Efflux-Related Carbapenem Resistance in Acinetobacter baumannii Is Associated with Two-Component Regulatory Efflux Systems’ Alteration and Insertion of ΔAbaR25-Type Island Fragment
Abstract
1. Introduction
2. Results
2.1. Susceptibility Profiles and EPI Effects on Carbapenem Resistance
2.2. Presence and Expression of Efflux Pump Genes
2.3. Amino Acid Sequence analysis of Efflux Pumps and their TCS Regulators
2.4. Core-Genome SNP Phylogenetic Analysis
2.5. Analysis of Genetic Structure of adeRS and adeABC Region in Isolate A. baumannii 96
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains
4.2. Determination of the MICs of AdeABC and AbeM Efflux Pumps Substrates
4.3. Determination of the MICs of Carbapenems with and without Efflux Pump Inhibitors
4.4. Detection of Genes Encoding AdeABC and AbeM Efflux Pumps
4.5. Whole Genome Sequencing
4.6. Core-Genome SNP Phylogenetic Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- McConnell, M.J.; Actis, L.; Pachon, J. Acinetobacter baumannii: Human infections, factors contributing to pathogenesis and animal models. FEMS Microbiol. Rev. 2013, 37, 130–155. [Google Scholar] [CrossRef] [PubMed][Green Version]
- De Benedetto, I.; Lupia, T.; Shbaklo, N.; Bianchi, A.; Concialdi, E.; Penna, M.; Corcione, S.; De Rosa, F.G. Prognostic evaluation of Acinetobacter baumannii ventilator-associated pneumonia in COVID-19. Infez. Med. 2022, 30, 570–576. [Google Scholar] [PubMed]
- Nasr, P. Genetics, epidemiology, and clinical manifestations of multidrug-resistant Acinetobacter baumannii. J. Hosp. Infect. 2020, 104, 4–11. [Google Scholar] [CrossRef] [PubMed]
- WHO Regional Office for Europe/European Centre for Disease Prevention and Control. Antimicrobial Resistance Surveillance in Europe 2022—2020 Data. Copenhagen: WHO Regional Office for Europe 2022. Available online: https://www.ecdc.europa.eu/en/publications-data/antimicrobial-resistance-surveillance-europe-2022-2020-data (accessed on 10 May 2023).
- Krajewska, J.; Laudy, A.E. The European Medicines Agency approved the new antibacterial drugs—Response to the 2017 WHO report on the global problem of multi-drug resistance. Adv. Microbiol. 2021, 60, 249–264. [Google Scholar] [CrossRef]
- Ramirez, M.S.; Bonomo, R.A.; Tolmasky, M.E. Carbapenemases: Transforming Acinetobacter baumannii into a yet more dangerous menace. Biomolecules 2020, 10, 720. [Google Scholar] [CrossRef] [PubMed]
- Rumbo, C.; Gato, E.; López, M.; Ruiz de Alegría, C.; Fernández-Cuenca, F.; Martínez-Martínez, L.; Vila, J.; Pachón, J.; Cisneros, J.M.; Rodríguez-Baño, J. Contribution of efflux pumps, porins, and beta-lactamases to multidrug resistance in clinical isolates of Acinetobacter baumannii. Antimicrob. Agents Chemother. 2013, 57, 5247–5257. [Google Scholar] [CrossRef][Green Version]
- Freire, M.P.; de Oliveira Garcia, D.; Garcia, C.P.; Campagnari Bueno, M.F.; Camargo, C.H.; Kono Magri, A.S.G.; Francisco, G.R.; Reghini, R.; Vieira, M.F.; Ibrahim, K.Y.; et al. Bloodstream infection caused by extensively drug-resistant Acinetobacter baumannii in cancer patients: High mortality associated with delayed treatment rather than with the degree of neutropenia. Clin. Microbiol. Infect. 2016, 22, 352–358. [Google Scholar] [CrossRef]
- Słoczyńska, A.; Wand, M.E.; Tyski, S.; Laudy, A.E. Analysis of blaCHDL genes and insertion sequences related to carbapenem resistance in Acinetobacter baumannii clinical strains isolated in Warsaw, Poland. Int. J. Mol. Sci. 2021, 22, 2486. [Google Scholar] [CrossRef]
- Roy, S.; Junghare, V.; Dutta, S.; Hazra, S.; Basu, S. Differential binding of carbapenems with the AdeABC efflux pump and modulation of the expression of AdeB linked to novel mutations within Two-Component System AdeRS in Carbapenem-Resistant Acinetobacter baumannii. mSystems 2022, 7, e0021722. [Google Scholar] [CrossRef] [PubMed]
- Abdi, S.N.; Ghotaslou, R.; Ganbarov, K.; Mobed, A.; Tanomand, A.; Yousefi, M.; Asgharzadeh, M.; Kafil, H.S. Acinetobacter baumannii efflux pumps and antibiotic resistance. Infect. Drug Resist. 2020, 13, 423–434. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Laudy, A.E. Non-antibiotics, efflux pumps and drug resistance of Gram-negative rods. Pol. J. Microbiol. 2018, 67, 129–135. [Google Scholar] [CrossRef][Green Version]
- Verma, P.; Tiwari, M.; Tiwari, V. Efflux pumps in multidrug-resistant Acinetobacter baumannii: Current status and challenges in the discovery of efflux pumps inhibitors. Microb. Pathog. 2021, 152, 104766. [Google Scholar] [CrossRef] [PubMed]
- Coyne, S.; Courvalin, P.; Perichon, B. Efflux-mediated antibiotic resistance in Acinetobacter spp. Antimicrob. Agents Chemother. 2011, 55, 947–953. [Google Scholar] [CrossRef][Green Version]
- Gerson, S.; Nowak, J.; Zander, E.; Ertel, J.; Wen, Y.; Krut, O.; Seifert, H.; Higgins, P.G. Diversity of mutations in regulatory genes of resistance-nodulation-cell division efflux pumps in association with tigecycline resistance in Acinetobacter baumannii. J. Antimicrob. Chemother. 2018, 73, 1501–1508. [Google Scholar] [CrossRef] [PubMed]
- Xu, C.; Bilya, S.R.; Xu, W. adeABC efflux gene in Acinetobacter baumannii. New Microbes New Infect. 2019, 30, 100549. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Fan, B.; Luo, Y.; Tao, Z.; Nie, Y.; Wang, Y.; Ding, F.; Li, Y.; Gu, D. Comparative analysis of carbapenemases, RND family efflux pumps and biofilm formation potential among Acinetobacter baumannii strains with different carbapenem susceptibility. BMC Infect. Dis. 2021, 21, 841. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Li, Z.; He, X.; Ding, F.; Wu, W.; Luo, Y.; Fan, B.; Cao, H. Overproduction of efflux pumps caused reduced susceptibility to carbapenem under consecutive imipenem-selected stress in Acinetobacter baumannii. Infect. Drug Resist. 2017, 11, 457–467. [Google Scholar] [CrossRef][Green Version]
- Lin, M.F.; Lin, Y.Y.; Yeh, H.W.; Lan, C.Y. Role of the BaeSR two-component system in the regulation of Acinetobacter baumannii adeAB genes and its correlation with tigecycline susceptibility. BMC Microbiol. 2014, 14, 119. [Google Scholar] [CrossRef][Green Version]
- Chang, T.Y.; Huang, B.J.; Sun, J.R.; Perng, C.L.; Chan, M.C.; Yu, C.P.; Chiueh, T.S. AdeR protein regulates adeABC expression by binding to a direct-repeat motif in the intercistronic spacer. Microbiol. Res. 2016, 183, 60–67. [Google Scholar] [CrossRef]
- Sun, J.R.; Perng, C.L.; Chan, M.C.; Morita, Y.; Lin, J.C.; Su, C.M.; Wang, W.Y.; Chang, T.Y.; Chiueh, T.S. A truncated AdeS kinase protein generated by ISAba1 insertion correlates with tigecycline resistance in Acinetobacter baumannii. PLoS ONE 2012, 7, e49534. [Google Scholar] [CrossRef][Green Version]
- Hammerstrom, T.G.; Beabout, K.; Clements, T.P.; Saxer, G.; Shamoo, Y. Acinetobacter baumannii repeatedly evolves a hypermutator phenotype in response to tigecycline that effectively surveys evolutionary trajectories to resistance. PLoS ONE 2015, 10, e0140489. [Google Scholar] [CrossRef] [PubMed]
- Hou, P.F.; Chen, X.Y.; Yan, G.F.; Wang, Y.P.; Ying, C.M. Study of the correlation of imipenem resistance with efflux pumps AdeABC, AdeIJK, AdeDE and AbeM in clinical isolates of Acinetobacter baumannii. Chemotherapy 2012, 58, 152–158. [Google Scholar] [CrossRef]
- Su, X.Z.; Chen, J.; Mizushima, T.; Kuroda, T.; Tsuchiya, T. AbeM, an H+-coupled Acinetobacter baumannii multidrug efflux pump belonging to the MATE family of transporters. Antimicrob. Agents Chemother. 2005, 49, 4362–4364. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Rafiei, E.; Shahini Shams Abadi, M.; Zamanzad, B.; Gholipour, A. The frequency of efflux pump genes expression in Acinetobacter baumannii isolates from pulmonary secretions. AMB Express 2022, 12, 103. [Google Scholar] [CrossRef] [PubMed]
- Poirel, L.; Nordmann, P. Carbapenem resistance in Acinetobacter baumannii: Mechanisms and epidemiology. Clin. Microbiol. Infect. 2006, 12, 826–836. [Google Scholar] [CrossRef][Green Version]
- Zając, O.M.; Tyski, S.; Laudy, A.E. The contribution of efflux systems to levofloxacin resistance in Stenotrophomonas maltophilia clinical strains isolated in Warsaw, Poland. Biology 2022, 11, 1044. [Google Scholar] [CrossRef]
- Pannek, S.; Higgins, P.G.; Steinke, P.; Jonas, D.; Akova, M.; Bohnert, J.A.; Seifert, H.; Kern, W.V. Multidrug efflux inhibition in Acinetobacter baumannii: Comparison between 1-(1-naphthylmethyl)-piperazine and phenyl-arginine-beta-naphthylamide. J. Antimicrob. Chemother. 2006, 57, 970–974. [Google Scholar] [CrossRef]
- Lee, Y.; Yum, J.H.; Kim, C.K.; Yong, D.; Jeon, E.H.; Jeong, S.H.; Ahn, J.Y.; Lee, K. Role of OXA-23 and AdeABC efflux pump for acquiring carbapenem resistance in an Acinetobacter baumannii strain carrying the blaOXA-66 gene. Ann. Clin. Lab. Sci. 2010, 40, 43–48. [Google Scholar]
- Laudy, A.E.; Kulińska, E.; Tyski, S. The impact of efflux pump inhibitors on the activity of selected non-antibiotic medicinal products against Gram-negative bacteria. Molecules 2017, 22, 114. [Google Scholar] [CrossRef][Green Version]
- Laudy, A.E.; Róg, P.; Smolińska-Król, K.; Ćmiel, M.; Słoczyńska, A.; Patzer, J.; Dzierżanowska, D.; Wolinowska, R.; Starościak, B.; Tyski, S. Prevalence of ESBL-producing Pseudomonas aeruginosa isolates in Warsaw, Poland, detected by various phenotypic and genotypic methods. PLoS ONE 2017, 12, e0180121. [Google Scholar] [CrossRef][Green Version]
- Huang, L.; Sun, L.; Xu, G.; Xia, T. Differential susceptibility to carbapenems due to the AdeABC efflux pump among nosocomial outbreak isolates of Acinetobacter baumannii in a Chinese hospital. Diagn. Microbiol. Infect. Dis. 2008, 62, 326–332. [Google Scholar] [CrossRef]
- Ardebili, A.; Lari, A.R.; Talebi, M. Correlation of ciprofloxacin resistance with the AdeABC efflux system in Acinetobacter baumannii clinical isolates. Ann. Lab. Med. 2014, 34, 433–438. [Google Scholar] [CrossRef][Green Version]
- Ardehali, S.H.; Azimi, T.; Fallah, F.; Owrang, M.; Aghamohammadi, N.; Azimi, L. Role of efflux pumps in reduced susceptibility to tigecycline in Acinetobacter baumannii. New Microbes New Infect. 2019, 30, 100547. [Google Scholar] [CrossRef]
- Amiri, G.; Abbasi Shaye, M.; Bahreini, M.; Mafinezhad, A.; Ghazvini, K.; Sharifmoghadam, M.R. Determination of imipenem efflux-mediated resistance in Acinetobacter spp., using an efflux pump inhibitor. Iran J. Microbiol. 2019, 11, 368–372. [Google Scholar] [CrossRef]
- Sanchez-Carbonel, A.; Mondragon, B.; Lopez-Chegne, N.; Pena-Tuesta, I.; Huayan-Davila, G.; Blitchtein, D.; Carrillo-Ng, H.; Silva-Caso, W.; Aguilar-Luis, M.A.; Del Valle-Mendoza, J. The effect of the efflux pump inhibitor Carbonyl Cyanide m-Chlorophenylhydrazone (CCCP) on the susceptibility to imipenem and cefepime in clinical strains of Acinetobacter baumannii. PLoS ONE 2021, 16, e0259915. [Google Scholar] [CrossRef] [PubMed]
- Marchand, I.; Damier-Piolle, L.; Courvalin, P.; Lambert, T. Expression of the RND-type efflux pump AdeABC in Acinetobacter baumannii is regulated by the AdeRS two-component system. Antimicrob. Agents Chemother. 2004, 48, 3298–3304. [Google Scholar] [CrossRef][Green Version]
- Nemec, A.; Maixnerova, M.; van der Reijden, T.J.; van den Broek, P.J.; Dijkshoorn, L. Relationship between the AdeABC efflux system gene content, netilmicin susceptibility and multidrug resistance in a genotypically diverse collection of Acinetobacter baumannii strains. J. Antimicrob. Chemother. 2007, 60, 483–489. [Google Scholar] [CrossRef] [PubMed]
- Higgins, P.G.; Wisplinghoff, H.; Stefanik, D.; Seifert, H. Selection of topoisomerase mutations and overexpression of adeB mRNA transcripts during an outbreak of Acinetobacter baumannii. J. Antimicrob. Chemother. 2004, 54, 821–823. [Google Scholar] [CrossRef]
- Salehi, B.; Ghalavand, Z.; Yadegar, A.; Eslami, G. Characteristics and diversity of mutations in regulatory genes of resistance-nodulation-cell division efflux pumps in association with drug-resistant clinical isolates of Acinetobacter baumannii. Antimicrob. Resist. Infect. Control 2021, 10, 53. [Google Scholar] [CrossRef] [PubMed]
- Sun, J.R.; Perng, C.L.; Lin, J.C.; Yang, Y.S.; Chan, M.C.; Chang, T.Y.; Lin, F.M.; Chiueh, T.S. AdeRS combination codes differentiate the response to efflux pump inhibitors in tigecycline-resistant isolates of extensively drug-resistant Acinetobacter baumannii. Eur. J. Clin. Microbiol. Infect. Dis. 2014, 33, 2141–2147. [Google Scholar] [CrossRef]
- Hornsey, M.; Ellington, M.J.; Doumith, M.; Thomas, C.P.; Gordon, N.C.; Wareham, D.W.; Quinn, J.; Lolans, K.; Livermore, D.M.; Woodford, N. AdeABC-mediated efflux and tigecycline MICs for epidemic clones of Acinetobacter baumannii. J. Antimicrob. Chemother. 2010, 65, 1589–1593. [Google Scholar] [CrossRef][Green Version]
- Sun, J.R.; Jeng, W.Y.; Perng, C.L.; Yang, Y.S.; Soo, P.C.; Chiang, Y.S.; Chiueh, T.S. Single amino acid substitution Gly186Val in AdeS restores tigecycline susceptibility of Acinetobacter baumannii. J. Antimicrob. Chemother. 2016, 71, 1488–1492. [Google Scholar] [CrossRef][Green Version]
- Haeili, M.; Abdollahi, A.; Ahmadi, A.; Khoshbayan, A. Molecular characterization of tigecycline non-susceptibility among extensively drug-resistant Acinetobacter baumannii isolates of clinical origin. Chemotherapy 2021, 66, 99–106. [Google Scholar] [CrossRef]
- Lari, A.R.; Ardebili, A.; Hashemi, A. AdeR-AdeS mutations & overexpression of the AdeABC efflux system in ciprofloxacin-resistant Acinetobacter baumannii clinical isolates. Indian J. Med. Res. 2018, 147, 413–421. [Google Scholar] [PubMed]
- Higgins, P.G.; Schneiders, T.; Hamprecht, A.; Seifert, H. In vivo selection of a missense mutation in adeR and conversion of the novel bla(OXA-164) gene into bla(OXA-58) in carbapenem-resistant Acinetobacter baumannii isolates from a hospitalized patient. Antimicrob. Agents Chemother. 2010, 54, 5021–5027. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Lopes, B.S.; Amyes, S.G. Insertion sequence disruption of adeR and ciprofloxacin resistance caused by efflux pumps and gyrA and parC mutations in Acinetobacter baumannii. Int. J. Antimicrob. Agents 2013, 41, 117–121. [Google Scholar] [CrossRef] [PubMed]
- Zang, M.; Adams, F.G.; Hassan, K.A.; Eijkelkamp, B.A. The Impact of omega-3 fatty acids on the evolution of Acinetobacter baumannii drug resistance. Microbiol. Spectr. 2021, 9, e0145521. [Google Scholar] [CrossRef] [PubMed]
- Saule, M.; Samuelsen, O.; Dumpis, U.; Sundsfjord, A.; Karlsone, A.; Balode, A.; Miklasevics, E.; Karah, N. Dissemination of a carbapenem-resistant Acinetobacter baumannii strain belonging to international clone II/sequence type 2 and harboring a novel AbaR4-like resistance island in Latvia. Antimicrob. Agents Chemother. 2013, 57, 1069–1072. [Google Scholar] [CrossRef][Green Version]
- Bi, D.; Xie, R.; Zheng, J.; Yang, H.; Zhu, X.; Ou, H.Y.; Wei, Q. Large-scale identification of AbaR-Type genomic islands in Acinetobacter baumannii reveals diverse insertion sites and clonal lineage-specific antimicrobial resistance gene profiles. Antimicrob. Agents Chemother. 2019, 63, e02526-18. [Google Scholar] [CrossRef][Green Version]
- Kim, D.H.; Choi, J.Y.; Kim, H.W.; Kim, S.H.; Chung, D.R.; Peck, K.R.; Thamlikitkul, V.; So, T.M.; Yasin, R.M.; Hsueh, P.R.; et al. Spread of carbapenem-resistant Acinetobacter baumannii global clone 2 in Asia and AbaR-type resistance islands. Antimicrob. Agents Chemother. 2013, 57, 5239–5246. [Google Scholar] [CrossRef][Green Version]
- Segal, H.; Jacobson, R.K.; Garny, S.; Bamford, C.M.; Elisha, B.G. Extended -10 promoter in ISAba-1 upstream of blaOXA-23 from Acinetobacter baumannii. Antimicrob. Agents Chemother. 2007, 51, 3040–3041. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Nigro, S.J.; Hall, R.M. Structure and context of Acinetobacter transposons carrying the oxa23 carbapenemase gene. J. Antimicrob. Chemother. 2016, 71, 1135–1147. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Clinical and Laboratory Standards Institute. M100: Performance Standards for Antimicrobial Susceptibility Testing, 32nd ed.; CLSI: Wayne, PA, USA, 2022. [Google Scholar]
- Clinical and Laboratory Standards Institute. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria that Grow Aerobically, Approved Standard, Document M07-A9, 9th ed.; CLSI: Wayne, PA, USA, 2012. [Google Scholar]
- Lamers, R.P.; Cavallari, J.F.; Burrows, L.L. The efflux inhibitor phenylalanine-arginine beta-naphthylamide (PAbetaN) permeabilizes the outer membrane of gram-negative bacteria. PLoS ONE 2013, 8, e60666. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Fernando, D.; Kumar, A. Growth phase-dependent expression of RND efflux pump- and outer membrane porin-encoding genes in Acinetobacter baumannii ATCC 19606. J. Antimicrob. Chemother. 2012, 67, 569–572. [Google Scholar] [CrossRef][Green Version]
- Andrews, S. FastQC: A Quality Control Tool for High Throughput Sequence Data. 2010. Available online: http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ (accessed on 10 May 2023).
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef]
- Gardner, S.N.; Slezak, T.; Hall, B.G. kSNP3.0: SNP detection and phylogenetic analysis of genomes without genome alignment or reference genome. Bioinformatics 2015, 31, 2877–2878. [Google Scholar] [CrossRef][Green Version]
- Rambaut, A. FigTree v1.3.1. Institute of Evolutionary Biology, University of Edinburgh, Edinburgh. 2010. Available online: http://tree.bio.ed.ac.uk/software/figtree/ (accessed on 10 May 2023).
- De Coster, W.; D’Hert, S.; Schultz, D.T.; Cruts, M.; Van Broeckhoven, C. NanoPack: Visualizing and processing long-read sequencing data. Bioinformatics 2018, 34, 2666–2669. [Google Scholar] [CrossRef][Green Version]
- Wick, R.R.; Judd, L.M.; Cerdeira, L.T.; Hawkey, J.; Meric, G.; Vezina, B.; Wyres, K.L.; Holt, K.E. Trycycler: Consensus long-read assemblies for bacterial genomes. Genome Biol. 2021, 22, 266. [Google Scholar] [CrossRef]
- Available online: https://github.com/rrwick/Polypolish (accessed on 10 May 2023).
- Wick, R.R.; Holt, K.E. Polypolish: Short-read polishing of long-read bacterial genome assemblies. PLoS Comput. Biol. 2022, 18, e1009802. [Google Scholar] [CrossRef]
- Zimin, A.V.; Puiu, D.; Luo, M.C.; Zhu, T.; Koren, S.; Marcais, G.; Yorke, J.A.; Dvorak, J.; Salzberg, S.L. Hybrid assembly of the large and highly repetitive genome of Aegilops tauschii, a progenitor of bread wheat, with the MaSuRCA mega-reads algorithm. Genome Res. 2017, 27, 787–792. [Google Scholar] [CrossRef][Green Version]
Groups of Isolates Carrying the Following Genes (n = 14) [9] | Isolate | MIC (mg/L) | ||||||
---|---|---|---|---|---|---|---|---|
IMP a | IMP + CCCP | IMP + PAβN | MEM | MEM + CCCP | MEM + PAβN | |||
blaOXA-51-like | ISAba3-blaOXA-58-like | AB43 | 16 | 1b | 8 | 64 | 32 | 16 |
ISAba1-blaOXA-23-like | AB87 | 16 | 8 | 4 | 32 | 16 | 8 | |
AB92 | 16 | 8 | 8 | 32 | 16 | 8 | ||
AB96 | 32 | 16 | 16 | 32 | 16 | 8 | ||
AB111 | 32 | 16 | 16 | 64 | 32 | 16 | ||
AB113 | 32 | 16 | 8 | 64 | 32 | 8 | ||
AB118 | 32 | 16 | 16 | 64 | 32 | 16 | ||
AB119 | 16 | 8 | 16 | 64 | 32 | 16 | ||
AB177 | 16 | 8 | 16 | 64 | 32 | 16 | ||
blaOXA-24-like | AB37 | 32 | 32 | 32 | 128 | 64 | 32 | |
AB81 | 64 | 32 | 16 | 128 | 128 | 32 | ||
AB153 | 32 | 8 | 16 | 64 | 32 | 32 | ||
AB165 | 32 | 16 | 16 | 128 | 64 | 32 | ||
AB195 | 32 | 16 | 16 | 128 | 128 | 16 |
Isolate Groups Producing Acquired CHDL [9] | Isolate | MIC MEM a/x-Fold Reduction with PAβN | MIC IMP/x-Fold Reduction with PAβN | CA Result (Time in Minutes) [9] | Fold Upregulation b | Mutation c | |||
---|---|---|---|---|---|---|---|---|---|
adeB | adeR | adeS | AdeR | AdeS | |||||
OXA-58-like (n = 2) | AB43 | 64/4 | 16/none | Uninterpretable (120) | 11 | 2 | 1 | V120I, A136V | L172P, G186V, N268H, Y303F, V348I, G356N, H357N |
AB52 | 8/none | 16/none | Uninterpretable (120) | 21 | 1 | 1 | V120I, A136V | L172P, G186V, N268H, Y303F, V348I, G356N, H357N | |
OXA-23-like (n = 7) | AB86 | 16/none | 16/none | Positive (45) | 11 | 2 | 1 | V120I, A136V | L172P, G186V, N268H, Y303F, V348I, G356N, H357N |
AB87 | 32/4 | 16/4 | Positive (45) | 11 | 3 | 1 | V120I, A136V | L172P, G186V, N268H, Y303F, V348I, G356N, H357N | |
AB96 | 32/4 | 32/none | Positive (25) | 67 | 1 | 1 | V120I, A136V, ISAba1 insertion | L172P, G186V, N268H, Y303F, V348I, G356N, H357N deletion: H102, G103 | |
AB113 | 64/8 | 32/4 | Positive (45) | 21 | 1 | 1 | V120I, A136V | L172P, G186V, N268H, Y303F, V348I, G356N, H357N | |
AB118 | 64/4 | 32/none | Positive (60) | 10 | 2 | 1 | V120I, A136V | L172P, G186V, N268H, Y303F, V348I, G356N, H357N | |
AB129 | 8/none | 8/none | Uninterpretable (120) | 49 | 1 | 1 | V120I, A136V, ISAba1 insertion | L172P, G186V, N268H, Y303F, V348I, G356N, H357N deletion: H102, G103 | |
AB185 | 8/none | 16/none | Uninterpretable (120) | 58 | 1 | 1 | V120I, A136V, ISAba1 insertion | L172P, G186V, N268H, Y303F, V348I, G356N, H357N deletion: H102, G103 | |
OXA-24-like (n = 6) | AB76 | 128/none | 64/none | Positive (45) | 5 | 2 | 1 | V120I, A136V | L172P, G186V, N268H, Y303F, V348I, G356N, H357N |
AB81 | 128/4 | 64/4 | Positive (35) | 16 | 2 | 1 | V120I, A136V | L172P, G186V, N268H, Y303F, V348I, G356N, H357N | |
AB159 | 32/none | 32/none | Positive (55) | 15 | 2 | 1 | V120I, A136V | L172P, G186V, N268H, Y303F, V348I, G356N, H357N | |
AB165 | 128/4 | 32/none | Positive (25) | 14 | 4 | 3 | N115T, V120I, A136V | L172P, G186V, N268H, Y303F, V348I, G356N, H357N | |
AB176 | 128/none | 64/none | Positive (5) | 13 | 2 | 1 | V120I, A136V | L172P, G186V, N268H, Y303F, V348I, G356N, H357N | |
AB195 | 128/8 | 32/none | Positive (100) | 14 | 1 | 1 | V120I, A136V | L172P, G186V, N268H, Y303F, V348I, G356N, H357N |
Target Gene | PCR Type | Sequence (5′→3′) | Reference | |
---|---|---|---|---|
adeB | qPCR | F a | GGATTATGGCGACTGAAGGA | [57] |
R | AATACTGCCGCCAATACCAG | |||
adeS | F | GAATTCACTCCGCCGAAATGT | This study | |
R | AACTCATGTGCGATAGCTGC | |||
adeR | F | TGCACTAGAGCGAACCGTAG | This study | |
R | CTATATCCCACGCCACGCAC | |||
fabD | F | CCAGTATTGCTTTATGGCG | This study | |
R | TGCAACTAAAGCGCTGTATTC | |||
proC | F | CTGTCGAACAAATTCGTCAA | This study | |
R | CGTAGAACATTTGCCAGAACTT | |||
adeB | Classic PCR | F | TTAACGATAGCGTTGTAACC | This study |
R | TGAGCAGACAATGGAATAGT | |||
abeM | F | GCAACATCCATTTTACAGTG | This study | |
R | TTGTTCACGGCCTAAAAGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Słoczyńska, A.; Wand, M.E.; Bock, L.J.; Tyski, S.; Laudy, A.E. Efflux-Related Carbapenem Resistance in Acinetobacter baumannii Is Associated with Two-Component Regulatory Efflux Systems’ Alteration and Insertion of ΔAbaR25-Type Island Fragment. Int. J. Mol. Sci. 2023, 24, 9525. https://doi.org/10.3390/ijms24119525
Słoczyńska A, Wand ME, Bock LJ, Tyski S, Laudy AE. Efflux-Related Carbapenem Resistance in Acinetobacter baumannii Is Associated with Two-Component Regulatory Efflux Systems’ Alteration and Insertion of ΔAbaR25-Type Island Fragment. International Journal of Molecular Sciences. 2023; 24(11):9525. https://doi.org/10.3390/ijms24119525
Chicago/Turabian StyleSłoczyńska, Alicja, Matthew E. Wand, Lucy J. Bock, Stefan Tyski, and Agnieszka E. Laudy. 2023. "Efflux-Related Carbapenem Resistance in Acinetobacter baumannii Is Associated with Two-Component Regulatory Efflux Systems’ Alteration and Insertion of ΔAbaR25-Type Island Fragment" International Journal of Molecular Sciences 24, no. 11: 9525. https://doi.org/10.3390/ijms24119525
APA StyleSłoczyńska, A., Wand, M. E., Bock, L. J., Tyski, S., & Laudy, A. E. (2023). Efflux-Related Carbapenem Resistance in Acinetobacter baumannii Is Associated with Two-Component Regulatory Efflux Systems’ Alteration and Insertion of ΔAbaR25-Type Island Fragment. International Journal of Molecular Sciences, 24(11), 9525. https://doi.org/10.3390/ijms24119525