Correlated Target Search by Vaccinia Virus Uracil–DNA Glycosylase, a DNA Repair Enzyme and a Processivity Factor of Viral Replication Machinery
Abstract
1. Introduction
2. Results
2.1. vvUNG Is Capable of Correlated DNA Cleavage
2.2. vvUNG Binds Damaged and Undamaged DNA with Similar Affinity
2.3. Efficiency of Lesion Recognition by vvUNG
2.4. Dependence of Pcc on the Distance between the Lesions
2.5. Small-Molecule Inhibitors Affecting Correlated Cleavage by vvUNG
3. Discussion
4. Materials and Methods
4.1. Enzymes, Oligonucleotides, and Chemicals
4.2. vvUNG Cloning and Purification
4.3. Substrate Preparation
4.4. Steady-State Kinetics
4.5. Correlated Cleavage Assay
4.6. Quench-Flow Experiments
4.7. Microscale Thermophoresis
4.8. One-Dimensional Walk Simulation
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Friedberg, E.C.; Walker, G.C.; Siede, W.; Wood, R.D.; Schultz, R.A.; Ellenberger, T. DNA Repair and Mutagenesis; ASM Press: Washington, DC, USA, 2006; p. 1118. [Google Scholar]
- Zharkov, D.O. Base excision DNA repair. Cell. Mol. Life Sci. 2008, 65, 1544–1565. [Google Scholar] [CrossRef] [PubMed]
- Stivers, J.T.; Jiang, Y.L. A mechanistic perspective on the chemistry of DNA repair glycosylases. Chem. Rev. 2003, 103, 2729–2760. [Google Scholar] [CrossRef]
- Zharkov, D.O.; Grollman, A.P. The DNA trackwalkers: Principles of lesion search and recognition by DNA glycosylases. Mutat. Res. 2005, 577, 24–54. [Google Scholar] [CrossRef] [PubMed]
- Lee, A.J.; Wallace, S.S. Hide and seek: How do DNA glycosylases locate oxidatively damaged DNA bases amidst a sea of undamaged bases? Free Radic. Biol. Med. 2017, 107, 170–178. [Google Scholar] [CrossRef]
- Esadze, A.; Stivers, J.T. Facilitated diffusion mechanisms in DNA base excision repair and transcriptional activation. Chem. Rev. 2018, 118, 11298–11323. [Google Scholar] [CrossRef] [PubMed]
- Sousa, M.M.L.; Krokan, H.E.; Slupphaug, G. DNA-uracil and human pathology. Mol. Asp. Med. 2007, 28, 276–306. [Google Scholar] [CrossRef] [PubMed]
- Kavli, B.; Slupphaug, G.; Krokan, H.E. Genomic uracil in biology, immunity and cancer. In DNA Damage, DNA Repair and Disease; Dizdaroglu, M., Lloyd, R.S., Eds.; Royal Society of Chemistry: London, UK, 2021; Volume 1, pp. 220–248. [Google Scholar] [CrossRef]
- Visnes, T.; Doseth, B.; Pettersen, H.S.; Hagen, L.; Sousa, M.M.L.; Akbari, M.; Otterlei, M.; Kavli, B.; Slupphaug, G.; Krokan, H.E. Uracil in DNA and its processing by different DNA glycosylases. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2009, 364, 563–568. [Google Scholar] [CrossRef][Green Version]
- Pyles, R.B.; Thompson, R.L. Evidence that the herpes simplex virus type 1 uracil DNA glycosylase is required for efficient viral replication and latency in the murine nervous system. J. Virol. 1994, 68, 4963–4972. [Google Scholar] [CrossRef][Green Version]
- Lu, C.-C.; Huang, H.-T.; Wang, J.-T.; Slupphaug, G.; Li, T.-K.; Wu, M.-C.; Chen, Y.-C.; Lee, C.-P.; Chen, M.-R. Characterization of the uracil-DNA glycosylase activity of Epstein-Barr virus BKRF3 and its role in lytic viral DNA replication. J. Virol. 2007, 81, 1195–1208. [Google Scholar] [CrossRef][Green Version]
- Minkah, N.; Macaluso, M.; Oldenburg, D.G.; Paden, C.R.; White, D.W.; McBride, K.M.; Krug, L.T. Absence of the uracil DNA glycosylase of murine gammaherpesvirus 68 impairs replication and delays the establishment of latency in vivo. J. Virol. 2015, 89, 3366–3379. [Google Scholar] [CrossRef][Green Version]
- Dong, Q.; Smith, K.R.; Oldenburg, D.G.; Shapiro, M.; Schutt, W.R.; Malik, L.; Plummer, J.B.; Mu, Y.; MacCarthy, T.; White, D.W.; et al. Combinatorial loss of the enzymatic activities of viral uracil-DNA glycosylase and viral dUTPase impairs murine gammaherpesvirus pathogenesis and leads to increased recombination-based deletion in the viral genome. mBio 2018, 9, e01831-18. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Mansky, L.M.; Preveral, S.; Selig, L.; Benarous, R.; Benichou, S. The interaction of Vpr with uracil DNA glycosylase modulates the human immunodeficiency virus type 1 in vivo mutation rate. J. Virol. 2000, 74, 7039–7047. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Chen, R.; Le Rouzic, E.; Kearney, J.A.; Mansky, L.M.; Benichou, S. Vpr-mediated incorporation of UNG2 into HIV-1 particles is required to modulate the virus mutation rate and for replication in macrophages. J. Biol. Chem. 2004, 279, 28419–28425. [Google Scholar] [CrossRef][Green Version]
- Guenzel, C.A.; Hérate, C.; Le Rouzic, E.; Maidou-Peindara, P.; Sadler, H.A.; Rouyez, M.-C.; Mansky, L.M.; Benichou, S. Recruitment of the nuclear form of uracil DNA glycosylase into virus particles participates in the full infectivity of HIV-1. J. Virol. 2012, 86, 2533–2544. [Google Scholar] [CrossRef][Green Version]
- Stuart, D.T.; Upton, C.; Higman, M.A.; Niles, E.G.; McFadden, G. A poxvirus-encoded uracil DNA glycosylase is essential for virus viability. J. Virol. 1993, 67, 2503–2512. [Google Scholar] [CrossRef][Green Version]
- Millns, A.K.; Carpenter, M.S.; DeLange, A.M. The vaccinia virus-encoded uracil DNA glycosylase has an essential role in viral DNA replication. Virology 1994, 198, 504–513. [Google Scholar] [CrossRef] [PubMed]
- Ellison, K.S.; Peng, W.; McFadden, G. Mutations in active-site residues of the uracil-DNA glycosylase encoded by vaccinia virus are incompatible with virus viability. J. Virol. 1996, 70, 7965–7973. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Scaramozzino, N.; Sanz, G.; Crance, J.M.; Saparbaev, M.; Drillien, R.; Laval, J.; Kavli, B.; Garin, D. Characterisation of the substrate specificity of homogeneous vaccinia virus uracil-DNA glycosylase. Nucleic Acids Res. 2003, 31, 4950–4957. [Google Scholar] [CrossRef][Green Version]
- Duraffour, S.; Ishchenko, A.A.; Saparbaev, M.; Crance, J.-M.; Garin, D. Substrate specificity of homogeneous monkeypox virus uracil-DNA glycosylase. Biochemistry 2007, 46, 11874–11881. [Google Scholar] [CrossRef]
- Schormann, N.; Grigorian, A.; Samal, A.; Krishnan, R.; DeLucas, L.; Chattopadhyay, D. Crystal structure of vaccinia virus uracil-DNA glycosylase reveals dimeric assembly. BMC Struct. Biol. 2007, 7, 45. [Google Scholar] [CrossRef][Green Version]
- Druck Shudofsky, A.M.; Silverman, J.E.Y.; Chattopadhyay, D.; Ricciardi, R.P. Vaccinia virus D4 mutants defective in processive DNA synthesis retain binding to A20 and DNA. J. Virol. 2010, 84, 12325–12335. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Sartmatova, D.; Nash, T.; Schormann, N.; Nuth, M.; Ricciardi, R.; Banerjee, S.; Chattopadhyay, D. Crystallization and preliminary X-ray diffraction analysis of three recombinant mutants of Vaccinia virus uracil DNA glycosylase. Acta Crystallogr. Sect. F Struct. Biol. Cryst. Commun. 2013, 69, 295–301. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Schormann, N.; Banerjee, S.; Ricciardi, R.; Chattopadhyay, D. Structure of the uracil complex of Vaccinia virus uracil DNA glycosylase. Acta Crystallogr. Sect. F Struct. Biol. Cryst. Commun. 2013, 69, 1328–1334. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Contesto-Richefeu, C.; Tarbouriech, N.; Brazzolotto, X.; Betzi, S.; Morelli, X.; Burmeister, W.P.; Iseni, F. Crystal structure of the vaccinia virus DNA polymerase holoenzyme subunit D4 in complex with the A20 N-terminal domain. PLoS Pathog. 2014, 10, e1003978. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Burmeister, W.P.; Tarbouriech, N.; Fender, P.; Contesto-Richefeu, C.; Peyrefitte, C.N.; Iseni, F. Crystal structure of the vaccinia virus uracil-DNA glycosylase in complex with DNA. J. Biol. Chem. 2015, 290, 17923–17934. [Google Scholar] [CrossRef][Green Version]
- Schormann, N.; Banerjee, S.; Ricciardi, R.; Chattopadhyay, D. Binding of undamaged double stranded DNA to vaccinia virus uracil-DNA glycosylase. BMC Struct. Biol. 2015, 15, 10. [Google Scholar] [CrossRef][Green Version]
- Contesto-Richefeu, C.; Tarbouriech, N.; Brazzolotto, X.; Burmeister, W.P.; Peyrefitte, C.N.; Iseni, F. Structural analysis of point mutations at the Vaccinia virus A20/D4 interface. Acta Crystallogr. F Struct. Biol. Commun. 2016, 72, 687–691. [Google Scholar] [CrossRef][Green Version]
- Schormann, N.; Zhukovskaya, N.; Bedwell, G.; Nuth, M.; Gillilan, R.; Prevelige, P.E.; Ricciardi, R.P.; Banerjee, S.; Chattopadhyay, D. Poxvirus uracil-DNA glycosylase—An unusual member of the family I uracil-DNA glycosylases. Protein Sci. 2016, 25, 2113–2131. [Google Scholar] [CrossRef][Green Version]
- De Silva, F.S.; Moss, B. Vaccinia virus uracil DNA glycosylase has an essential role in DNA synthesis that is independent of its glycosylase activity: Catalytic site mutations reduce virulence but not virus replication in cultured cells. J. Virol. 2003, 77, 159–166. [Google Scholar] [CrossRef][Green Version]
- Holzer, G.W.; Falkner, F.G. Construction of a vaccinia virus deficient in the essential DNA repair enzyme uracil DNA glycosylase by a complementing cell line. J. Virol. 1997, 71, 4997–5002. [Google Scholar] [CrossRef][Green Version]
- Holzer, G.W.; Gritschenberger, W.; Mayrhofer, J.A.; Wieser, V.; Dorner, F.; Falkner, F.G. Dominant host range selection of vaccinia recombinants by rescue of an essential gene. Virology 1998, 249, 160–166. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Stanitsa, E.S.; Arps, L.; Traktman, P. Vaccinia virus uracil DNA glycosylase interacts with the A20 protein to form a heterodimeric processivity factor for the viral DNA polymerase. J. Biol. Chem. 2006, 281, 3439–3451. [Google Scholar] [CrossRef] [PubMed]
- Sidorenko, V.S.; Mechetin, G.V.; Nevinsky, G.A.; Zharkov, D.O. Correlated cleavage of single- and double-stranded substrates by uracil-DNA glycosylase. FEBS Lett. 2008, 582, 410–414. [Google Scholar] [CrossRef][Green Version]
- Hedglin, M.; O’Brien, P.J. Human alkyladenine DNA glycosylase employs a processive search for DNA damage. Biochemistry 2008, 47, 11434–11445. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Porecha, R.H.; Stivers, J.T. Uracil DNA glycosylase uses DNA hopping and short-range sliding to trap extrahelical uracils. Proc. Natl. Acad. Sci. USA 2008, 105, 10791–10796. [Google Scholar] [CrossRef][Green Version]
- Belotserkovskii, B.P.; Zarling, D.A. Analysis of a one-dimensional random walk with irreversible losses at each step: Applications for protein movement on DNA. J. Theor. Biol. 2004, 226, 195–203. [Google Scholar] [CrossRef]
- Sidorenko, V.S.; Zharkov, D.O. Correlated cleavage of damaged DNA by bacterial and human 8-oxoguanine-DNA glycosylases. Biochemistry 2008, 47, 8970–8976. [Google Scholar] [CrossRef]
- Hedglin, M.; O’Brien, P.J. Hopping enables a DNA repair glycosylase to search both strands and bypass a bound protein. ACS Chem. Biol. 2010, 5, 427–436. [Google Scholar] [CrossRef][Green Version]
- Mechetin, G.V.; Zharkov, D.O. Mechanism of translocation of uracil-DNA glycosylase from Escherichia coli between distributed lesions. Biochem. Biophys. Res. Commun. 2011, 414, 425–430. [Google Scholar] [CrossRef][Green Version]
- Mechetin, G.V.; Zharkov, D.O. The mechanism of substrate search by base excision repair enzymes. Dokl. Biochem. Biophys. 2011, 437, 94–97. [Google Scholar] [CrossRef]
- Schonhoft, J.D.; Stivers, J.T. Timing facilitated site transfer of an enzyme on DNA. Nat. Chem. Biol. 2012, 8, 205–210. [Google Scholar] [CrossRef][Green Version]
- Hedglin, M.; Zhang, Y.; O’Brien, P.J. Isolating contributions from intersegmental transfer to DNA searching by alkyladenine DNA glycosylase. J. Biol. Chem. 2013, 288, 24550–24559. [Google Scholar] [CrossRef][Green Version]
- Schonhoft, J.D.; Kosowicz, J.G.; Stivers, J.T. DNA translocation by human uracil DNA glycosylase: Role of DNA phosphate charge. Biochemistry 2013, 52, 2526–2535. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Schonhoft, J.D.; Stivers, J.T. DNA translocation by human uracil DNA glycosylase: The case of single-stranded DNA and clustered uracils. Biochemistry 2013, 52, 2536–2544. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Rowland, M.M.; Schonhoft, J.D.; McKibbin, P.L.; David, S.S.; Stivers, J.T. Microscopic mechanism of DNA damage searching by hOGG1. Nucleic Acids Res. 2014, 42, 9295–9303. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Cravens, S.L.; Schonhoft, J.D.; Rowland, M.M.; Rodriguez, A.A.; Anderson, B.G.; Stivers, J.T. Molecular crowding enhances facilitated diffusion of two human DNA glycosylases. Nucleic Acids Res. 2015, 43, 4087–4097. [Google Scholar] [CrossRef][Green Version]
- Hedglin, M.; Zhang, Y.; O’Brien, P.J. Probing the DNA structural requirements for facilitated diffusion. Biochemistry 2015, 54, 557–566. [Google Scholar] [CrossRef][Green Version]
- Cravens, S.L.; Stivers, J.T. Comparative effects of ions, molecular crowding, and bulk DNA on the damage search mechanisms of hOGG1 and hUNG. Biochemistry 2016, 55, 5230–5242. [Google Scholar] [CrossRef][Green Version]
- Esadze, A.; Rodriguez, G.; Weiser, B.P.; Cole, P.A.; Stivers, J.T. Measurement of nanoscale DNA translocation by uracil DNA glycosylase in human cells. Nucleic Acids Res. 2017, 45, 12413–12424. [Google Scholar] [CrossRef][Green Version]
- Mechetin, G.V.; Dyatlova, E.A.; Sinyakov, A.N.; Ryabinin, V.A.; Vorobjev, P.E.; Zharkov, D.O. Correlated target search by uracil–DNA glycosylase in the presence of bulky adducts and DNA-binding ligands. Russ. J. Bioorg. Chem. 2017, 43, 23–28. [Google Scholar] [CrossRef]
- Rodriguez, G.; Esadze, A.; Weiser, B.P.; Schonhoft, J.D.; Cole, P.A.; Stivers, J.T. Disordered N-terminal domain of human uracil DNA glycosylase (hUNG2) enhances DNA translocation. ACS Chem. Biol. 2017, 12, 2260–2263. [Google Scholar] [CrossRef] [PubMed]
- Berg, O.G.; Winter, R.B.; von Hippel, P.H. Diffusion-driven mechanisms of protein translocation on nucleic acids. 1. Models and theory. Biochemistry 1981, 20, 6929–6948. [Google Scholar] [CrossRef]
- Winter, R.B.; von Hippel, P.H. Diffusion-driven mechanisms of protein translocation on nucleic acids. 2. The Escherichia coli repressor–operator interaction: Equilibrium measurements. Biochemistry 1981, 20, 6948–6960. [Google Scholar] [CrossRef] [PubMed]
- Winter, R.B.; Berg, O.G.; von Hippel, P.H. Diffusion-driven mechanisms of protein translocation on nucleic acids. 3. The Escherichia coli lac repressor–operator interaction: Kinetic measurements and conclusions. Biochemistry 1981, 20, 6961–6977. [Google Scholar] [CrossRef] [PubMed]
- Owczarzy, R.; Moreira, B.G.; You, Y.; Behlke, M.A.; Walder, J.A. Predicting stability of DNA duplexes in solutions containing magnesium and monovalent cations. Biochemistry 2008, 47, 5336–5353. [Google Scholar] [CrossRef][Green Version]
- Slupphaug, G.; Eftedal, I.; Kavli, B.; Bharati, S.; Helle, N.M.; Haug, T.; Levine, D.W.; Krokan, H.E. Properties of a recombinant human uracil-DNA glycosylase from the UNG gene and evidence that UNG encodes the major uracil-DNA glycosylase. Biochemistry 1995, 34, 128–138. [Google Scholar] [CrossRef]
- Kavli, B.; Sundheim, O.; Akbari, M.; Otterlei, M.; Nilsen, H.; Skorpen, F.; Aas, P.A.; Hagen, L.; Krokan, H.E.; Slupphaug, G. hUNG2 is the major repair enzyme for removal of uracil from U:A matches, U:G mismatches, and U in single-stranded DNA, with hSMUG1 as a broad specificity backup. J. Biol. Chem. 2002, 277, 39926–39936. [Google Scholar] [CrossRef][Green Version]
- Blainey, P.C.; Luo, G.; Kou, S.C.; Mangel, W.F.; Verdine, G.L.; Bagchi, B.; Xie, X.S. Nonspecifically bound proteins spin while diffusing along DNA. Nat. Struct. Mol. Biol. 2009, 16, 1224–1229. [Google Scholar] [CrossRef][Green Version]
- Stivers, J.T.; Pankiewicz, K.W.; Watanabe, K.A. Kinetic mechanism of damage site recognition and uracil flipping by Escherichia coli uracil DNA glycosylase. Biochemistry 1999, 38, 952–963. [Google Scholar] [CrossRef]
- Grin, I.R.; Mechetin, G.V.; Kasymov, R.D.; Diatlova, E.A.; Yudkina, A.V.; Shchelkunov, S.N.; Gileva, I.P.; Denisova, A.A.; Stepanov, G.A.; Chilov, G.G.; et al. A new class of uracil–DNA glycosylase inhibitors active against human and vaccinia virus enzyme. Molecules 2021, 26, 6668. [Google Scholar] [CrossRef]
- Wu, X.; Zhang, Y. TET-mediated active DNA demethylation: Mechanism, function and beyond. Nat. Rev. Genet. 2017, 18, 517–534. [Google Scholar] [CrossRef] [PubMed]
- Parrilla-Doblas, J.T.; Roldán-Arjona, T.; Ariza, R.R.; Córdoba-Cañero, D. Active DNA demethylation in plants. Int. J. Mol. Sci. 2019, 20, 4683. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Wang, R.; Hao, W.; Pan, L.; Boldogh, I.; Ba, X. The roles of base excision repair enzyme OGG1 in gene expression. Cell. Mol. Life Sci. 2018, 75, 3741–3750. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Hedglin, M.; Kumar, R.; Benkovic, S.J. Replication clamps and clamp loaders. Cold Spring Harb. Perspect. Biol. 2013, 5, a010165. [Google Scholar] [CrossRef][Green Version]
- Zuccola, H.J.; Filman, D.J.; Coen, D.M.; Hogle, J.M. The crystal structure of an unusual processivity factor, herpes simplex virus UL42, bound to the C terminus of its cognate polymerase. Mol. Cell 2000, 5, 267–278. [Google Scholar] [CrossRef]
- Appleton, B.A.; Loregian, A.; Filman, D.J.; Coen, D.M.; Hogle, J.M. The cytomegalovirus DNA polymerase subunit UL44 forms a C clamp-shaped dimer. Mol. Cell 2004, 15, 233–244. [Google Scholar] [CrossRef]
- Huber, H.E.; Tabor, S.; Richardson, C.C. Escherichia coli thioredoxin stabilizes complexes of bacteriophage T7 DNA polymerase and primed templates. J. Biol. Chem. 1987, 262, 16224–16232. [Google Scholar] [CrossRef]
- Doublié, S.; Tabor, S.; Long, A.M.; Richardson, C.C.; Ellenberger, T. Crystal structure of a bacteriophage T7 DNA replication complex at 2.2 Å resolution. Nature 1998, 391, 251–258. [Google Scholar] [CrossRef]
- Gao, Y.; Cui, Y.; Fox, T.; Lin, S.; Wang, H.; de Val, N.; Zhou, H.; Yang, W. Structures and operating principles of the replisome. Science 2019, 363, eaav7003. [Google Scholar] [CrossRef]
- Foster, B.M.; Rosenberg, D.; Salvo, H.; Stephens, K.L.; Bintz, B.J.; Hammel, M.; Ellenberger, T.; Gainey, M.D.; Wallen, J.R. Combined solution and crystal methods reveal the electrostatic tethers that provide a flexible platform for replication activities in the bacteriophage T7 replisome. Biochemistry 2019, 58, 4466–4479. [Google Scholar] [CrossRef]
- Sun, S.; Geng, L.; Shamoo, Y. Structure and enzymatic properties of a chimeric bacteriophage RB69 DNA polymerase and single-stranded DNA binding protein with increased processivity. Proteins 2006, 65, 231–238. [Google Scholar] [CrossRef] [PubMed]
- Olszewski, M.; Śpibida, M.; Bilek, M.; Krawczyk, B. Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans—Expression and characterization. PLoS ONE 2017, 12, e0184162. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Prosen, D.E.; Mei, L.; Sullivan, J.C.; Finney, M.; Vander Horn, P.B. A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Res. 2004, 32, 1197–1207. [Google Scholar] [CrossRef] [PubMed]
- de Vega, M.; Lázaro, J.M.; Mencía, M.; Blanco, L.; Salas, M. Improvement of φ29 DNA polymerase amplification performance by fusion of DNA binding motifs. Proc. Natl. Acad. Sci. USA 2010, 107, 16506–16511. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Pavlov, A.R.; Pavlova, N.V.; Kozyavkin, S.A.; Slesarev, A.I. Cooperation between catalytic and DNA binding domains enhances thermostability and supports DNA synthesis at higher temperatures by thermostable DNA polymerases. Biochemistry 2012, 51, 2032–2043. [Google Scholar] [CrossRef][Green Version]
- McDonald, W.F.; Traktman, P. Vaccinia virus DNA polymerase: In vitro analysis of parameters affecting processivity. J. Biol. Chem. 1994, 269, 31190–31197. [Google Scholar] [CrossRef]
- McDonald, W.F.; Klemperer, N.; Traktman, P. Characterization of a processive form of the vaccinia virus DNA polymerase. Virology 1997, 234, 168–175. [Google Scholar] [CrossRef]
- Moss, B. Poxvirus DNA replication. Cold Spring Harb. Perspect. Biol. 2013, 5, a010199. [Google Scholar] [CrossRef][Green Version]
- Greseth, M.D.; Traktman, P. The life cycle of the vaccinia virus genome. Annu. Rev. Virol. 2022, 9, 239–259. [Google Scholar] [CrossRef]
- Boyle, K.A.; Stanitsa, E.S.; Greseth, M.D.; Lindgren, J.K.; Traktman, P. Evaluation of the role of the vaccinia virus uracil DNA glycosylase and A20 proteins as intrinsic components of the DNA polymerase holoenzyme. J. Biol. Chem. 2011, 286, 24702–24713. [Google Scholar] [CrossRef][Green Version]
- Sèle, C.; Gabel, F.; Gutsche, I.; Ivanov, I.; Burmeister, W.P.; Iseni, F.; Tarbouriech, N. Low-resolution structure of vaccinia virus DNA replication machinery. J. Virol. 2013, 87, 1679–1689. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Peng, Q.; Xie, Y.; Kuai, L.; Wang, H.; Qi, J.; Gao, G.F.; Shi, Y. Structure of monkeypox virus DNA polymerase holoenzyme. Science 2023, 379, 100–105. [Google Scholar] [CrossRef] [PubMed]
- Lu, H.; Zhou, Q.; He, J.; Jiang, Z.; Peng, C.; Tong, R.; Shi, J. Recent advances in the development of protein–protein interactions modulators: Mechanisms and clinical trials. Signal Transduct. Target. Ther. 2020, 5, 213. [Google Scholar] [CrossRef] [PubMed]
- Schormann, N.; Sommers, C.I.; Prichard, M.N.; Keith, K.A.; Noah, J.W.; Nuth, M.; Ricciardi, R.P.; Chattopadhyay, D. Identification of protein-protein interaction inhibitors targeting vaccinia virus processivity factor for development of antiviral agents. Antimicrob. Agents Chemother. 2011, 55, 5054–5062. [Google Scholar] [CrossRef][Green Version]
- Nuth, M.; Huang, L.; Saw, Y.L.; Schormann, N.; Chattopadhyay, D.; Ricciardi, R.P. Identification of inhibitors that block vaccinia virus infection by targeting the DNA synthesis processivity factor D4. J. Med. Chem. 2011, 54, 3260–3267. [Google Scholar] [CrossRef][Green Version]
- Nuth, M.; Guan, H.; Zhukovskaya, N.; Saw, Y.L.; Ricciardi, R.P. Design of potent poxvirus inhibitors of the heterodimeric processivity factor required for viral replication. J. Med. Chem. 2013, 56, 3235–3246. [Google Scholar] [CrossRef]
- Guan, H.; Nuth, M.; Zhukovskaya, N.; Saw, Y.L.; Bell, E.; Isaacs, S.N.; Ricciardi, R.P. A novel target and approach for identifying antivirals against molluscum contagiosum virus. Antimicrob. Agents Chemother. 2014, 58, 7383–7389. [Google Scholar] [CrossRef][Green Version]
- Nuth, M.; Guan, H.; Xiao, Y.; Kulp, J.L., 3rd; Parker, M.H.; Strobel, E.D.; Isaacs, S.N.; Scott, R.W.; Reitz, A.B.; Ricciardi, R.P. Mutation and structure guided discovery of an antiviral small molecule that mimics an essential C-terminal tripeptide of the vaccinia D4 processivity factor. Antivir. Res. 2019, 162, 178–185. [Google Scholar] [CrossRef]
- Gruskin, E.A.; Lloyd, R.S. Molecular analysis of plasmid DNA repair within ultraviolet-irradiated Escherichia coli. I. T4 endonuclease V-initiated excision repair. J. Biol. Chem. 1988, 263, 12728–12737. [Google Scholar] [CrossRef]
- Beattie, T.R.; Kapadia, N.; Nicolas, E.; Uphoff, S.; Wollman, A.J.M.; Leake, M.C.; Reyes-Lamothe, R. Frequent exchange of the DNA polymerase during bacterial chromosome replication. Elife 2017, 6, e21763. [Google Scholar] [CrossRef]
- Yakubitskiy, S.N.; Kolosova, I.V.; Maksyutov, R.A.; Shchelkunov, S.N. Attenuation of vaccinia virus. Acta Nat. 2015, 7, 113–121. [Google Scholar] [CrossRef]
- Gasteiger, E.; Jung, E.; Bairoch, A. SWISS-PROT: Connecting biomolecular knowledge via a protein database. Curr. Issues Mol. Biol. 2001, 3, 47–55. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Huang, C.Y. Derivation of initial velocity and isotope exchange rate equations. Methods Enzymol. 1979, 63, 54–84. [Google Scholar] [CrossRef] [PubMed]
Substrate (Oligo IDs) | Kd, µM a |
---|---|
C (13C) | 7.0 ± 2.0 |
T (13T) | 12 ± 7 |
F (13F) | 4.0 ± 2.0 |
C:G (13C//13cmpG) | 7.2 ± 1.5 |
T:A (13T//13cmpA) | 8.7 ± 1.7 |
F:G (13F//13cmpG) | 6.2 ± 2.3 |
F:A (13F//13cmpA) | 6.7 ± 1.4 |
Oligo ID | Sequence (5′ → 3′) |
---|---|
D4R gene cloning | |
D4Rfwd | GGCATATGAATTCAGTGACTGTATC |
D4Rrev | GGGGATCCTAAAATTTCACTAAGC |
Processivity studies | |
U20L | TCCCTTCUCTCCTTTCCTTC |
U20R | GGACTTCUCTCCTTTCCAGA |
U21L | TCCCTTCUCTCCTTTCCTTCC |
U40F 1 | TCCCTTCUCTCCTTTCCTTC[FluoT]GACTTCUCTCCTTTCCAGA |
G17L | GGAAAGGAGGGAAGGGA |
G17R | TCTGGAAAGGAGGGAAG |
G18L | AGGAAAGGAGGGAAGGGA |
G18R | TCTGGAAAGGAGGGAAGT |
G19L | AAGGAAAGGAGGGAAGGGA |
G19R | TCTGGAAAGGAGGGAAGTC |
G20L | GAAGGAAAGGAGGGAAGGGA |
G20R | TCTGGAAAGGAGGGAAGTCC |
G40 | TCTGGAAAGGAGGGAAGTCCGAAGGAAAGGAGGGAAGGGA |
G40R | TCTGGAAAGGAGGGAAGTCCGAGGTCTGAACGAGAGGAAA |
G41 | TCTGGAAAGGAGGGAAGTCCGGAAGGAAAGGAGGGAAGGGA |
G41L 2 | [p]GATCGCACAAATGAAAGGTCCGAAGGAAAGGAGGGAAGGGA |
G46 | TTTTCTGGAAAGGAGCGAAGTCCGAAGGAAAGGAGCGAAGGGATTT |
G50L | [p]AAATTCACTCATCGCACAAATGAAAGGTCCGAAGGAAAGGAGGGAAGGGA |
G51R | TCTGGAAAGGAGGGAAGTCCGAGGTCTGAACGAGAGGAAAGCTAAATCCCG |
G61 | TCTGGAAAGGAGGGAAGTCCGCTCTAACGCAAGTAAAGTCCGAAGGAAAGGAGGGAAGGGA |
L21 | [p]GGACTTTACTTGCGTTAGAGC |
L41 | [p]GGACCTTTCATTTGTGCGATCTTTCCTCTCGTTCAGACCTC |
L61 | [p]GGACCTTTCATTTGTGCGATGAGTGAATTTCGGGATTTAGCTTTCCTCTCGTTCAGACCTC |
Microscale thermophoresis | |
13C 3 | [Cy3]CCTTCCCTCCTTT |
13T | [Cy3]CCTTCTCTCCTTT |
13F | [Cy3]CCTTCFCTCCTTT |
13cmpG | AAAGGAGGGAAGG |
13cmpA | AAAGGAGAGAAGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Diatlova, E.A.; Mechetin, G.V.; Yudkina, A.V.; Zharkov, V.D.; Torgasheva, N.A.; Endutkin, A.V.; Shulenina, O.V.; Konevega, A.L.; Gileva, I.P.; Shchelkunov, S.N.; et al. Correlated Target Search by Vaccinia Virus Uracil–DNA Glycosylase, a DNA Repair Enzyme and a Processivity Factor of Viral Replication Machinery. Int. J. Mol. Sci. 2023, 24, 9113. https://doi.org/10.3390/ijms24119113
Diatlova EA, Mechetin GV, Yudkina AV, Zharkov VD, Torgasheva NA, Endutkin AV, Shulenina OV, Konevega AL, Gileva IP, Shchelkunov SN, et al. Correlated Target Search by Vaccinia Virus Uracil–DNA Glycosylase, a DNA Repair Enzyme and a Processivity Factor of Viral Replication Machinery. International Journal of Molecular Sciences. 2023; 24(11):9113. https://doi.org/10.3390/ijms24119113
Chicago/Turabian StyleDiatlova, Evgeniia A., Grigory V. Mechetin, Anna V. Yudkina, Vasily D. Zharkov, Natalia A. Torgasheva, Anton V. Endutkin, Olga V. Shulenina, Andrey L. Konevega, Irina P. Gileva, Sergei N. Shchelkunov, and et al. 2023. "Correlated Target Search by Vaccinia Virus Uracil–DNA Glycosylase, a DNA Repair Enzyme and a Processivity Factor of Viral Replication Machinery" International Journal of Molecular Sciences 24, no. 11: 9113. https://doi.org/10.3390/ijms24119113
APA StyleDiatlova, E. A., Mechetin, G. V., Yudkina, A. V., Zharkov, V. D., Torgasheva, N. A., Endutkin, A. V., Shulenina, O. V., Konevega, A. L., Gileva, I. P., Shchelkunov, S. N., & Zharkov, D. O. (2023). Correlated Target Search by Vaccinia Virus Uracil–DNA Glycosylase, a DNA Repair Enzyme and a Processivity Factor of Viral Replication Machinery. International Journal of Molecular Sciences, 24(11), 9113. https://doi.org/10.3390/ijms24119113