System and Promote Growth in Rice Seedlings under Low Light Stress. Int. J. Mol. Sci. 2023, 24, 10706. https://doi.org/10.3390/ijms241310706

AMA Style

Ren M, Liu S, Mao G, Tang C, Gai P, Guo X, Zheng H, Wang W, Tang Q. Simultaneous Application of Red and Blue Light Regulate Carbon and Nitrogen Metabolism, Induces Antioxidant Defense System and Promote Growth in Rice Seedlings under Low Light Stress. International Journal of Molecular Sciences. 2023; 24(13):10706. https://doi.org/10.3390/ijms241310706

Chicago/Turabian Style

Ren, Maofei, Shanzhen Liu, Guiling Mao, Chengzhu Tang, Panpan Gai, Xiaoli Guo, Huabin Zheng, Weiqin Wang, and Qiyuan Tang. 2023. "Simultaneous Application of Red and Blue Light Regulate Carbon and Nitrogen Metabolism, Induces Antioxidant Defense System and Promote Growth in Rice Seedlings under Low Light Stress" International Journal of Molecular Sciences 24, no. 13: 10706. https://doi.org/10.3390/ijms241310706

APA Style

Ren, M., Liu, S., Mao, G., Tang, C., Gai, P., Guo, X., Zheng, H., Wang, W., & Tang, Q. (2023). Simultaneous Application of Red and Blue Light Regulate Carbon and Nitrogen Metabolism, Induces Antioxidant Defense System and Promote Growth in Rice Seedlings under Low Light Stress. International Journal of Molecular Sciences, 24(13), 10706. https://doi.org/10.3390/ijms241310706

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop