MicroRNA-675-5p Overexpression Is an Independent Prognostic Molecular Biomarker of Short-Term Relapse and Poor Overall Survival in Colorectal Cancer
Abstract
1. Introduction
2. Results
2.1. The Expression Levels of miR-675-5p Are Lower in CRC Tissue Specimens Than in Adjacent Non-Cancerous Colorectal Tissue Specimens
2.2. High Levels of miR-675-5p Predict an Unfavorable Outcome for CRC Patient Survival
2.3. miR-675-5p Expression Retains Its Unfavorable Prognostic Significance Independently of Other Eshtablished Prognostic Factors
2.4. miR-675-5p Is an Unfavorable Prognostic Marker in Distinct Subgroups of CRC Patients
3. Discussion
4. Materials and Methods
4.1. Collection of Colorectal Tissue Samples
4.2. Characteristics of Tumors and Survival Outcomes of the CRC Patient Cohort
4.3. Cell Culture, Total RNA Isolation, In Vitro Polyadenylation, and cDNA Synthesis
4.4. Primer Design and Real-Time Quantitative Polymerase Chain Reaction (qPCR)
4.5. Biostatistics
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Siegel, R.L.; Wagle, N.S.; Cercek, A.; Smith, R.A.; Jemal, A. Colorectal cancer statistics, 2023. CA Cancer J. Clin. 2023, 73, 233–254. [Google Scholar] [CrossRef]
- Baidoun, F.; Elshiwy, K.; Elkeraie, Y.; Merjaneh, Z.; Khoudari, G.; Sarmini, M.T.; Gad, M.; Al-Husseini, M.; Saad, A. Colorectal Cancer Epidemiology: Recent Trends and Impact on Outcomes. Curr. Drug Targets 2021, 22, 998–1009. [Google Scholar] [CrossRef] [PubMed]
- Kerimis, D.; Kontos, C.K.; Christodoulou, S.; Papadopoulos, I.N.; Scorilas, A. Elevated expression of miR-24-3p is a potentially adverse prognostic factor in colorectal adenocarcinoma. Clin. Biochem. 2017, 50, 285–292. [Google Scholar] [CrossRef] [PubMed]
- Muller, M.F.; Ibrahim, A.E.; Arends, M.J. Molecular pathological classification of colorectal cancer. Virchows Arch. 2016, 469, 125–134. [Google Scholar] [CrossRef]
- Dekker, E.; Tanis, P.J.; Vleugels, J.L.A.; Kasi, P.M.; Wallace, M.B. Colorectal cancer. Lancet 2019, 394, 1467–1480. [Google Scholar] [CrossRef] [PubMed]
- Papatsirou, M.; Artemaki, P.I.; Scorilas, A.; Kontos, C.K. The role of circular RNAs in therapy resistance of patients with solid tumors. Pers. Med. 2020, 17, 469–490. [Google Scholar] [CrossRef]
- Lech, G.; Slotwinski, R.; Slodkowski, M.; Krasnodebski, I.W. Colorectal cancer tumour markers and biomarkers: Recent therapeutic advances. World J. Gastroenterol. 2016, 22, 1745–1755. [Google Scholar] [CrossRef]
- Biller, L.H.; Schrag, D. Diagnosis and Treatment of Metastatic Colorectal Cancer: A Review. JAMA 2021, 325, 669–685. [Google Scholar] [CrossRef]
- Artemaki, P.I.; Papatsirou, M.; Boti, M.A.; Adamopoulos, P.G.; Christodoulou, S.; Vassilacopoulou, D.; Scorilas, A.; Kontos, C.K. Revised Exon Structure of l-DOPA Decarboxylase (DDC) Reveals Novel Splice Variants Associated with Colorectal Cancer Progression. Int. J. Mol. Sci. 2020, 21, 8568. [Google Scholar] [CrossRef]
- Slack, F.J.; Chinnaiyan, A.M. The Role of Non-coding RNAs in Oncology. Cell 2019, 179, 1033–1055. [Google Scholar] [CrossRef]
- Karousi, P.; Papanota, A.M.; Artemaki, P.I.; Liacos, C.I.; Patseas, D.; Mavrianou-Koutsoukou, N.; Liosi, A.A.; Kalioraki, M.A.; Ntanasis-Stathopoulos, I.; Gavriatopoulou, M.; et al. tRNA Derivatives in Multiple Myeloma: Investigation of the Potential Value of a tRNA-Derived Molecular Signature. Biomedicines 2021, 9, 1811. [Google Scholar] [CrossRef]
- Chen, L.; He, M.; Zhang, M.; Sun, Q.; Zeng, S.; Zhao, H.; Yang, H.; Liu, M.; Ren, S.; Meng, X.; et al. The Role of non-coding RNAs in colorectal cancer, with a focus on its autophagy. Pharmacol. Ther. 2021, 226, 107868. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Liu, R.; Yang, F.; Cheng, R.; Chen, X.; Cui, S.; Gu, Y.; Sun, W.; You, C.; Liu, Z.; et al. miR-19a promotes colorectal cancer proliferation and migration by targeting TIA1. Mol. Cancer 2017, 16, 53. [Google Scholar] [CrossRef]
- Karousi, P.; Artemaki, P.I.; Sotiropoulou, C.D.; Christodoulou, S.; Scorilas, A.; Kontos, C.K. Identification of Two Novel Circular RNAs Deriving from BCL2L12 and Investigation of Their Potential Value as a Molecular Signature in Colorectal Cancer. Int. J. Mol. Sci. 2020, 21, 8867. [Google Scholar] [CrossRef]
- Papatsirou, M.; Diamantopoulos, M.A.; Katsaraki, K.; Kletsas, D.; Kontos, C.K.; Scorilas, A. Identification of Novel Circular RNAs of the Human Protein Arginine Methyltransferase 1 (PRMT1) Gene, Expressed in Breast Cancer Cells. Genes 2022, 13, 1133. [Google Scholar] [CrossRef]
- Papanota, A.M.; Karousi, P.; Kontos, C.K.; Artemaki, P.I.; Liacos, C.I.; Papadimitriou, M.A.; Bagratuni, T.; Eleutherakis-Papaiakovou, E.; Malandrakis, P.; Ntanasis-Stathopoulos, I.; et al. A Cancer-Related microRNA Signature Shows Biomarker Utility in Multiple Myeloma. Int. J. Mol. Sci. 2021, 22, 13144. [Google Scholar] [CrossRef] [PubMed]
- Papatsirou, M.; Artemaki, P.I.; Karousi, P.; Scorilas, A.; Kontos, C.K. Circular RNAs: Emerging Regulators of the Major Signaling Pathways Involved in Cancer Progression. Cancers 2021, 13, 2744. [Google Scholar] [CrossRef]
- Papatsirou, M.; Adamopoulos, P.G.; Artemaki, P.I.; Georganti, V.P.; Scorilas, A.; Vassilacopoulou, D.; Kontos, C.K. Next-generation sequencing reveals alternative L-DOPA decarboxylase (DDC) splice variants bearing novel exons, in human hepatocellular and lung cancer cells. Gene 2021, 768, 145262. [Google Scholar] [CrossRef] [PubMed]
- Smolarz, B.; Durczynski, A.; Romanowicz, H.; Szyllo, K.; Hogendorf, P. miRNAs in Cancer (Review of Literature). Int. J. Mol. Sci. 2022, 23, 2805. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Cheng, L.; Wu, H.; Li, G. Mechanisms and prospects of circular RNAs and their interacting signaling pathways in colorectal cancer. Front. Oncol. 2022, 12, 949656. [Google Scholar] [CrossRef]
- Das, P.K.; Islam, F.; Lam, A.K. The Roles of Cancer Stem Cells and Therapy Resistance in Colorectal Carcinoma. Cells 2020, 9, 1392. [Google Scholar] [CrossRef]
- Zhang, N.; Hu, X.; Du, Y.; Du, J. The role of miRNAs in colorectal cancer progression and chemoradiotherapy. Biomed. Pharmacother. 2021, 134, 111099. [Google Scholar] [CrossRef]
- Wu, K.F.; Liang, W.C.; Feng, L.; Pang, J.X.; Waye, M.M.; Zhang, J.F.; Fu, W.M. H19 mediates methotrexate resistance in colorectal cancer through activating Wnt/beta-catenin pathway. Exp. Cell. Res. 2017, 350, 312–317. [Google Scholar] [CrossRef]
- Yang, X.; Lou, Y.; Wang, M.; Liu, C.; Liu, Y.; Huang, W. miR-675 promotes colorectal cancer cell growth dependent on tumor suppressor DMTF1. Mol. Med. Rep. 2019, 19, 1481–1490. [Google Scholar] [CrossRef]
- Tsang, W.P.; Ng, E.K.; Ng, S.S.; Jin, H.; Yu, J.; Sung, J.J.; Kwok, T.T. Oncofetal H19-derived miR-675 regulates tumor suppressor RB in human colorectal cancer. Carcinogenesis 2010, 31, 350–358. [Google Scholar] [CrossRef] [PubMed]
- Costa, V.; Lo Dico, A.; Rizzo, A.; Rajata, F.; Tripodi, M.; Alessandro, R.; Conigliaro, A. MiR-675-5p supports hypoxia induced epithelial to mesenchymal transition in colon cancer cells. Oncotarget 2017, 8, 24292–24302. [Google Scholar] [CrossRef] [PubMed]
- Zichittella, C.; Barreca, M.M.; Cordaro, A.; Corrado, C.; Alessandro, R.; Conigliaro, A. Mir-675-5p supports hypoxia-induced drug resistance in colorectal cancer cells. BMC Cancer 2022, 22, 567. [Google Scholar] [CrossRef] [PubMed]
- Zhang, R.; Xu, J.; Zhao, J.; Liu, F. Upregulated serum miR-675 predicts poor prognosis for colorectal cancer. Int. J. Clin. Exp. Pathol 2017, 10, 8043–8049. [Google Scholar] [PubMed]
- Campos-da-Paz, M.; Dorea, J.G.; Galdino, A.S.; Lacava, Z.G.M.; de Fatima Menezes Almeida Santos, M. Carcinoembryonic Antigen (CEA) and Hepatic Metastasis in Colorectal Cancer: Update on Biomarker for Clinical and Biotechnological Approaches. Recent Pat. Biotechnol. 2018, 12, 269–279. [Google Scholar] [CrossRef] [PubMed]
- Rao, H.; Wu, H.; Huang, Q.; Yu, Z.; Zhong, Z. Clinical Value of Serum CEA, CA24-2 and CA19-9 in Patients with Colorectal Cancer. Clin. Lab. 2021, 67. [Google Scholar] [CrossRef] [PubMed]
- Kontos, C.K.; Adamopoulos, P.G.; Scorilas, A. Prognostic and predictive biomarkers in prostate cancer. Expert Rev. Mol. Diagn 2015, 15, 1567–1576. [Google Scholar] [CrossRef] [PubMed]
- Tsiakanikas, P.; Adamopoulos, P.G.; Tsirba, D.; Artemaki, P.I.; Papadopoulos, I.N.; Kontos, C.K.; Scorilas, A. High Expression of a tRNA(Pro) Derivative Associates with Poor Survival and Independently Predicts Colorectal Cancer Recurrence. Biomedicines 2022, 10, 1120. [Google Scholar] [CrossRef] [PubMed]
- Artemaki, P.I.; Kontos, C.K. Editorial for the Special Issue “Molecular Biomarkers in Colorectal Adenocarcinoma”. Int. J. Mol. Sci. 2021, 22, 2052. [Google Scholar] [CrossRef]
- Kontos, C.K.; Avgeris, M.; Vassilacopoulou, D.; Ardavanis, A.; Scorilas, A. Molecular Effects of Treatment of Human Colorectal Cancer Cells with Natural and Classical Chemotherapeutic Drugs: Alterations in the Expression of Apoptosis-related BCL2 Family Members, Including BCL2L12. Curr. Pharm. Biotechnol. 2018, 19, 1064–1075. [Google Scholar] [CrossRef]
- Artemaki, P.I.; Scorilas, A.; Kontos, C.K. Circular RNAs: A New Piece in the Colorectal Cancer Puzzle. Cancers 2020, 12, 2464. [Google Scholar] [CrossRef]
- Alexopoulou, D.K.; Kontos, C.K.; Christodoulou, S.; Papadopoulos, I.N.; Scorilas, A. KLK11 mRNA expression predicts poor disease-free and overall survival in colorectal adenocarcinoma patients. Biomark. Med. 2014, 8, 671–685. [Google Scholar] [CrossRef]
- Christodoulou, S.; Alexopoulou, D.K.; Kontos, C.K.; Scorilas, A.; Papadopoulos, I.N. Kallikrein-related peptidase-6 (KLK6) mRNA expression is an independent prognostic tissue biomarker of poor disease-free and overall survival in colorectal adenocarcinoma. Tumour Biol. 2014, 35, 4673–4685. [Google Scholar] [CrossRef] [PubMed]
- Kontos, C.K.; Chantzis, D.; Papadopoulos, I.N.; Scorilas, A. Kallikrein-related peptidase 4 (KLK4) mRNA predicts short-term relapse in colorectal adenocarcinoma patients. Cancer Lett. 2013, 330, 106–112. [Google Scholar] [CrossRef] [PubMed]
- Kontos, C.K.; Mavridis, K.; Talieri, M.; Scorilas, A. Kallikrein-related peptidases (KLKs) in gastrointestinal cancer: Mechanistic and clinical aspects. Thromb. Haemost. 2013, 110, 450–457. [Google Scholar] [CrossRef]
- Kontos, C.K.; Scorilas, A. Kallikrein-related peptidases (KLKs): A gene family of novel cancer biomarkers. Clin. Chem. Lab. Med. 2012, 50, 1877–1891. [Google Scholar] [CrossRef]
- Kontos, C.K.; Papadopoulos, I.N.; Fragoulis, E.G.; Scorilas, A. Quantitative expression analysis and prognostic significance of L-DOPA decarboxylase in colorectal adenocarcinoma. Br. J. Cancer 2010, 102, 1384–1390. [Google Scholar] [CrossRef] [PubMed]
- Kontos, C.K.; Papadopoulos, I.N.; Scorilas, A. Quantitative expression analysis and prognostic significance of the novel apoptosis-related gene BCL2L12 in colon cancer. Biol. Chem. 2008, 389, 1467–1475. [Google Scholar] [CrossRef]
- Kontos, C.K.; Christodoulou, M.I.; Scorilas, A. Apoptosis-related BCL2-family members: Key players in chemotherapy. Anticancer Agents Med. Chem. 2014, 14, 353–374. [Google Scholar] [CrossRef] [PubMed]
- Artemaki, P.I.; Sklirou, A.D.; Kontos, C.K.; Liosi, A.A.; Gianniou, D.D.; Papadopoulos, I.N.; Trougakos, I.P.; Scorilas, A. High clusterin (CLU) mRNA expression levels in tumors of colorectal cancer patients predict a poor prognostic outcome. Clin. Biochem. 2020, 75, 62–69. [Google Scholar] [CrossRef] [PubMed]
- Kalioraki, M.A.; Artemaki, P.I.; Sklirou, A.D.; Kontos, C.K.; Adamopoulos, P.G.; Papadopoulos, I.N.; Trougakos, I.P.; Scorilas, A. Heat shock protein beta 3 (HSPB3) is an unfavorable molecular biomarker in colorectal adenocarcinoma. Mol. Carcinog. 2020, 59, 116–125. [Google Scholar] [CrossRef]
- Condrat, C.E.; Thompson, D.C.; Barbu, M.G.; Bugnar, O.L.; Boboc, A.; Cretoiu, D.; Suciu, N.; Cretoiu, S.M.; Voinea, S.C. miRNAs as Biomarkers in Disease: Latest Findings Regarding Their Role in Diagnosis and Prognosis. Cells 2020, 9, 276. [Google Scholar] [CrossRef]
- Skourti, E.; Logotheti, S.; Kontos, C.K.; Pavlopoulou, A.; Dimoragka, P.T.; Trougakos, I.P.; Gorgoulis, V.; Scorilas, A.; Michalopoulos, I.; Zoumpourlis, V. Progression of mouse skin carcinogenesis is associated with the orchestrated deregulation of mir-200 family members, mir-205 and their common targets. Mol. Carcinog. 2016, 55, 1229–1242. [Google Scholar] [CrossRef]
- Ferraro, A.; Kontos, C.K.; Boni, T.; Bantounas, I.; Siakouli, D.; Kosmidou, V.; Vlassi, M.; Spyridakis, Y.; Tsipras, I.; Zografos, G.; et al. Epigenetic regulation of miR-21 in colorectal cancer: ITGB4 as a novel miR-21 target and a three-gene network (miR-21-ITGBeta4-PDCD4) as predictor of metastatic tumor potential. Epigenetics 2014, 9, 129–141. [Google Scholar] [CrossRef]
- Diamantopoulos, M.A.; Kontos, C.K.; Kerimis, D.; Papadopoulos, I.N.; Scorilas, A. Upregulated miR-16 expression is an independent indicator of relapse and poor overall survival of colorectal adenocarcinoma patients. Clin. Chem. Lab. Med. 2017, 55, 737–747. [Google Scholar] [CrossRef] [PubMed]
- Tsiakanikas, P.; Kontos, C.K.; Kerimis, D.; Papadopoulos, I.N.; Scorilas, A. High microRNA-28-5p expression in colorectal adenocarcinoma predicts short-term relapse of node-negative patients and poor overall survival of patients with non-metastatic disease. Clin. Chem. Lab. Med. 2018, 56, 990–1000. [Google Scholar] [CrossRef]
- Adamopoulos, P.G.; Kontos, C.K.; Rapti, S.M.; Papadopoulos, I.N.; Scorilas, A. miR-224 overexpression is a strong and independent prognosticator of short-term relapse and poor overall survival in colorectal adenocarcinoma. Int. J. Oncol. 2015, 46, 849–859. [Google Scholar] [CrossRef] [PubMed]
- Kontos, C.K.; Tsiakanikas, P.; Avgeris, M.; Papadopoulos, I.N.; Scorilas, A. miR-15a-5p, A Novel Prognostic Biomarker, Predicting Recurrent Colorectal Adenocarcinoma. Mol. Diagn. Ther. 2017, 21, 453–464. [Google Scholar] [CrossRef] [PubMed]
- Rapti, S.M.; Kontos, C.K.; Christodoulou, S.; Papadopoulos, I.N.; Scorilas, A. miR-34a overexpression predicts poor prognostic outcome in colorectal adenocarcinoma, independently of clinicopathological factors with established prognostic value. Clin. Biochem. 2017, 50, 918–924. [Google Scholar] [CrossRef]
- Rapti, S.M.; Kontos, C.K.; Papadopoulos, I.N.; Scorilas, A. Enhanced miR-182 transcription is a predictor of poor overall survival in colorectal adenocarcinoma patients. Clin. Chem. Lab. Med. 2014, 52, 1217–1227. [Google Scholar] [CrossRef]
- Rapti, S.M.; Kontos, C.K.; Papadopoulos, I.N.; Scorilas, A. High miR-96 levels in colorectal adenocarcinoma predict poor prognosis, particularly in patients without distant metastasis at the time of initial diagnosis. Tumour Biol. 2016, 37, 11815–11824. [Google Scholar] [CrossRef]
- Abo-Elela, D.A.; Salem, A.M.; Swellam, M.; Hegazy, M.G. Potential diagnostic role of circulating MiRNAs in colorectal cancer. Int. J. Immunopathol. Pharmacol. 2023, 37, 3946320221144565. [Google Scholar] [CrossRef] [PubMed]
- Muller, V.; Oliveira-Ferrer, L.; Steinbach, B.; Pantel, K.; Schwarzenbach, H. Interplay of lncRNA H19/miR-675 and lncRNA NEAT1/miR-204 in breast cancer. Mol. Oncol. 2019, 13, 1137–1149. [Google Scholar] [CrossRef] [PubMed]
- Ghaedi, H.; Mozaffari, M.A.N.; Salehi, Z.; Ghasemi, H.; Zadian, S.S.; Alipoor, S.; Hadianpour, S.; Alipoor, B. Co-expression profiling of plasma miRNAs and long noncoding RNAs in gastric cancer patients. Gene 2019, 687, 135–142. [Google Scholar] [CrossRef]
- Hu, Y.; Qi, Q.; Zheng, Y.; Wang, H.; Zhou, J.; Hao, Z.; Meng, J.; Liang, C. Nomogram for predicting the overall survival of patients with early-onset prostate cancer: A population-based retrospective study. Cancer Med. 2022, 11, 3260–3271. [Google Scholar] [CrossRef]
- Gervaz, P.; Bucher, P.; Morel, P. Two colons-two cancers: Paradigm shift and clinical implications. J. Surg. Oncol. 2004, 88, 261–266. [Google Scholar] [CrossRef]
- Stintzing, S.; Tejpar, S.; Gibbs, P.; Thiebach, L.; Lenz, H.J. Understanding the role of primary tumour localisation in colorectal cancer treatment and outcomes. Eur. J. Cancer 2017, 84, 69–80. [Google Scholar] [CrossRef]
- Eslamizadeh, S.; Zare, A.A.; Talebi, A.; Tabaeian, S.P.; Eshkiki, Z.S.; Heydari-Zarnagh, H.; Akbari, A. Differential Expression of miR-20a and miR-145 in Colorectal Tumors as Potential Location-specific miRNAs. microRNA 2021, 10, 66–73. [Google Scholar] [CrossRef]
- Zheng, Z.H.; Wu, D.M.; Fan, S.H.; Zhang, Z.F.; Chen, G.Q.; Lu, J. Upregulation of miR-675-5p induced by lncRNA H19 was associated with tumor progression and development by targeting tumor suppressor p53 in non-small cell lung cancer. J. Cell. Biochem. 2019, 120, 18724–18735. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Shi, X.; Yang, M.; Luo, J.; Gao, Q.; Wang, X.; Wu, Y.; Tian, Y.; Wu, F.; Zhou, H. Glycolysis reprogramming in cancer-associated fibroblasts promotes the growth of oral cancer through the lncRNA H19/miR-675-5p/PFKFB3 signaling pathway. Int. J. Oral Sci. 2021, 13, 12. [Google Scholar] [CrossRef] [PubMed]
- Sawai, S.; Wong, P.F.; Ramasamy, T.S. Hypoxia-regulated microRNAs: The molecular drivers of tumor progression. Crit. Rev. Biochem. Mol. Biol. 2022, 57, 351–376. [Google Scholar] [CrossRef]
- Katsaraki, K.; Artemaki, P.I.; Papageorgiou, S.G.; Pappa, V.; Scorilas, A.; Kontos, C.K. Identification of a novel, internal tRNA-derived RNA fragment as a new prognostic and screening biomarker in chronic lymphocytic leukemia, using an innovative quantitative real-time PCR assay. Leuk. Res. 2019, 87, 106234. [Google Scholar] [CrossRef] [PubMed]
- Karousi, P.; Katsaraki, K.; Papageorgiou, S.G.; Pappa, V.; Scorilas, A.; Kontos, C.K. Identification of a novel tRNA-derived RNA fragment exhibiting high prognostic potential in chronic lymphocytic leukemia. Hematol. Oncol. 2019, 37, 498–504. [Google Scholar] [CrossRef]
Number of Patients (%) | |
---|---|
Gender | |
Male | 114 (52.3%) |
Female | 104 (47.7%) |
Tumor location | |
Colon | 148 (67.9%) |
Rectum | 70 (32.1%) |
Histological grade | |
I | 19 (8.7%) |
II | 167 (76.6%) |
III | 32 (14.7%) |
T (tumor invasion) | |
T1 | 6 (2.8%) |
T2 | 26 (11.9%) |
T3 | 135 (61.9%) |
T4 | 51 (23.4%) |
N (nodal status) | |
N0 | 122 (56.0%) |
N1 | 57 (26.1%) |
N2 | 39 (17.9%) |
M (distant metastasis) | |
M0 | 191 (87.6%) |
M1 | 27 (12.4%) |
TNM stage | |
I | 28 (12.8%) |
II | 89 (40.8%) |
III | 74 (34.0%) |
IV | 27 (12.4%) |
Radiotherapy | |
No | 169 (83.3%) |
Yes | 34 (16.7%) |
Chemotherapy | |
No | 86 (42.4%) |
Yes | 117 (57.6%) |
Variable | Mean ± SEM | Range | Quartiles | ||
---|---|---|---|---|---|
1st | 2nd (Median) | 3rd | |||
Normalized miR-675-5p expression (RQU) | |||||
in cancerous tissues (n = 218) | 2542 ± 496.7 | 0.61–48,781 | 3.27 | 20.74 | 692.4 |
in normal tissues (n = 90) | 5721 ± 1728 | 0.71–81,457 | 7.03 | 19.65 | 170.7 |
Covariate | HR 1 | 95% CI 2 | p-Value 3 | 95% Bootstrap BCa 4 CI 2 | Bootstrap p-Value 3 | |
---|---|---|---|---|---|---|
Univariate analysis | miR-675-5p expression | |||||
Low | 1.00 | |||||
High | 3.18 | 1.66–6.11 | <0.001 | 1.86–6.86 | <0.001 | |
Tumor location | ||||||
Colon | 1.00 | |||||
Rectum | 1.75 | 1.06–2.91 | 0.030 | 1.02–2.98 | 0.031 | |
Histological grade | ||||||
I | 1.00 | |||||
II | 1.73 | 0.62–4.79 | 0.30 | 0.78–7.72 | 0.25 | |
III | 2.83 | 0.90–8.90 | 0.075 | 1.01–18.43 | 0.049 | |
TNM stage | ||||||
I | 1.00 | |||||
II | 4.28 | 1.01–18.11 | 0.049 | 1.29–26.260 | 0.048 | |
III | 9.61 | 2.31–40.00 | 0.002 | 2.97–67.669 | 0.004 | |
Radiotherapy | ||||||
No | 1.00 | |||||
Yes | 1.81 | 1.02–3.19 | 0.042 | 0.95–3.26 | 0.041 | |
Chemotherapy | ||||||
No | 1.00 | |||||
Yes | 2.33 | 1.33–4.07 | 0.003 | 1.39–4.42 | 0.004 | |
Multivariate (n = 176) | miR-675-5p expression | |||||
Low | 1.00 | |||||
High | 3.07 | 1.59–5.92 | <0.001 | 1.66–8.02 | <0.001 | |
Tumor location | ||||||
Colon | 1.00 | |||||
Rectum | 2.69 | 1.34–5.40 | 0.005 | 1.35–7.40 | 0.011 | |
Histological grade | ||||||
I | 1.00 | |||||
II | 1.06 | 0.37–3.08 | 0.91 | 0.36–5.77 | 0.92 | |
III | 1.60 | 0.48–5.32 | 0.44 | 0.47–11.40 | 0.44 | |
TNM stage | ||||||
I | 1.00 | |||||
II | 4.89 | 1.10–21.72 | 0.037 | 1.46–39.676 | 0.025 | |
III | 9.70 | 2.08–45.22 | 0.004 | 3.04–105.6 | 0.004 | |
Radiotherapy | ||||||
No | 1.00 | |||||
Yes | 0.49 | 0.22–1.09 | 0.081 | 0.16–1.12 | 0.10 | |
Chemotherapy | ||||||
No | 1.00 | |||||
Yes | 1.36 | 0.71–2.61 | 0.35 | 0.56–2.99 | 0.41 |
Covariate | HR 1 | 95% CI 2 | p-Value 3 | 95% Bootstrap BCa 4 CI 2 | Bootstrap p-Value 3 | |
---|---|---|---|---|---|---|
Univariate analysis | miR-675-5p expression | |||||
Low | 1.00 | |||||
High | 4.28 | 2.33–7.85 | <0.001 | 2.53–9.26 | <0.001 | |
Tumor location | ||||||
Colon | 1.00 | |||||
Rectum | 1.62 | 1.07–2.45 | 0.022 | 1.03–2.45 | 0.020 | |
Histological grade | ||||||
I | 1.00 | |||||
II | 1.35 | 0.62–2.94 | 0.45 | 0.66–3.87 | 0.46 | |
III | 2.53 | 1.06–6.02 | 0.036 | 1.06–9.05 | 0.047 | |
TNM stage | ||||||
I | ||||||
II | 2.55 | 0.89–7.32 | 0.082 | 0.95–13.88 | 0.074 | |
III | 5.73 | 2.03–16.16 | <0.001 | 2.31–30.43 | <0.001 | |
IV | 35.24 | 11.88–104.5 | <0.001 | 13.23–200.4 | <0.001 | |
Radiotherapy | ||||||
No | 1.00 | |||||
Yes | 1.62 | 1.00–2.64 | 0.051 | 0.94–2.63 | 0.058 | |
Chemotherapy | ||||||
No | 1.00 | |||||
Yes | 1.84 | 1.19–2.85 | 0.006 | 1.21–2.95 | 0.007 | |
Multivariate (n = 203) | miR-675-5p expression | |||||
Low | 1.00 | |||||
High | 3.87 | 2.10–7.13 | <0.001 | 2.42–7.95 | <0.001 | |
Tumor location | ||||||
Colon | 1.00 | |||||
Rectum | 1.43 | 0.85–2.41 | 0.18 | 0.83–2.60 | 0.20 | |
Histological grade | ||||||
I | 1.00 | |||||
II | 0.76 | 0.33–1.75 | 0.52 | 0.26–2.49 | 0.58 | |
III | 1.16 | 0.46–2.90 | 0.76 | 0.33–3.90 | 0.82 | |
TNM stage | ||||||
I | 1.00 | |||||
II | 2.88 | 0.97–8.53 | 0.056 | 1.05–19.54 | 0.045 | |
III | 6.79 | 2.20–20.99 | <0.001 | 2.33–73.65 | <0.001 | |
IV | 39.17 | 12.06–127.2 | <0.001 | 14.27–417.8 | <0.001 | |
Radiotherapy | ||||||
No | 1.00 | |||||
Yes | 1.08 | 0.57–2.02 | 0.82 | 0.53–2.01 | 0.83 | |
Chemotherapy | ||||||
No | 1.00 | |||||
Yes | 0.78 | 0.46–1.33 | 0.36 | 0.41–1.40 | 0.39 |
Target | Primer Sequence (5′ to 3′) | Direction | Length (nt) | Tm (°C) |
---|---|---|---|---|
miR-675-5p | GAGGCCCGGGTTCGATTC | Forward | 18 | 62 |
SNORD43 | ACTTATTGACGGGCGGACA | 19 | 59 | |
SNORD48 | TGATGATGACCCCAGGTAACTCT | 23 | 59 | |
None (Universal primer) | GCGAGCACAGAATTAATACGAC | Reverse | 22 | 56 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Christodoulou, S.; Sotiropoulou, C.D.; Vassiliu, P.; Danias, N.; Arkadopoulos, N.; Sideris, D.C. MicroRNA-675-5p Overexpression Is an Independent Prognostic Molecular Biomarker of Short-Term Relapse and Poor Overall Survival in Colorectal Cancer. Int. J. Mol. Sci. 2023, 24, 9990. https://doi.org/10.3390/ijms24129990
Christodoulou S, Sotiropoulou CD, Vassiliu P, Danias N, Arkadopoulos N, Sideris DC. MicroRNA-675-5p Overexpression Is an Independent Prognostic Molecular Biomarker of Short-Term Relapse and Poor Overall Survival in Colorectal Cancer. International Journal of Molecular Sciences. 2023; 24(12):9990. https://doi.org/10.3390/ijms24129990
Chicago/Turabian StyleChristodoulou, Spyridon, Christina D. Sotiropoulou, Panteleimon Vassiliu, Nikolaos Danias, Nikolaos Arkadopoulos, and Diamantis C. Sideris. 2023. "MicroRNA-675-5p Overexpression Is an Independent Prognostic Molecular Biomarker of Short-Term Relapse and Poor Overall Survival in Colorectal Cancer" International Journal of Molecular Sciences 24, no. 12: 9990. https://doi.org/10.3390/ijms24129990
APA StyleChristodoulou, S., Sotiropoulou, C. D., Vassiliu, P., Danias, N., Arkadopoulos, N., & Sideris, D. C. (2023). MicroRNA-675-5p Overexpression Is an Independent Prognostic Molecular Biomarker of Short-Term Relapse and Poor Overall Survival in Colorectal Cancer. International Journal of Molecular Sciences, 24(12), 9990. https://doi.org/10.3390/ijms24129990