Characterization of Diabetic Retinopathy in Two Mouse Models and Response to a Single Injection of Anti-Vascular Endothelial Growth Factor
Abstract
:1. Introduction
2. Results
2.1. Microaneurysms on Fundus Photography and Fluorescein Angiography (FA)
2.2. Retinal Edema in Optical Coherence Tomography (OCT) and Histological Studies
2.3. Tortuosity and Neovascularization in Retinal Perfusion and Histological Studies
2.4. Gold Nanoparticle (GNP) Detection/Nondetection with AirSEM and OCT Angiography (OCTA)
2.5. GFAP and RAGE Expression upon Molecular Analysis
2.6. Activation of Müller Glia with Prominent Müller Cells upon GFAP Staining
2.7. Reduced Gliosis and Retinal Edema following Intravitreal Injection of Anti-VEGF
3. Discussion
4. Materials and Methods
4.1. Animal Model
4.2. Clinical Evaluation of Retinal Vasculature
4.2.1. Optical Coherence Tomography (OCT)
4.2.2. Fluorescein Angiography (FA)
4.3. Retinal Perfusion Studies
4.3.1. Fluorescent Gelatin
4.3.2. India Ink
4.3.3. Gold Nanoparticles (GNPs)
4.4. Retinal Flat-Mount Studies
4.4.1. Fluorescence Microscope
4.4.2. AirSEM
4.4.3. Hyperspectral Imaging
4.5. Histological Studies
4.5.1. Hematoxylin and Eosin
4.5.2. Immunostaining
4.6. Molecular Analysis
Real-Time Quantitative PCR (RT-qPCR)
4.7. Intravitreal Injection of Anti-VEGF
4.8. Statistical Analysis
4.9. Data and Resource Availability
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sobrin, L.; Green, T.; Sim, X.; Jensen, R.A.; Tai, E.S.; Tay, W.T.; Wang, J.J.; Mitchell, P.; Sandholm, N.; Liu, Y.; et al. Candidate Gene Association Study for Diabetic Retinopathy in Persons with Type 2 Diabetes: The Candidate Gene Association Resource (CARe). Investig. Opthalmology Vis. Sci. 2011, 52, 7593–7602. [Google Scholar] [CrossRef] [PubMed]
- Eleftheriou, C.G.; Ivanova, E.; Sagdullaev, B.T. Of neurons and pericytes: The neuro-vascular approach to diabetic retinopathy. Vis. Neurosci. 2020, 37, E005. [Google Scholar] [CrossRef] [PubMed]
- Safi, S.Z.; Qvist, R.; Kumar, S.; Batumalaie, K.; Ismail, I.S.B. Molecular Mechanisms of Diabetic Retinopathy, General Preventive Strategies, and Novel Therapeutic Targets. BioMed Res. Int. 2014, 2014, 801269. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Osaadon, P.; Fagan, X.J.; Lifshitz, T.; Levy, J. A review of anti-VEGF agents for proliferative diabetic retinopathy. Eye 2014, 28, 510–520. [Google Scholar] [CrossRef] [Green Version]
- Calvo, P.; Abadia, B.; Ferreras, A.; Ruiz-Moreno, O.; Verdes, G.; Pablo, L.E. Diabetic Macular Edema: Options for Adjunct Therapy. Drugs 2015, 75, 1461–1469. [Google Scholar] [CrossRef]
- Stahl, A.; Connor, K.; Sapieha, P.; Chen, J.; Dennison, R.J.; Krah, N.M.; Seaward, M.R.; Willett, K.L.; Aderman, C.M.; Guerin, K.I.; et al. The Mouse Retina as an Angiogenesis Model. Investig. Opthalmology Vis. Sci. 2010, 51, 2813–2826. [Google Scholar] [CrossRef]
- Deeds, M.C.; Anderson, J.M.; Armstrong, A.S.; A Gastineau, D.; Hiddinga, H.J.; Jahangir, A.; Eberhardt, N.L.; Kudva, Y.C. Single dose streptozotocin-induced diabetes: Considerations for study design in islet transplantation models. Lab. Anim. 2011, 45, 131–140. [Google Scholar] [CrossRef] [Green Version]
- Makino, S.; Kunimoto, K.; Muraoka, Y.; Mizushima, Y.; Katagiri, K.; Tochino, Y. Breeding of a Non-Obese, Diabetic Strain of Mice. Exp. Anim. 1980, 29, 1–13. [Google Scholar] [CrossRef] [Green Version]
- Lai, A.K.W.; Lo, A.C.Y. Animal Models of Diabetic Retinopathy: Summary and Comparison. J. Diabetes Res. 2013, 2013, 106594. [Google Scholar] [CrossRef]
- Bogdanov, P.; Corraliza, L.; A Villena, J.; Carvalho, A.R.; Garcia-Arumi, J.; Ramos, D.; Ruberte, J.; Simó, R.; Hernández, C. The db/db Mouse: A Useful Model for the Study of Diabetic Retinal Neurodegeneration. PLoS ONE 2014, 9, e97302. [Google Scholar] [CrossRef]
- Yu, L.; Wu, X.; Cheng, Z.; Lee, C.V.; LeCouter, J.; Campa, C.; Fuh, G.; Lowman, H.; Ferrara, N. Interaction between Bevacizumab and Murine VEGF-A: A Reassessment. Investig. Opthalmology Vis. Sci. 2008, 49, 522–527. [Google Scholar] [CrossRef] [PubMed]
- Robinson, R.; Barathi, V.A.; Chaurasia, S.; Wong, T.Y.; Kern, T.S. Update on animal models of diabetic retinopathy: From molecular approaches to mice and higher mammals. Dis. Model. Mech. 2012, 5, 444–456. [Google Scholar] [CrossRef] [Green Version]
- Lee, V.K.; Hosking, B.M.; Holeniewska, J.; Kubala, E.C.; von Leithner, P.L.; Gardner, P.J.; Foxton, R.H.; Shima, D.T. BTBR ob/ob mouse model of type 2 diabetes exhibits early loss of retinal function and retinal inflammation followed by late vascular changes. Diabetologia 2018, 61, 2422–2432. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yariv, I.; Rahamim, G.; Shliselberg, E.; Duadi, H.; Lipovsky, A.; Lubart, R.; Fixler, D. Detecting nanoparticles in tissue using an optical iterative technique. Biomed. Opt. Express 2014, 5, 3871–3881. [Google Scholar] [CrossRef]
- Fixler, D.; Nayhoz, T.; Ray, K. Diffusion Reflection and Fluorescence Lifetime Imaging Microscopy Study of Fluorophore-Conjugated Gold Nanoparticles or Nanorods in Solid Phantoms. ACS Photon 2014, 1, 900–905. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wylęgała, A.; Teper, S.; Dobrowolski, D.; Wylęgała, E. Optical coherence angiography. Medicine 2016, 95, e4907. [Google Scholar] [CrossRef] [PubMed]
- Lin, M.; Chen, Y.; Jin, J.; Hu, Y.; Zhou, K.; Zhu, M.; Le, Y.-Z.; Ge, J.; Johnson, R.; Ma, J.-X. Ischaemia-induced retinal neovascularisation and diabetic retinopathy in mice with conditional knockout of hypoxia-inducible factor-1 in retinal Müller cells. Diabetologia 2011, 54, 1554–1566. [Google Scholar] [CrossRef] [Green Version]
- Barile, G.R.; Pachydaki, S.I.; Tari, S.R.; Lee, S.E.; Donmoyer, C.M.; Ma, W.; Rong, L.L.; Buciarelli, L.G.; Wendt, T.; Ho¨rig, H.; et al. The RAGE Axis in Early Diabetic Retinopathy. Investig. Opthalmology Vis. Sci. 2005, 46, 2916–2924. [Google Scholar] [CrossRef] [Green Version]
- Villacampa, P.; Ribera, A.; Motas, S.; Ramírez, L.; Garcia, M.; de la Villa, P.; Haurigot, V.A.; Bosch, F. Insulin-like Growth Factor I (IGF-I)-induced Chronic Gliosis and Retinal Stress Lead to Neurodegeneration in a Mouse Model of Retinopathy. J. Biol. Chem. 2013, 288, 17631–17642. [Google Scholar] [CrossRef] [Green Version]
- Hippert, C.; Graca, A.B.; Barber, A.C.; West, E.; Smith, A.J.; Ali, R.; Pearson, R.A. Müller Glia Activation in Response to Inherited Retinal Degeneration Is Highly Varied and Disease-Specific. PLoS ONE 2015, 10, e0120415. [Google Scholar] [CrossRef]
- Masser, D.R.; Starkey, H.D.V.; Bixler, G.V.; Dunton, W.; Bronson, S.K.; Freeman, W.M. Insulin treatment normalizes retinal neuroinflammation but not markers of synapse loss in diabetic rats. Exp. Eye Res. 2014, 125, 95–106. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vázquez-Chona, F.R.; Swan, A.; Ferrell, W.D.; Jiang, L.; Baehr, W.; Chien, W.-M.; Fero, M.; E Marc, R.; Levine, E.M. Proliferative reactive gliosis is compatible with glial metabolic support and neuronal function. BMC Neurosci. 2011, 12, 98. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rappoport, D.; Morzaev, D.; Weiss, S.; Vieyra, M.; Nicholson, J.D.; Leiba, H.; Goldenberg-Cohen, N. Effect of Intravitreal Injection of Bevacizumab on Optic Nerve Head Leakage and Retinal Ganglion Cell Survival in a Mouse Model of Optic Nerve Crush. Investig. Opthalmology Vis. Sci. 2013, 54, 8160–8171. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Novitzky, I.; Marianayagam, N.J.; Weiss, S.; Muhsinoglu, O.; Fridman, M.; Leibovitch, T.A.; Goldenberg-Cohen, N.; Michowiz, S. Comparison of Neuroprotective Effect of Bevacizumab and Sildenafil following Induction of Stroke in a Mouse Model. BioMed Res. Int. 2016, 2016, 3938523. [Google Scholar] [CrossRef] [Green Version]
- Goldenberg-Cohen, N.; Guo, Y.; Margolis, F.; Cohen, Y.; Miller, N.R.; Bernstein, S.L. Oligodendrocyte Dysfunction after Induction of Experimental Anterior Optic Nerve Ischemia. Investig. Opthalmology Vis. Sci. 2005, 46, 2716–2725. [Google Scholar] [CrossRef] [Green Version]
- Zahavi, A.; Weiss, S.; Vieyra, M.; Nicholson, J.D.; Muhsinoglu, O.; Barinfeld, O.; Zadok, D.; Goldenberg-Cohen, N. Ocular Effects of Sildenafil in Naïve Mice and a Mouse Model of Optic Nerve Crush. Investig. Opthalmology Vis. Sci. 2019, 60, 1987–1995. [Google Scholar] [CrossRef] [Green Version]
- Valentim, C.C.; Singh, R.P.; Du, W.; Moini, H.; Talcott, K.E. Time to Resolution of Diabetic Macular Edema after Treatment with Intravitreal Aflibercept Injection or Laser in VISTA and VIVID. Ophthalmol. Retin. 2022; in press. [Google Scholar] [CrossRef]
- Gerhardinger, C.; Costa, M.B.; Coulombe, M.C.; Toth, I.; Hoehn, T.; Grosu, P. Expression of Acute-Phase Response Proteins in Retinal Muller Cells in Diabetes. Investig. Opthalmology Vis. Sci. 2005, 46, 349–357. [Google Scholar] [CrossRef]
- Olivares, A.M.; Althoff, K.; Chen, G.F.; Wu, S.; Morrisson, M.A.; DeAngelis, M.M.; Haider, N. Animal Models of Diabetic Retinopathy. Curr. Diabetes Rep. 2017, 17, 93. [Google Scholar] [CrossRef] [Green Version]
- Shaw, S.G.; Boden, J.P.; Biecker, E.; Reichen, J.; Rothen, B. Endothelin antagonism prevents diabetic retinopathy in NOD mice: A potential role of the angiogenic factor adrenomedullin. Exp. Biol. Med. 2006, 231, 1101–1105. [Google Scholar]
- Li, C.-R.; Sun, S.-G. VEGF expression and cell apoptosis in NOD mouse retina. Int. J. Ophthalmol. 2010, 3, 224–227. [Google Scholar] [CrossRef]
Gene | F | R | |
---|---|---|---|
Angiogenesis | VEGF-A | CACGACAGAAGGAGAGCAGAA | CGCTGGTAGACATCCATGA |
Flt-1 (VEGFR1) | CCCCTCCCCAGAAATCGT | CAAATAGCGAGCAGACTTCAATG | |
Flk-1 (VEGFR2) | CGCGGCCAAGAGGTTT | GATGCCAGCAAGTGGGAATT | |
Ischemia | HO-1 | CAGGTGTCCAGAGAAGGCTTT | TCTTCCAGGGCCGTGTAGAT |
SOD-1 | GCCCGGCGGATGAAGA | CGTCCTTTCCAGCAGTCACA | |
Activation of Müller Glia | GFAP | CGGAGACGCATCACCTCTG | TGGAGGAGTCATTCGAGACAA |
Vimentin | CAGCAGTATGAAAGCGTGG | GGAAGAAAAGGTTGGCAGAG | |
Diabetes-Related | IGF-1 | AGAGACCCTTTGCGGGGC | CGGATAGAGCGGGTGCTT |
EPO | GCCCTGCTAGCCAATTCC | GGCGACATCAATTCCTTCTG | |
RAGE | CTTGCTCTATGGGGAGCTGTA | GGAGGATTTGAGCCACGCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Azrad-Leibovich, T.; Zahavi, A.; Gohas, M.F.; Brookman, M.; Barinfeld, O.; Muhsinoglu, O.; Michowiz, S.; Fixler, D.; Goldenberg-Cohen, N. Characterization of Diabetic Retinopathy in Two Mouse Models and Response to a Single Injection of Anti-Vascular Endothelial Growth Factor. Int. J. Mol. Sci. 2023, 24, 324. https://doi.org/10.3390/ijms24010324
Azrad-Leibovich T, Zahavi A, Gohas MF, Brookman M, Barinfeld O, Muhsinoglu O, Michowiz S, Fixler D, Goldenberg-Cohen N. Characterization of Diabetic Retinopathy in Two Mouse Models and Response to a Single Injection of Anti-Vascular Endothelial Growth Factor. International Journal of Molecular Sciences. 2023; 24(1):324. https://doi.org/10.3390/ijms24010324
Chicago/Turabian StyleAzrad-Leibovich, Tamar, Alon Zahavi, Moran Friedman Gohas, Myles Brookman, Orit Barinfeld, Orkun Muhsinoglu, Shalom Michowiz, Dror Fixler, and Nitza Goldenberg-Cohen. 2023. "Characterization of Diabetic Retinopathy in Two Mouse Models and Response to a Single Injection of Anti-Vascular Endothelial Growth Factor" International Journal of Molecular Sciences 24, no. 1: 324. https://doi.org/10.3390/ijms24010324