Atlantic Salmon Mucins Inhibit LuxS-Dependent A. Salmonicida AI-2 Quorum Sensing in an N-Acetylneuraminic Acid-Dependent Manner
Abstract
:1. Introduction
2. Results
2.1. V. Harveyi BB170 Autoinducer-2 Reporter Assay Is Suitable for AI-2 Quantification in Narrow Concentration Ranges Defined by the Selected Culture Medium
2.2. A. Salmonicida Autoinducer-2 Production Starts before the Log Phase of Growth and Its Kinetics Differs Depending on Culture Media
2.3. Exogenous DPD Enhances A. Salmonicida Growth
2.4. Atlantic Salmon Mucins Reduce A. Salmonicida AI-2 Secretion
2.5. Among the Saccharides Abundant on Mucins, Fucose, N-Acetylneuraminic Acid and GlcNAcβ1-3Gal Inhibit AI-2 Secretion of A. Salmonicida
2.6. Removal of N-Acetylneuraminic Acid from Atlantic Salmon Mucins Attenuates the AI-2 Reducing Effects of Mucins on A. Salmonicida
2.7. Identification of the luxS Gene in the Genome of A. Salmonicida Ssp. Salmonicida Strain VI-88/09/03175
2.8. Construction of ΔluxS Gene-Deletion Mutant Strain
2.9. Growth Characteristics of A. Salmonicida WT and ΔluxS
2.10. Deletion of LuxS Abolished A. Salmonicida AI-2 Production Both in the Absence and Presence of Skin Mucins
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains and Culture Conditions
4.2. Culture Media
4.3. DNA Manipulation
4.4. Construction of ΔluxS Mutant
4.5. Quorum-Sensing Assay
4.6. Assay Sensitivity Testing
4.7. Growth Assay
4.8. Growth Assay with DPD
4.9. Growth Assay with Mucins and Saccharides
4.10. Fish and Sampling Procedure
4.11. Isolation and Purification of Mucins
4.12. Preparation of Mucin Samples
4.13. Statistical Analyses
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Austin, B.; Austin, D.A. Bacterial Fish Pathogens: Disease of Farmed and Wild Fish, 4th ed.; Springer: Dordrecht, The Netherlands, 2007; Volume xxvi, p. 552. [Google Scholar]
- Jutfelt, F.; Sundh, H.; Glette, J.; Mellander, L.; Thrandur Bjornsson, B.; Sundell, K. The involvement of Aeromonas salmonicida virulence factors in bacterial translocation across the rainbow trout, Oncorhynchus mykiss (Walbaum), intestine. J. Fish Dis. 2008, 31, 141–151. [Google Scholar] [CrossRef] [PubMed]
- Sharba, S.; Sundh, H.; Sundell, K.; Benktander, J.; Santos, L.; Birchenough, G.; Lindén, S.K. Rainbow trout gastrointestinal mucus, mucin production, mucin glycosylation and response to lipopolysaccharide. Fish Shellfish Immunol. 2022, 122, 181–190. [Google Scholar] [CrossRef] [PubMed]
- Jin, C.; Padra, J.T.; Sundell, K.; Sundh, H.; Karlsson, N.G.; Linden, S.K. Atlantic salmon carries a range of novel o-glycan structures differentially localized on skin and intestinal mucins. J. Proteome Res. 2015, 14, 3239–3251. [Google Scholar] [CrossRef] [PubMed]
- Padra, J.T.; Sundh, H.; Jin, C.; Karlsson, N.G.; Sundell, K.; Linden, S.K. Aeromonas salmonicida binds differentially to mucins isolated from skin and intestinal regions of Atlantic salmon in an N-acetylneuraminic acid-dependent manner. Infect. Immun. 2014, 82, 5235–5245. [Google Scholar] [CrossRef] [Green Version]
- Linden, S.K.; Sutton, P.; Karlsson, N.G.; Korolik, V.; McGuckin, M.A. Mucins in the mucosal barrier to infection. Mucosal. Immunol. 2008, 1, 183–197. [Google Scholar] [CrossRef] [Green Version]
- Quintana-Hayashi, M.P.; Padra, M.; Padra, J.T.; Benktander, J.; Linden, S.K. Mucus-Pathogen Interactions in the Gastrointestinal Tract of Farmed Animals. Microorganisms 2018, 6, 55. [Google Scholar] [CrossRef] [Green Version]
- Padra, J.T.; Sundh, H.; Sundell, K.; Venkatakrishnan, V.; Jin, C.; Samuelsson, T.; Karlsson, N.G.; Linden, S.K. Aeromonas salmonicida Growth in Response to Atlantic Salmon Mucins Differs between Epithelial Sites, Is Governed by Sialylated and N-Acetylhexosamine-Containing O-Glycans, and Is Affected by Ca2+. Infect. Immun. 2017, 85, e00189-17. [Google Scholar] [CrossRef] [Green Version]
- Henke, J.M.; Bassler, B.L. Bacterial social engagements. Trends Cell Biol. 2004, 14, 648–656. [Google Scholar] [CrossRef]
- Swift, S.; Karlyshev, A.V.; Fish, L.; Durant, E.L.; Winson, M.K.; Chhabra, S.R.; Williams, P.; MacIntyre, S.; Stewart, G.S.A.B. Quorum sensing in Aeromonas hydrophila and Aeromonas salmonicida: Identification of the LuxRI homologs AhyRI and AsaRI and their cognate N-acylhomoserine lactone signal molecules. J. Bacteriol. 1997, 179, 5271–5281. [Google Scholar] [CrossRef] [Green Version]
- Reith, M.E.; Singh, R.K.; Curtis, B.; Boyd, J.M.; Bouevitch, A.; Kimball, J.; Munholland, J.; Murphy, C.; Sarty, D.; Williams, J.; et al. The genome of Aeromonas salmonicida subsp. salmonicida A449: Insights into the evolution of a fish pathogen. BMC Genom. 2008, 9, 427. [Google Scholar] [CrossRef]
- Meng, L.; Du, Y.; Liu, P.; Li, X.; Liu, Y. Involvement of LuxS in Aeromonas salmonicida metabolism, virulence and infection in Atlantic salmon (Salmo salar L.). Fish Shellfish Immunol. 2017, 64, 260–269. [Google Scholar] [CrossRef] [PubMed]
- Miller, S.T.; Xavier, K.B.; Campagna, S.R.; Taga, M.E.; Semmelhack, M.F.; Bassler, B.L.; Hughson, F.M. Salmonella typhimurium recognizes a chemically distinct form of the bacterial quorum-sensing signal AI-2. Mol. Cell 2004, 15, 677–687. [Google Scholar] [CrossRef] [PubMed]
- Greenberg, E.P.; Hastings, J.W.; Ulitzur, S. Induction of luciferase synthesis in Beneckea harveyi by other marine bacteria. Arch. Microbiol. 1979, 120, 87–91. [Google Scholar] [CrossRef]
- Xavier, K.B.; Bassler, B.L. LuxS quorum sensing: More than just a numbers game. Curr. Opin. Microbiol. 2003, 6, 191–197. [Google Scholar] [CrossRef]
- Ljungh, Å.; Wretlind, B.; Möllby, R. Separation and characterization of enterotoxin and two haemolysins from aeromonas hydrophila. Acta Pathol. Microbiol. Scand. Sect. B Microbiol. 1981, 89B, 387–397. [Google Scholar] [CrossRef] [PubMed]
- Macintyre, S.; Buckley, J.T. Presence of glycerophospholipid-cholesterol acyltransferase and phospholipase in culture supernatant of aeromonas-hydrophila. J. Bacteriol. 1978, 135, 402–407. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Macintyre, S.; Trust, T.J.; Buckley, J.T. Distribution of glycerophospholipid-cholesterol acyltransferase in selected bacterial species. J. Bacteriol. 1979, 139, 132–136. [Google Scholar] [CrossRef] [Green Version]
- Anguita, J.; Aparicio, L.B.R.; Naharro, G. Purification, Gene Cloning, Amino-Acid-Sequence Analysis, and Expression of an Extracellular Lipase from an Aeromonas-Hydrophila Human Isolate. Appl. Environ. Microb. 1993, 59, 2411–2417. [Google Scholar] [CrossRef] [Green Version]
- Whitby, P.W.; Landon, M.; Coleman, G. The Cloning and Nucleotide-Sequence of the Serine Protease Gene (Aspa) of Aeromonas-Salmonicida Ssp Salmonicida. FEMS Microbiol. Lett. 1992, 99, 65–72. [Google Scholar] [CrossRef]
- Bassler, B.L.; Wright, M.; Silverman, M.R. Multiple signalling systems controlling expression of luminescence in Vibrio harveyi: Sequence and function of genes encoding a second sensory pathway. Mol. Microbiol. 1994, 13, 273–286. [Google Scholar] [CrossRef]
- Timmen, M.; Bassler, B.L.; Jung, K. AI-1 influences the kinase activity but not the phosphatase activity of LuxN of Vibrio harveyi. J. Biol. Chem. 2006, 281, 24398–24404. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Turovskiy, Y.; Chikindas, M.L. Autoinducer-2 bioassay is a qualitative, not quantitative method influenced by glucose. J. Microbiol. Methods 2006, 66, 497–503. [Google Scholar] [CrossRef] [PubMed]
- Vilchez, R.; Lemme, A.; Thiel, V.; Schulz, S.; Sztajer, H.; Wagner-Dobler, I. Analysing traces of autoinducer-2 requires standardization of the Vibrio harveyi bioassay. Anal. Bioanal. Chem. 2007, 387, 489–496. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, T.N.; Kaksonen, A.H.; Hong, P.Y. Evaluation of two autoinducer-2 quantification methods for application in marine environments. J. Appl. Microbiol. 2018, 124, 1469–1479. [Google Scholar] [CrossRef] [Green Version]
- Aharoni, R.; Bronstheyn, M.; Jabbour, A.; Zaks, B.; Srebnik, M.; Steinberg, D. Oxazaborolidine derivatives inducing autoinducer-2 signal transduction in Vibrio harveyi. Bioorg. Med. Chem. 2008, 16, 1596–1604. [Google Scholar] [CrossRef]
- De Keersmaecker, S.C.; Sonck, K.; Vanderleyden, J. Let LuxS speak up in AI-2 signaling. Trends Microbiol. 2006, 14, 114–119. [Google Scholar] [CrossRef]
- Moreira, C.G.; Palmer, K.; Whiteley, M.; Sircili, M.P.; Trabulsi, L.R.; Castro, A.F.; Sperandio, V. Bundle-forming pili and EspA are involved in biofilm formation by enteropathogenic Escherichia coli. J. Bacteriol. 2006, 188, 3952–3961. [Google Scholar] [CrossRef] [Green Version]
- Sun, Y.; Li, Y.; Luo, Q.; Huang, J.; Chen, J.; Zhang, R.; Wang, X. LuxS/AI-2 Quorum Sensing System in Edwardsiella piscicida Promotes Biofilm Formation and Pathogenicity. Infect. Immun. 2020, 88, e00907-19. [Google Scholar] [CrossRef]
- Lyon, W.R.; Madden, J.C.; Levin, J.C.; Stein, J.L.; Caparon, M.G. Mutation of luxS affects growth and virulence factor expression in Streptococcus pyogenes. Mol. Microbiol. 2001, 42, 145–157. [Google Scholar] [CrossRef]
- Jones, M.B.; Blaser, M.J. Detection of a luxS-signaling molecule in Bacillus anthracis. Infect. Immun. 2003, 71, 3914–3919. [Google Scholar] [CrossRef] [Green Version]
- Sambrook, J.; Fritsch, E.F.; Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory: Cold Spring Harbor, NY, USA, 1989. [Google Scholar]
- Kozlova, E.V.; Popov, V.L.; Sha, J.; Foltz, S.M.; Erova, T.E.; Agar, S.L.; Horneman, A.J.; Chopra, A.K. Mutation in the S-ribosylhomocysteinase (luxS) gene involved in quorum sensing affects biofilm formation and virulence in a clinical isolate of Aeromonas hydrophila. Microb. Pathog. 2008, 45, 343–354. [Google Scholar] [CrossRef] [PubMed]
- Vendeville, A.; Winzer, K.; Heurlier, K.; Tang, C.M.; Hardie, K.R. Making ‘sense’ of metabolism: Autoinducer-2, LuxS and pathogenic bacteria. Nat. Rev. Microbiol. 2005, 3, 383–396. [Google Scholar] [CrossRef] [PubMed]
- Skoog, E.C.; Padra, M.; Aberg, A.; Gideonsson, P.; Obi, I.; Quintana-Hayashi, M.P.; Arnqvist, A.; Linden, S.K. BabA dependent binding of Helicobacter pylori to human gastric mucins cause aggregation that inhibits proliferation and is regulated via ArsS. Sci. Rep. 2017, 7, 40656. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ismail, A.S.; Valastyan, J.S.; Bassler, B.L. A Host-Produced Autoinducer-2 Mimic Activates Bacterial Quorum Sensing. Cell Host Microbe 2016, 19, 470–480. [Google Scholar] [CrossRef] [Green Version]
- Cole, S.P.; Harwood, J.; Lee, R.; She, R.; Guiney, D.G. Characterization of monospecies biofilm formation by Helicobacter pylori. J. Bacteriol. 2004, 186, 3124–3132. [Google Scholar] [CrossRef] [Green Version]
- Anderson, J.K.; Huang, J.Y.; Wreden, C.; Sweeney, E.G.; Goers, J.; Remington, S.J.; Guillemin, K. Chemorepulsion from the Quorum Signal Autoinducer-2 Promotes Helicobacter pylori Biofilm Dispersal. mBio 2015, 6, e00379. [Google Scholar] [CrossRef] [Green Version]
- Liu, Z.; Miyashiro, T.; Tsou, A.; Hsiao, A.; Goulian, M.; Zhu, J. Mucosal penetration primes Vibrio cholerae for host colonization by repressing quorum sensing. Proc. Natl. Acad. Sci. USA 2008, 105, 9769–9774. [Google Scholar] [CrossRef] [Green Version]
- Umelo, E.; Trust, T.J. Identification and molecular characterization of two tandemly located flagellin genes from Aeromonas salmonicida A449. J. Bacteriol. 1997, 179, 5292–5299. [Google Scholar] [CrossRef] [Green Version]
- Masada, C.L.; LaPatra, S.E.; Morton, A.W.; Strom, M.S. An Aeromonas salmonicida type IV pilin is required for virulence in rainbow trout Oncorhynchus mykiss. Dis. Aquat. Org. 2002, 51, 13–25. [Google Scholar] [CrossRef] [Green Version]
- Boyd, J.M.; Dacanay, A.; Knickle, L.C.; Touhami, A.; Brown, L.L.; Jericho, M.H.; Johnson, S.C.; Reith, M. Contribution of type IV pili to the virulence of Aeromonas salmonicida subsp. salmonicida in Atlantic salmon (Salmo salar L.). Infect. Immun. 2008, 76, 1445–1455. [Google Scholar] [CrossRef] [Green Version]
- Dacanay, A.; Boyd, J.M.; Fast, M.D.; Knickle, L.C.; Reith, M.E. Aeromonas salmonicida Type I pilus system contributes to host colonization but not invasion. Dis. Aquat. Org. 2010, 88, 199–206. [Google Scholar] [CrossRef] [PubMed]
- Glessner, A.; Smith, R.S.; Iglewski, B.H.; Robinson, J.B. Roles of Pseudomonas aeruginosa las and rhl quorum-sensing systems in control of twitching motility. J. Bacteriol. 1999, 181, 1623–1629. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bruhn, J.B.; Dalsgaard, I.; Nielsen, K.F.; Buchholtz, C.; Larsen, J.L.; Gram, L. Quorum sensing signal molecules (acylated homoserine lactones) in gram-negative fish pathogenic bacteria. Dis. Aquat. Org. 2005, 65, 43–52. [Google Scholar] [CrossRef]
- Venkatakrishnan, V.; Padra, J.T.; Sundh, H.; Sundell, K.; Jin, C.; Langeland, M.; Carlberg, H.; Vidakovic, A.; Lundh, T.; Karlsson, N.G.; et al. Exploring the Arctic Charr Intestinal Glycome: Evidence of Increased N-Glycolylneuraminic Acid Levels and Changed Host-Pathogen Interactions in Response to Inflammation. J. Proteome Res. 2019, 18, 1760–1773. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Linden, S.K.; Sheng, Y.H.; Every, A.L.; Miles, K.M.; Skoog, E.C.; Florin, T.H.; Sutton, P.; McGuckin, M.A. MUC1 limits Helicobacter pylori infection both by steric hindrance and by acting as a releasable decoy. PLoS Pathog. 2009, 5, e1000617. [Google Scholar] [CrossRef] [PubMed]
- Phippen, B.L.; Oliver, J.D. Clinical and environmental genotypes of Vibrio vulnificus display distinct, quorum-sensing-mediated, chitin detachment dynamics. Pathog. Dis. 2015, 73, ftv072. [Google Scholar] [CrossRef] [Green Version]
- Simon, R.; Priefer, U.; Pühler, A. A Broad Host Range Mobilization System for In Vivo Genetic Engineering: Transposon Mutagenesis in Gram Negative Bacteria. Bio Technol. 1983, 1, 784–791. [Google Scholar] [CrossRef]
- Thorell, K.; Sharma, A.; Rudbeck, E.; Kirangwa, J.; Alvarez-Carretero, S.; Boulund, F. BACTpipe: Bacterial Whole Genome Sequence Assembly and Annotation Pipeline. Available online: https://github.com/ctmrbio/BACTpipe (accessed on 13 February 2021).
Strain or Plasmid | Description | Source/Reference |
---|---|---|
A. salmonicida ssp. salmonicida strain VI-88/09/03175 | - | Norwegian Veterinary Institute, Norway |
A. salmonicida ssp. salmonicida strain VI-88/09/03175 ΔluxS | luxS deficient | This study |
E. coli S17-1 | Mobilizing donor for conjugation RP4-2(Km::Tn7,Tc::Mu-1), pro-82, LAMpir, recA1, endA1, thiE1, hsdR17, creC510 | [49] |
V. harvey BB170 | Reporter for AI-2 bioassay | ATCC BAA-1117 |
pRE112 plasmid | Suicide vector; R6K ori sacB CmR | Addgene |
ΔluxS_pRE112 plasmid | Cmr; pRE112 bearing homologous arms of luxS | This study. |
Component | DM Medium | CM9 Medium |
---|---|---|
Ca(NO3)2·4H2O | 0.1 g/L | |
KCl | 0.4 g/L | |
MgSO4·7H2O | 0.1 g/L | |
NaCl | 6 g/L | 0.5 g/L |
Na2HPO4 | 0.8 g/L | 12.8 g/L |
NaHCO3 | 2 g/L | |
FeSO4 | 2 mg/L | |
BSA | 5 g/L | |
adenine | 50 mg/L | |
lipoic acid | 3 mg/L | |
alanine | 44.5 mg/L | |
arginine | 632 mg/L | |
asparagine | 75 mg/L | |
aspartic acid | 66.5 mg/L | |
cysteine | 120 mg/L | |
glutamic acid | 73.5 mg/L | |
glutamine | 300 mg/L | |
glycine | 37.5 mg/L | |
histidine | 110 mg/L | |
isoleucine | 262.5 mg/L | |
leucine | 262 mg/L | |
lysine | 362.5 mg/L | |
methionine | 75.5 mg/L | |
phenylalanine | 165 mg/L | |
proline | 57.5 mg/L | |
serine | 52.5 mg/L | |
threonine | 238 mg/L | |
tryptophan | 51 mg/L | |
tyrosine | 180 mg/L | |
valine | 234 mg/L | |
D-biotin | 0.2 mg/L | |
choline chloride | 3 mg/L | |
folic acid | 1 mg/L | |
myo-inositol | 35 mg/L | |
niacinamide | 1 mg/L | |
p-aminobenzoicacid | 1 mg/L | |
D-pantothenicacid | 1.25 mg/L | |
pyridoxinehydrochloride | 1 mg/L | |
riboflavin | 0.2 mg/L | |
thiamine hydrochloride | 1 mg/L | |
vitamin B12 (cyanocobalamin) | 5 µg/L | |
KH2PO4 | 3 g/L | |
NH4Cl | 1.0 g/L | |
MgSO4 | 0.24 g/L | |
CaCl2 | 11.1 mg/L | |
BactoTM Casamino acids | 40 g/L |
Primer | Sequence (5′−3′) |
---|---|
A-F | ctcgatatcgcatgcggtaccGAAGCCATAATCAAACCGTT |
A-R | catgcacaacTTCTGACTCCTGATTTGGTTAC |
B-F | ggagtcagaaGTTGTGCATGGCAAAAATGA |
B-R | caagcttcttctagaggtaccGGATAACTATACCCTTTGGTATAAC |
luxS-up-F | CTGAACGGCAATGGTGTGGAGA |
luxS-down-R | GCACGGTCAACACATCGCTCAT |
LuxS-F | ATGAGCGATGTGTTGACCGT |
LuxS-R | CGATCTCATGGGCTTCCTCC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Padra, J.T.; Loibman, S.O.; Thorell, K.; Sundh, H.; Sundell, K.; Lindén, S.K. Atlantic Salmon Mucins Inhibit LuxS-Dependent A. Salmonicida AI-2 Quorum Sensing in an N-Acetylneuraminic Acid-Dependent Manner. Int. J. Mol. Sci. 2022, 23, 4326. https://doi.org/10.3390/ijms23084326
Padra JT, Loibman SO, Thorell K, Sundh H, Sundell K, Lindén SK. Atlantic Salmon Mucins Inhibit LuxS-Dependent A. Salmonicida AI-2 Quorum Sensing in an N-Acetylneuraminic Acid-Dependent Manner. International Journal of Molecular Sciences. 2022; 23(8):4326. https://doi.org/10.3390/ijms23084326
Chicago/Turabian StylePadra, János Tamás, Stefany Ojaimi Loibman, Kaisa Thorell, Henrik Sundh, Kristina Sundell, and Sara K. Lindén. 2022. "Atlantic Salmon Mucins Inhibit LuxS-Dependent A. Salmonicida AI-2 Quorum Sensing in an N-Acetylneuraminic Acid-Dependent Manner" International Journal of Molecular Sciences 23, no. 8: 4326. https://doi.org/10.3390/ijms23084326
APA StylePadra, J. T., Loibman, S. O., Thorell, K., Sundh, H., Sundell, K., & Lindén, S. K. (2022). Atlantic Salmon Mucins Inhibit LuxS-Dependent A. Salmonicida AI-2 Quorum Sensing in an N-Acetylneuraminic Acid-Dependent Manner. International Journal of Molecular Sciences, 23(8), 4326. https://doi.org/10.3390/ijms23084326