Evaluation of the Optimal Manufacturing Protocols and Therapeutic Properties of Mesenchymal Stem/Stromal Cells Derived from Wharton’s Jelly
Abstract
:1. Introduction
2. Results
2.1. Isolation of MSCs from Different Regions of the Umbilical Cord (UC)
2.2. Cell Viability in Different Transport Media in Time
2.3. Soluble Secretome of WJ-MSCs and WJ Bioptats
2.3.1. Soluble Secretome of Freshly Isolated WJ Bioptats
2.3.2. Soluble Secretome of Freshly Isolated WJ-MSCs
2.3.3. Soluble Secretome of Cryopreserved WJ Bioptats
2.3.4. Comparison of the Soluble Secretomes of Freshly Isolated WJ Bioptats and WJ-MSCs
2.3.5. Comparison of the Soluble Secretomes of Freshly Isolated WJ Bioptats and Cryopreserved WJ Bioptats
2.4. Morphology of WJ-MSCs Cultured in CSF Obtained from Patients
2.5. Expression of Neural Genes and Markers in WJ-MSCs Cultured in CSF (RT-qPCR Analysis and Immunocytochemistry)
3. Materials and Methods
3.1. Isolation of MSCs from Different Regions of the Umbilical Cord (UC)
- cylindrical fragments of intervascular Wharton’s jelly (WJ) were obtained from the slices using a 2 mm diameter biopsy punch (Miltex, GmbH, Viernheim, Germany)—Figure 8(1); or
- cylindrical fragments were obtained from the border area of the cord slices using a 2 mm diameter biopsy punch—Figure 8(2); or
- the blood vessels were removed using a 3 mm diameter biopsy punch, the epithelium was removed with a lancet, and the remaining tissue was chopped with a lancet into small pieces (approximately 4 mm2)—Figure 8(3).
3.2. Flow Cytometry Analysis
3.3. Mesodermal Lineage Differentiation
3.3.1. Adipogenesis
3.3.2. Chondrogenesis
3.3.3. Osteogenesis
3.4. Evaluation of Cell Viability in Different Transport Media in Time
3.5. Soluble Secretome of WJ-MSCs and WJ Bioptats
3.6. Characteristics of WJ-MSCs Cultured in Cerebrospinal Fluid Obtained from Patients
3.6.1. Morphology
3.6.2. Expression of Neural Genes by Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)
3.6.3. Immunocytochemistry
4. Discussion
4.1. Most Efficient Isolation Method of MSCs from Human Umbilical Cord
4.2. Most Optimal Culture and Long-Term Storage Conditions
4.3. Most Optimal Transport Medium for WJ-MSCs
4.4. Soluble Secretome and Therapeutic Properties of WJ-MSCs
4.5. WJ-MSCs Cultured in CSF Change Their Phenotype and Undergo Neural Differentiation
5. Conclusions
- isolate the cells using the mechanical method, which involves cutting the whole UC with a lancet (after removing the blood vessels and the epithelium surrounding the cord);
- transport the cells in Optilyte (a multi-electrolyte medium), as it proved to be the medium that ensures the highest cell viability during transportation, with the optimal time of transportation being 0–2 h; and
- cryopreserve the isolated cells and not the tissue bioptats (concerning long term stem cell-banking), as it was shown that WJ-MSCs secrete higher levels of immunomodulatory, angiogenic, and neuroprotective factors than whole WJ bioptats, and we can also conclude that low temperatures cause a decrease in the soluble secretome of WJ bioptats.
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zakrzewski, W.; Dobrzyński, M.; Szymonowicz, M.; Rybak, Z. Stem cells: Past, present, and future. Stem Cell Res. Ther. 2019, 128, 329–332. [Google Scholar] [CrossRef]
- Kolios, G.; Moodley, Y. Introduction to stem cells and regenerative medicine. Respiration 2013, 85, 3–10. [Google Scholar] [CrossRef]
- Naji, A.; Eitoku, M.; Favier, B.; Deschaseaux, F.; Rouas-Freiss, N.; Suganuma, N. Biological functions of mesenchymal stem cells and clinical implications. Cell. Mol. Life Sci. 2019, 17, 3323–3348. [Google Scholar] [CrossRef]
- Li, N.; Hua, J. Interactions between mesenchymal stem cells and the immune system. Cell. Mol. Life Sci. 2017, 13, 2345–2360. [Google Scholar] [CrossRef]
- Wedzinska, A.; Figiel-Dabrowska, A.; Kozlowska, H.; Sarnowska, A. The Effect of Proinflammatory Cytokines on the Proliferation, Migration and Secretory Activity of Mesenchymal Stem/Stromal Cells (WJ-MSCs) under 5% O2 and 21% O2 Culture Conditions. J. Clin. Med. 2021, 9, 1813. [Google Scholar] [CrossRef]
- Bacakova, L.; Zarubova, J.; Travnickova, M.; Musilkova, J.; Pajorova, J.; Slepicka, P.; Kasalkova, N.S.; Svorcik, V.; Kolska, Z.; Motarjemi, H.; et al. Stem cells: Their source, potency and use in regenerative therapies with focus on adipose-derived stem cells—A review. Biotechnol. Adv. 2018, 4, 1111–1126. [Google Scholar] [CrossRef] [PubMed]
- Maqsood, M.; Kang, M.; Wu, X.; Chen, J.; Teng, L.; Qiu, L. Adult mesenchymal stem cells and their exosomes: Sources, characteristics, and application in regenerative medicine. Life Sci. 2020, 256, 118002. [Google Scholar] [CrossRef]
- Li, T.; Xia, M.; Gao, Y.; Chen, Y.; Xu, Y. Human umbilical cord mesenchymal stem cells: An overview of their potential in cell-based therapy. Expert Opin. Biol. Ther. 2015, 9, 1293–1306. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Yu, Q.; Hu, Y.; Shi, Y. Current Research and Use of Mesenchymal Stem Cells in the Therapy of Autoimmune Diseases. Curr. Stem Cell Res. Ther. 2019, 7, 579–582. [Google Scholar] [CrossRef]
- Kuroda, Y.; Dezawa, M. Mesenchymal stem cells and their subpopulation, pluripotent muse cells, in basic research and regenerative medicine. Anat. Rec. 2014, 297, 98–110. [Google Scholar] [CrossRef]
- Samsonraj, R.M.; Raghunath, M.; Nurcombe, V.; Hui, J.H.; van Wijnen, A.J.; Cool, S.M. Concise Review: Multifaceted Characterization of Human Mesenchymal Stem Cells for Use in Regenerative Medicine. Stem Cells Transl. Med. 2017, 12, 2173–2185. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bunnell, B.A. Adipose Tissue-Derived Mesenchymal Stem Cells. Cells 2021, 10, 3433. [Google Scholar] [CrossRef] [PubMed]
- Brown, C.; McKee, C.; Bakshi, S.; Walker, K.; Hakman, E.; Halassy, S.; Svinarich, D.; Dodds, R.; Govind, C.K.; Chaudhry, G.R. Mesenchymal stem cells: Cell therapy and regeneration potential. J. Tissue Eng. Regen. Med. 2019, 9, 1738–1755. [Google Scholar] [CrossRef] [PubMed]
- Mushahary, D.; Spittler, A.; Kasper, C.; Weber, V.; Charwat, V. Isolation, cultivation, and characterization of human mesenchymal stem cells. Cytom. A 2018, 93, 19–31. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Marino, L.; Castaldi, M.A.; Rosamilio, R.; Ragni, E.; Vitolo, R.; Fulgione, C.; Castaldi, S.G.; Serio, B.; Bianco, R.; Guida, M.; et al. Mesenchymal Stem Cells from the Wharton’s Jelly of the Human Umbilical Cord: Biological Properties and Therapeutic Potential. Int. J. Stem Cells 2019, 12, 218–226. [Google Scholar] [CrossRef] [PubMed]
- Liau, L.L.; Ruszymah, B.H.I.; Ng, M.H.; Law, J.X. Characteristics and clinical applications of Wharton’s jelly-derived mesenchymal stromal cells. Curr. Res. Transl. Med. 2020, 68, 5–16. [Google Scholar] [CrossRef]
- Tomecka, E.; Lech, W.; Zychowicz, M.; Sarnowska, A.; Murzyn, M.; Oldak, T.; Domanska-Janik, K.; Buzanska, L.; Rozwadoska, N. Assessment of the Neuroprotective and Stemness Properties of Human Wharton’s Jelly-Derived Mesenchymal Stem Cells under Variable (5% vs. 21%) Aerobic Conditions. Cells 2021, 10, 717. [Google Scholar] [CrossRef]
- Chetty, S.; Yarani, R.; Swaminathan, G.; Primavera, R.; Regmi, S.; Rai, S.; Zhong, J.; Ganguly, A.; Thakor, A.S. Umbilical Cord Mesenchymal Stromal Cells—From Bench to Bedside. Front. Cell Dev. Biol. 2022, 10, 1006295. [Google Scholar] [CrossRef]
- Thirumala, S.; Goebel, W.S.; Woods, E.J. Manufacturing and banking of mesenchymal stem cells. Expert Opin. Biol. Ther. 2013, 13, 673–691. [Google Scholar] [CrossRef]
- Harris, D.T. Banking of Adipose- and Cord Tissue-Derived Stem Cells: Technical and Regulatory Issues. Adv. Exp. Med. Biol. 2016, 951, 147–154. [Google Scholar] [CrossRef]
- Arutyunyan, I.; Fatkhudinov, T.; Sukhikh, G. Umbilical cord tissue cryopreservation: A short review. Stem Cell Res. Ther. 2018, 9, 236. [Google Scholar] [CrossRef] [PubMed]
- Forraz, N.; Mcguckin, C.P. The umbilical cord: A rich and ethical stem cell source to advance regenerative medicine. Cell Prolif. 2011, 44, 60–69. [Google Scholar] [CrossRef] [PubMed]
- Borys-Wójcik, S.; Brązert, M.; Jankowski, M.; Ożegowska, K.; Chermuła, B.; Piotrowska-Kempisty, H.; Bukowska, D.; Antosik, P.; Pawelczyk, L.; Nowicki, M.; et al. Human Wharton’s jelly mesenchymal stem cells: Properties, isolation and clinical applications. J. Biol. Regul. Homeost. Agents 2019, 33, 119–123. [Google Scholar] [PubMed]
- Selich, A.; Zimmermann, K.; Tenspolde, M.; Dittrich-Breiholz, O.; von Kaisenberg, C.; Schambach, A.; Rothe, M. Umbilical cord as a long-term source of activatable mesenchymal stromal cells for immunomodulation. Stem Cell Res. Ther. 2019, 10, 285. [Google Scholar] [CrossRef] [PubMed]
- Figiel-Dąbrowska, A.; Sypecka, M.; Chodkowska, M.; Sarnowska, A. Critical factors responsible for the therapeutic effect of mesenchymal stem/stromal cells in central nervous system disorders. Folia Neuropathol. 2022, 60, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Lech, W.; Figiel-Dabrowska, A.; Sarnowska, A.; Drela, K.; Obtulowicz, P.; Noszczyk, B.H.; Buzanska, L.; Domanska-Janik, K. Phenotypic, Functional, and Safety Control at Preimplantation Phase of MSC-Based Therapy. Stem Cells Int. 2016, 2016, 2514917. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hendijani, F.; Sadeghi-Aliabadi, H.; Haghjooy Javanmard, S. Comparison of human mesenchymal stem cells isolated by explant culture method from entire umbilical cord and Wharton’s jelly matrix. Cell Tissue Bank. 2014, 15, 555–565. [Google Scholar] [CrossRef]
- Subramanian, A.; Fong, C.Y.; Biswas, A.; Bongso, A. Comparative characterization of cells from the various compartments of the human umbilical cord shows that the Wharton’s jelly compartment provides the best source of clinically utilizable mesenchymal stem cells. PLoS ONE 2015, 10, e0127992. [Google Scholar] [CrossRef]
- Ishige, I.; Nagamura-Inoue, T.; Honda, M.J.; Harnprasopwat, R.; Kido, M.; Sugimoto, M.; Nakauchi, H.; Tojo, A. Comparison of mesenchymal stem cells derived from arterial, venous, and Wharton’s jelly explants of human umbilical cord. Int. J. Hematol. 2009, 90, 261–269. [Google Scholar] [CrossRef]
- Chatzistamatiou, T.K.; Papassavas, A.C.; Michalopoulos, E.; Gamaloutsos, C.; Mallis, P.; Gontika, I.; Panagouli, E.; Koussoulakos, S.L.; Stavropoulos-Giokas, C. Optimizing Isolation Culture and Freezing Methods to Preserve Wharton’s Jelly’s Mesenchymal Stem Cell (MSC) Properties: An MSC Banking Protocol Validation for the Hellenic Cord Blood Bank. Transfusion 2014, 54, 3108–3120. [Google Scholar] [CrossRef]
- Moll, G.; Geißler, S.; Catar, R.; Ignatowicz, L.; Hoogduijn, M.J.; Strunk, D.; Bieback, K.; Ringdén, O. Cryopreserved or Fresh Mesenchymal Stromal Cells: Only a Matter of Taste or Key to Unleash the Full Clinical Potential of MSC Therapy? Biobank. Cryopreserv. Stem Cells 2016, 951, 77–98. [Google Scholar] [CrossRef]
- Iftimia-Mander, A.; Hourd, P.; Dainty, R.; Thomas, R.J. Mesenchymal stem cell isolation from human umbilical cord tissue: Understanding and minimizing variability in cell yield for process optimization. Biopreserv. Biobank. 2013, 11, 291–298. [Google Scholar] [CrossRef]
- Celikkan, F.T.; Mungan, C.; Sucu, M.; Ulus, A.T.; Cinar, O.; Ili, E.G.; Can, A.L.P. Optimizing the transport and storage conditions of current Good Manufacturing Practice–grade human umbilical cord mesenchymal stromal cells for transplantation (HUC-HEART Trial). Cytotherapy 2019, 21, 64–75. [Google Scholar] [CrossRef]
- Petrenko, Y.; Chudickova, M.; Vackova, I.; Groh, T.; Kosnarova, E.; Cejkova, J.; Turnovcova, K.; Petrenko, A.; Sykova, E.; Kubinova, S. Clinically relevant solution for the hypothermic storage and transportation of human multipotent mesenchymal stromal cells. Stem Cells Int. 2019, 2019, 5909524. [Google Scholar] [CrossRef] [Green Version]
- Bartolucci, J.; Verdugo, F.J.; González, P.L.; Larrea, R.E.; Abarzua, E.; Goset, C.; Rojo, P.; Palma, I.; Lamich, R.; Pedreros, P.A.; et al. Safety and Efficacy of the Intravenous Infusion of Umbilical Cord Mesenchymal Stem Cells in Patients with Heart Failure: A Phase 1/2 Randomized Controlled Trial (RIMECARD Trial [Randomized Clinical Trial of Intravenous Infusion Umbilical Cord Mesenchymal Stem Cells on Cardiopathy]). Circ. Res. 2017, 10, 1192–1204. [Google Scholar] [CrossRef]
- Teixeira, F.G.; Carvalho, M.M.; Panchalingam, K.M.; Rodrigues, A.J.; Mendes-Pinheiro, B.; Anjo, S.; Manadas, B.; Behie, L.A.; Sousa, N.; Salgado, A.J. Impact of the Secretome of Human Mesenchymal Stem Cells on Brain Structure and Animal Behavior in a Rat Model of Parkinson’s Disease. Stem Cells Transl. Med. 2017, 6, 634–646. [Google Scholar] [CrossRef]
- Salwierak-Głośna, K.; Piątek, P.; Domowicz, M.; Świderek-Matysiak, M. Effect of Multiple Sclerosis Cerebrospinal Fluid and Oligodendroglia Cell Line Environment on Human Wharton’s Jelly Mesenchymal Stem Cells Secretome. Int. J. Mol. Sci. 2022, 23, 2177. [Google Scholar] [CrossRef]
- Romanov, Y.A.; Volgina, N.E.; Vtorushina, V.V.; Romanov, A.Y.; Dugina, T.N.; Kabaeva, N.V.; Sukhikh, G.T. Comparative Analysis of Secretome of Human Umbilical Cord- and Bone Marrow-Derived Multipotent Mesenchymal Stromal Cells. Bull. Exp. Biol. Med. 2019, 166, 535–540. [Google Scholar] [CrossRef]
- Eleuteri, S.; Fierabracci, A. Insights into the secretome of mesenchymal stem cells and its potential applications. Int. J. Mol. Sci. 2019, 20, 4597. [Google Scholar] [CrossRef] [Green Version]
- Fernandez-Gonzalez, A.; Willis, G.R.; Yeung, V.; Reis, M.; Liu, X.; Mitsialis, S.A.; Kourembanas, S. Therapeutic Effects of Mesenchymal Stromal Cell-Derived Small Extracellular Vesicles in Oxygen-Induced Multi-Organ Disease: A Developmental Perspective. Front. Cell Dev. Biol. 2021, 9, 647025. [Google Scholar] [CrossRef]
- Taglauer, E.S.; Fernandez-Gonzalez, A.; Willis, G.R.; Reis, M.; Yeung, V.; Liu, X.; Prince, L.S.; Mitsialis, S.A.; Kourembanas, S. Antenatal Mesenchymal Stromal Cell Extracellular Vesicle Therapy Prevents Preeclamptic Lung Injury in Mice. Am. J. Respir. Cell Mol. Biol. 2022, 66, 86–95. [Google Scholar] [CrossRef] [PubMed]
- Reis, M.; Willis, G.R.; Fernandez-Gonzalez, A.; Yeung, V.; Taglauer, E.; Magaletta, M.; Parsons, T.; Derr, A.; Liu, X.; Maehr, R.; et al. Mesenchymal Stromal Cell-Derived Extracellular Vesicles Restore Thymic Architecture and T Cell Function Disrupted by Neonatal Hyperoxia. Front. Immunol. 2021, 12, 640595. [Google Scholar] [CrossRef] [PubMed]
- McKay, T.B.; Yeung, V.; Hutcheon, A.E.K.; Guo, X.; Zieske, J.D.; Ciolino, J.B. Extracellular Vesicles in the Cornea: Insights from Other Tissues. Anal. Cell. Pathol. 2021, 2021, 9983900. [Google Scholar] [CrossRef]
- Yeung, V.; Willis, G.R.; Taglauer, E.; Mitsialis, S.A.; Kourembanas, S. Paving the Road for Mesenchymal Stem Cell-Derived Exosome Therapy in Bronchopulmonary Dysplasia and Pulmonary Hypertension. In Stem Cell-Based Therapy for Lung Disease; Burgess, J., Heijink, I., Eds.; Springer: Cham, Switzerland, 2019. [Google Scholar] [CrossRef]
- Ge, W.; Ren, C.; Duan, X.; Geng, D.; Zhang, C.; Liu, X.; Chen, H.; Wan, M.; Geng, R. Differentiation of Mesenchymal Stem Cells into Neural Stem Cells Using Cerebrospinal Fluid. Cell Biochem. Biophys. 2015, 71, 449–455. [Google Scholar] [CrossRef] [PubMed]
- Farivar, S.; Mohamadzade, Z.; Shiari, R.; Fahimzad, A. Neural differentiation of human umbilical cord mesenchymal stem cells by cerebrospinal fluid. Iran. J. Child Neurol. 2015, 9, 87–93. [Google Scholar]
- Ye, Y.; Zeng, Y.M.; Wan, M.R.; Lu, X.F. Induction of Human Bone Marrow Mesenchymal Stem Cells Differentiation into Neural-Like Cells Using Cerebrospinal Fluid. Cell Biochem. Biophys. 2011, 59, 179–184. [Google Scholar] [CrossRef]
- Yasuhara, T.; Shingo, T.; Muraoka, K. Neurorescue effects of VEGF on a rat model of Parkinson’s disease. Brain Res. 2005, 1053, 10–18. [Google Scholar] [CrossRef]
- Zappaterra, M.W.; Lehtinen, M.K. The cerebrospinal fluid: Regulator of neurogenesis, behavior, and beyond. Cell. Mol. Life Sci. 2012, 69, 2863–2878. [Google Scholar] [CrossRef]
Gene Name | Specific Primers |
---|---|
nestin | F: GGGAAGAGGTGATGGAACCA R: AAGCCCTGAACCCTCTTTGC |
GFAP | F: CCGACAGCAGGTCCATGT R: GTTGCTGGACGCCATTG |
MAP2 | F: TTGGTGCCGAGTGAGAAGA R: GTCTGGCAGTGGTTGGTTAA |
RBFOX3 (NeuN) | F: ACTTACGGAGCGGTCGTGTATC R: ATGGTGTGATGGTACGGGTCGG |
TUBB3 (β-III-tubulin) | F: GGAAGAGGGCGAGATGTACG R: GGGTTTAGACACTGCTGGCT |
S-100-β | F: AGCGCTCCTGGAAAAAGCAA R: TTGAATCGCATGGGTCACGG |
NG2 | F: GTCTACACCATCGAGCAGCC R: TGTGTGAGAACAGCACGAGC |
ACTB (β-actin) | F: CATGTACGTTGCTATCCAGGC R: CTCCTTAATGTCACGCACGAT |
Reaction Components | Concentration |
---|---|
cDNA | 10 ng (2 µL) |
RT HS-PCR Mix SYBR (A&A Biotechnology) | 7.5 µL |
Specific primers (5′ i 3′) | 0.25 µM/µL (0.075 µL) |
RNase-free water | 5.425 µL |
Antigen | Source | Isotype | Dilution | Company |
---|---|---|---|---|
Nestin | Mouse monoclonal | IgG1 | 1:500 | Merck |
β-III-tubulin | Mouse monoclonal | IgG2b | 1:400 | Sigma |
S-100-β | Rabbit polyclonal | Polyclonal | 1:100 | abcam |
GFAP | Mouse monoclonal | IgG1 | 1:1000 | Biolegend |
Doublecortin | Rabbit polyclonal | Polyclonal | 1:800 | CellSignaling |
Antigen | Antibody | Dilution | Fluorochrome (ThermoFisher Scientific) |
---|---|---|---|
Nestin | Anti-mouse | 1:500 | Alexa Fluor 546 |
β-III-tubulin | Anti-mouse | 1:400 | Alexa Fluor 546 |
S-100-β | Goat, anti-rabbit | 1:100 | Alexa Fluor 488 |
GFAP | Anti-mouse | 1:1000 | Alexa Fluor 546 |
Doublecortin | Goat, anti-rabbit | 1:800 | Alexa Fluor 488 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sypecka, M.; Bzinkowska, A.; Sulejczak, D.; Dabrowski, F.; Sarnowska, A. Evaluation of the Optimal Manufacturing Protocols and Therapeutic Properties of Mesenchymal Stem/Stromal Cells Derived from Wharton’s Jelly. Int. J. Mol. Sci. 2023, 24, 652. https://doi.org/10.3390/ijms24010652
Sypecka M, Bzinkowska A, Sulejczak D, Dabrowski F, Sarnowska A. Evaluation of the Optimal Manufacturing Protocols and Therapeutic Properties of Mesenchymal Stem/Stromal Cells Derived from Wharton’s Jelly. International Journal of Molecular Sciences. 2023; 24(1):652. https://doi.org/10.3390/ijms24010652
Chicago/Turabian StyleSypecka, Monika, Aleksandra Bzinkowska, Dorota Sulejczak, Filip Dabrowski, and Anna Sarnowska. 2023. "Evaluation of the Optimal Manufacturing Protocols and Therapeutic Properties of Mesenchymal Stem/Stromal Cells Derived from Wharton’s Jelly" International Journal of Molecular Sciences 24, no. 1: 652. https://doi.org/10.3390/ijms24010652
APA StyleSypecka, M., Bzinkowska, A., Sulejczak, D., Dabrowski, F., & Sarnowska, A. (2023). Evaluation of the Optimal Manufacturing Protocols and Therapeutic Properties of Mesenchymal Stem/Stromal Cells Derived from Wharton’s Jelly. International Journal of Molecular Sciences, 24(1), 652. https://doi.org/10.3390/ijms24010652