p62 Promotes the Mitochondrial Localization of p53 through Its UBA Domain and Participates in Regulating the Sensitivity of Ovarian Cancer Cells to Cisplatin
Abstract
:1. Introduction
2. Results
2.1. High p53 Expression Was Associated with Cisplatin Sensitivity in Ovarian Cancer Cells
2.2. Epox-Induced Proteasome Inhibition Led to Mitochondrial Dysfunction and UPRmt in Ovarian Cancer Cells
2.3. Inhibition of the Proteasome Pathway Affected the Expression of Mitochondrial Respiratory Chain Subunits in Ovarian Cancer Cells
2.4. Inhibition of the Proteasome Pathway Promoted Mitochondrial Localization of p53 in Ovarian Cancer Cells
2.5. UBA Domain Deletion in p62 Inhibited Mitochondrial Localization of p53
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Reagents and Antibodies
4.3. Cell Viability Assays
4.4. Mitochondrial Membrane Potential (MMP) Detection
4.5. ATP Measurement
4.6. Detection of the Mitochondrial ROS Levels
4.7. Determination of the Relative mtDNA Copy Number
4.8. Western Blot Analysis
4.9. Cell Transfection
4.10. RNA Extraction and Quantitative Real-Time PCR(qPCR)
4.11. Mitochondria Isolation
4.12. Nuclear Isolation
4.13. Immunofluorescence
4.14. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2018. CA Cancer J. Clin. 2018, 68, 7–30. [Google Scholar] [CrossRef] [PubMed]
- Lupia, M.; Cavallaro, U. Ovarian cancer stem cells: Still an elusive entity? Mol. Cancer 2017, 16, 64. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Oronsky, B.; Ray, C.M.; Spira, A.I.; Trepel, J.B.; Carter, C.A.; Cottrill, H.M. A brief review of the management of platinum-resistant-platinum-refractory ovarian cancer. Med. Oncol. 2017, 34, 103. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Yu, Y.; Jiang, Z.; Cao, W.M.; Wang, Z.; Dou, J.; Zhao, Y.; Cui, Y.; Zhang, H. Next-generation proteasome inhibitor MLN9708 sensitizes breast cancer cells to doxorubicin-induced apoptosis. Sci. Rep. 2016, 6, 26456. [Google Scholar] [CrossRef] [PubMed]
- Li, Q.Z.; Sun, L.P.; Shi, H.Y.; Chen, Y.; Shen, H. The new-generation proteasome inhibitor oprozomib increases the sensitivity of cervical cancer cells to cisplatin-induced apoptosis. J. Biol. Regul. Homeost. Agents 2021, 35, 559–569. [Google Scholar] [CrossRef] [PubMed]
- Yan, X.Y.; Zhong, X.R.; Yu, S.H.; Zhang, L.C.; Liu, Y.N.; Zhang, Y.; Sun, L.K.; Su, J. p62 aggregates mediated Caspase 8 activation is responsible for progression of ovarian cancer. J. Cell Mol. Med. 2019, 23, 4030–4042. [Google Scholar] [CrossRef]
- Boija, A.; Klein, I.A.; Young, R.A. Biomolecular Condensates and Cancer. Cancer Cell 2021, 39, 174–192. [Google Scholar] [CrossRef]
- Bieging, K.T.; Mello, S.S.; Attardi, L.D. Unravelling mechanisms of p53-mediated tumour suppression. Nat. Rev. Cancer 2014, 14, 359–370. [Google Scholar] [CrossRef] [Green Version]
- Vousden, K.H.; Ryan, K.M. p53 and metabolism. Nat. Rev. Cancer 2009, 9, 691–700. [Google Scholar] [CrossRef]
- Humpton, T.J.; Vousden, K.H. Regulation of Cellular Metabolism and Hypoxia by p53. Cold Spring Harb. Perspect Med. 2016, 6, a026146. [Google Scholar] [CrossRef] [Green Version]
- Li, Y.; Zhang, M.C.; Xu, X.K.; Zhao, Y.; Mahanand, C.; Zhu, T.; Deng, H.; Nevo, E.; Du, J.Z.; Chen, X.Q. Functional Diversity of p53 in Human and Wild Animals. Front. Endocrinol. 2019, 10, 152. [Google Scholar] [CrossRef] [PubMed]
- Pant, V.; Lozano, G. Limiting the power of p53 through the ubiquitin proteasome pathway. Genes. Dev. 2014, 28, 1739–1751. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guo, K.Y.; Han, L.; Li, X.; Yang, A.V.; Lu, J.; Guan, S.; Li, H.; Yu, Y.; Zhao, Y.; Yang, J.; et al. Novel proteasome inhibitor delanzomib sensitizes cervical cancer cells to doxorubicin-induced apoptosis via stabilizing tumor suppressor proteins in the p53 pathway. Oncotarget 2017, 8, 114123–114135. [Google Scholar] [CrossRef] [Green Version]
- Xue, Y.; Barker, N.; Hoon, S.; He, P.; Thakur, T.; Abdeen, S.R.; Maruthappan, P.; Ghadessy, F.J.; Lane, D.P. Bortezomib Stabilizes and Activates p53 in Proliferative Compartments of Both Normal and Tumor Tissues In Vivo. Cancer Res. 2019, 79, 3595–3607. [Google Scholar] [CrossRef] [PubMed]
- Tasdemir, E.; Maiuri, M.C.; Galluzzi, L.; Vitale, I.; Djavaheri-Mergny, M.; D’Amelio, M.; Criollo, A.; Morselli, E.; Zhu, C.; Harper, F.; et al. Regulation of autophagy by cytoplasmic p53. Nat. Cell Biol. 2008, 10, 676–687. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Strasser, A.; Cory, S.; Adams, J.M. Deciphering the rules of programmed cell death to improve therapy of cancer and other diseases. Embo J. 2011, 30, 3667–3683. [Google Scholar] [CrossRef] [PubMed]
- Youle, R.J.; Strasser, A. The BCL-2 protein family: Opposing activities that mediate cell death. Nat. Rev. Mol. Cell Biol. 2008, 9, 47–59. [Google Scholar] [CrossRef]
- Deng, P.; Haynes, C.M. Mitochondrial dysfunction in cancer: Potential roles of ATF5 and the mitochondrial UPR. Semin. Cancer Biol. 2017, 47, 43–49. [Google Scholar] [CrossRef] [PubMed]
- Karpel-Massler, G.; Horst, B.A.; Shu, C.; Chau, L.; Tsujiuchi, T.; Bruce, J.N.; Canoll, P.; Greene, L.A.; Angelastro, J.M.; Siegelin, M.D. A Synthetic Cell-Penetrating Dominant-Negative ATF5 Peptide Exerts Anticancer Activity against a Broad Spectrum of Treatment-Resistant Cancers. Clin. Cancer Res. 2016, 22, 4698–4711. [Google Scholar] [CrossRef] [Green Version]
- Nargund, A.M.; Pellegrino, M.W.; Fiorese, C.J.; Baker, B.M.; Haynes, C.M. Mitochondrial import efficiency of ATFS-1 regulates mitochondrial UPR activation. Science 2012, 337, 587–590. [Google Scholar] [CrossRef] [Green Version]
- Fiorese, C.J.; Schulz, A.M.; Lin, Y.F.; Rosin, N.; Pellegrino, M.W.; Haynes, C.M. The Transcription Factor ATF5 Mediates a Mammalian Mitochondrial UPR. Curr. Biol. 2016, 26, 2037–2043. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sheng, Z.; Li, L.; Zhu, L.J.; Smith, T.W.; Demers, A.; Ross, A.H.; Moser, R.P.; Green, M.R. A genome-wide RNA interference screen reveals an essential CREB3L2-ATF5-MCL1 survival pathway in malignant glioma with therapeutic implications. Nat. Med. 2010, 16, 671–677. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nargund, A.M.; Fiorese, C.J.; Pellegrino, M.W.; Deng, P.; Haynes, C.M. Mitochondrial and nuclear accumulation of the transcription factor ATFS-1 promotes OXPHOS recovery during the UPR(mt). Mol. Cell 2015, 58, 123–133. [Google Scholar] [CrossRef] [Green Version]
- Sahin, E.; Colla, S.; Liesa, M.; Moslehi, J.; Müller, F.L.; Guo, M.; Cooper, M.; Kotton, D.; Fabian, A.J.; Walkey, C.; et al. Telomere dysfunction induces metabolic and mitochondrial compromise. Nature 2011, 470, 359–365. [Google Scholar] [CrossRef] [Green Version]
- Memme, J.M.; Oliveira, A.N.; Hood, D.A. p53 regulates skeletal muscle mitophagy and mitochondrial quality control following denervation-induced muscle disuse. J. Biol. Chem. 2021, 298, 101540. [Google Scholar] [CrossRef] [PubMed]
- Bennett, C.F.; Kaeberlein, M. The mitochondrial unfolded protein response and increased longevity: Cause, consequence, or correlation? Exp. Gerontol. 2014, 56, 142–146. [Google Scholar] [CrossRef] [Green Version]
- Bourougaa, K.; Naski, N.; Boularan, C.; Mlynarczyk, C.; Candeias, M.M.; Marullo, S.; Fåhraeus, R. Endoplasmic reticulum stress induces G2 cell-cycle arrest via mRNA translation of the p53 isoform p53/47. Mol. Cell 2010, 38, 78–88. [Google Scholar] [CrossRef]
- Lamark, T.; Svenning, S.; Johansen, T. Regulation of selective autophagy: The p62/SQSTM1 paradigm. Essays Biochem. 2017, 61, 609–624. [Google Scholar] [CrossRef] [PubMed]
- Gabai, V.L.; Shifrin, V.I. Feasibility analysis of p62 (SQSTM1)-encoding DNA vaccine as a novel cancer immunotherapy. Int. Rev. Immunol. 2014, 33, 375–382. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Y.B.; Gong, J.L.; Xing, T.Y.; Zheng, S.P.; Ding, W. Autophagy protein p62/SQSTM1 is involved in HAMLET-induced cell death by modulating apotosis in U87MG cells. Cell Death Dis. 2013, 4, e550. [Google Scholar] [CrossRef] [Green Version]
- Shi, J.; Wong, J.; Piesik, P.; Fung, G.; Zhang, J.; Jagdeo, J.; Li, X.; Jan, E.; Luo, H. Cleavage of sequestosome 1/p62 by an enteroviral protease results in disrupted selective autophagy and impaired NFKB signaling. Autophagy 2013, 9, 1591–1603. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Seibenhener, M.L.; Babu, J.R.; Geetha, T.; Wong, H.C.; Krishna, N.R.; Wooten, M.W. Sequestosome 1/p62 is a polyubiquitin chain binding protein involved in ubiquitin proteasome degradation. Mol. Cell Biol. 2004, 24, 8055–8068. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pankiv, S.; Lamark, T.; Bruun, J.A.; Øvervatn, A.; Bjørkøy, G.; Johansen, T. Nucleocytoplasmic shuttling of p62/SQSTM1 and its role in recruitment of nuclear polyubiquitinated proteins to promyelocytic leukemia bodies. J. Biol. Chem. 2010, 285, 5941–5953. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Noguchi, T.; Suzuki, M.; Mutoh, N.; Hirata, Y.; Tsuchida, M.; Miyagawa, S.; Hwang, G.W.; Aoki, J.; Matsuzawa, A. Nuclear-accumulated SQSTM1/p62-based ALIS act as microdomains sensing cellular stresses and triggering oxidative stress-induced parthanatos. Cell Death Dis. 2018, 9, 1193. [Google Scholar] [CrossRef] [PubMed]
- Bui, C.B.; Shin, J. Persistent expression of Nqo1 by p62-mediated Nrf2 activation facilitates p53-dependent mitotic catastrophe. Biochem. Biophys. Res. Commun. 2011, 412, 347–352. [Google Scholar] [CrossRef] [PubMed]
- Ai, T.J.; Sun, J.Y.; Du, L.J.; Shi, C.; Li, C.; Sun, X.N.; Liu, Y.; Li, L.; Xia, Z.; Jia, L.; et al. Inhibition of neddylation by MLN4924 improves neointimal hyperplasia and promotes apoptosis of vascular smooth muscle cells through p53 and p62. Cell Death Differ. 2018, 25, 319–329. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.C.; Wei, Y.H. Mitochondrial biogenesis and mitochondrial DNA maintenance of mammalian cells under oxidative stress. Int. J. Biochem. Cell Biol. 2005, 37, 822–834. [Google Scholar] [CrossRef]
- Gaziev, A.I.; Abdullaev, S.; Podlutsky, A. Mitochondrial function and mitochondrial DNA maintenance with advancing age. Biogerontology 2014, 15, 417–438. [Google Scholar] [CrossRef]
- Gustafsson, C.M.; Falkenberg, M.; Larsson, N.G. Maintenance and Expression of Mammalian Mitochondrial DNA. Annu. Rev. Biochem. 2016, 85, 133–160. [Google Scholar] [CrossRef]
- Koc, E.C.; Koc, H. Regulation of mammalian mitochondrial translation by post-translational modifications. Biochim. Biophys. Acta 2012, 1819, 1055–1066. [Google Scholar] [CrossRef]
- Falkenberg, M.; Gaspari, M.; Rantanen, A.; Trifunovic, A.; Larsson, N.G.; Gustafsson, C.M. Mitochondrial transcription factors B1 and B2 activate transcription of human mtDNA. Nat. Genet. 2002, 31, 289–294. [Google Scholar] [CrossRef] [PubMed]
- Shokolenko, I.N.; Alexeyev, M.F. Mitochondrial transcription in mammalian cells. Front. Biosci. 2017, 22, 835–853. [Google Scholar] [CrossRef] [Green Version]
- Cohen-Kaplan, V.; Ciechanover, A.; Livneh, I. p62 at the crossroad of the ubiquitin-proteasome system and autophagy. Oncotarget 2016, 7, 83833–83834. [Google Scholar] [CrossRef] [PubMed]
- Zheng, H.C. The molecular mechanisms of chemoresistance in cancers. Oncotarget 2017, 8, 59950–59964. [Google Scholar] [CrossRef] [Green Version]
- Deshaies, R.J. Proteotoxic crisis, the ubiquitin-proteasome system, and cancer therapy. BMC Biol. 2014, 12, 94. [Google Scholar] [CrossRef] [PubMed]
- Fricker, L.D. Proteasome Inhibitor Drugs. Annu. Rev. Pharmacol. Toxicol. 2020, 60, 457–476. [Google Scholar] [CrossRef] [Green Version]
- Inuzuka, H.; Shaik, S.; Onoyama, I.; Gao, D.; Tseng, A.; Maser, R.S.; Zhai, B.; Wan, L.; Gutierrez, A.; Lau, A.W.; et al. SCF(FBW7) regulates cellular apoptosis by targeting MCL1 for ubiquitylation and destruction. Nature 2011, 471, 104–109. [Google Scholar] [CrossRef]
- Bock, F.J.; Tait, S.W.G. Mitochondria as multifaceted regulators of cell death. Nat. Rev. Mol. Cell Biol. 2020, 21, 85–100. [Google Scholar] [CrossRef]
- Tsakiri, E.N.; Gumeni, S.; Vougas, K.; Pendin, D.; Papassideri, I.; Daga, A.; Gorgoulis, V.; Juhász, G.; Scorrano, L.; Trougakos, I.P. Proteasome dysfunction induces excessive proteome instability and loss of mitostasis that can be mitigated by enhancing mitochondrial fusion or autophagy. Autophagy 2019, 15, 1757–1773. [Google Scholar] [CrossRef] [Green Version]
- Bragado, P.; Armesilla, A.; Silva, A.; Porras, A. Apoptosis by cisplatin requires p53 mediated p38alpha MAPK activation through ROS generation. Apoptosis 2007, 12, 1733–1742. [Google Scholar] [CrossRef]
- Li, J.; Li, Y.; Chen, L.; Yu, B.; Xue, Y.; Guo, R.; Su, J.; Liu, Y.; Sun, L. p53/PGC-1α-mediated mitochondrial dysfunction promotes PC3 prostate cancer cell apoptosis. Mol. Med. Rep. 2020, 22, 155–164. [Google Scholar] [CrossRef] [PubMed]
- Hillen, H.S.; Temiakov, D.; Cramer, P. Structural basis of mitochondrial transcription. Nat. Struct. Mol. Biol. 2018, 25, 754–765. [Google Scholar] [CrossRef] [PubMed]
- Myeku, N.; Figueiredo-Pereira, M.E. Dynamics of the degradation of ubiquitinated proteins by proteasomes and autophagy: Association with sequestosome 1/p62. J. Biol. Chem. 2011, 286, 22426–22440. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yu, S.; Yan, X.; Tian, R.; Xu, L.; Zhao, Y.; Sun, L.; Su, J. An Experimentally Induced Mutation in the UBA Domain of p62 Changes the Sensitivity of Cisplatin by Up-Regulating HK2 Localisation on the Mitochondria and Increasing Mitophagy in A2780 Ovarian Cancer Cells. Int. J. Mol. Sci. 2021, 22, 3983. [Google Scholar] [CrossRef]
- Shen, L.; Zhou, L.; Xia, M.; Lin, N.; Ma, J.; Dong, D.; Sun, L. PGC1α regulates mitochondrial oxidative phosphorylation involved in cisplatin resistance in ovarian cancer cells via nucleo-mitochondrial transcriptional feedback. Exp. Cell Res. 2021, 398, 112369. [Google Scholar] [CrossRef]
Primer Name | Sequence (5′-3′) | Primer Name | Sequence (5′-3′) |
---|---|---|---|
MT-ND1 | ATGGCCAACCTCCTACTCCTCATT TTATGGCGTCAGCGAAGGGTTGTA | MT-ATP6 | TAGCCCACTTCTTACCACAAGGCA TGAGTAGGTGGCCTGCAGTAATGT |
MT-ND2 | ACTGCGCTAAGCTCGCACTGATTT GATTATGGATGCGGTTGCTTGCGT | MT-ATP8 | ACCGTATGGCCCACCATAATTACC TTTATGGGCTTTGGTGAGGGAGGT |
MT-ND3 | CCCTACCATGAGCCCTACAAACAA AGTCACTCATAGGCCAGACTTAGG | TFAM | ATGGCGTTTCTCCGAAGCAT TCCGCCCTATAAGCATCTTGA |
MT-ND4 | ACAAGCTCCATCTGCCTACGACAA TTATGAGAATGACTGCGCCGGTGA | TFB2M | GACCACTTACGTTCATTGACTCC CAGGGTTTCATCATACAGCCAT |
MT-ND4L | TATCGCTCACACCTCATATCCTCCCT AGGCGGCAAAGACTAGTATGGCAA | POLRMT | GCAAGACCAAGACCGCAGGAAG GCTACCATCTCCACTGCCACATTC |
MT-ND5 | ATCGGTTTCATCCTCGCCTTAGCA ACCTAATTGGGCTGATTTGCCTGC | mtHSP70 | CAAGCGACAGGCTGTCACCAAC CAACCCAGGCATCACCATTGG |
MT-ND6 | AGGATTGGTGCTGTGGGTGAAAGA ATAGGATCCTCCCGAATCAACCCT | HSP60 | GATGCTGTGGCCGTTACAATG GTCAATTGACTTTGCAACAGTCACAC |
MT-CO1 | ACCCTAGACCAAACCTACGCCAAA TAGGCCGAGAAAGTGTTGTGGGAA | HSP10 | TGGCAGGACAAGCGTTTAG GGTTACAGTTTCAGCAGCAC |
MT-CO2 | ACAGATGCAATTCCCGGACGTCTA GGCATGAAACTGTGGTTTGCTCCA | Lonp1 | AGCCTTATGTCGGCGTCTTTC CGTCCCCGTGTGGTAGATTTC |
MT-CO3 | ACTTCCACTCCATAACGCTCCTCA TGGCCTTGGTATGTGCTTTCTCGT | p53 | CAGCACATGACGGAGGTTGT TCATCCAAATACTCCACACGC |
MT-CYB | TCCTCCCGTGAGGCCAAATATCAT AAAGAATCGTGTGAGGGTGGGACT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kong, Q.; Yan, X.; Cheng, M.; Jiang, X.; Xu, L.; Shen, L.; Yu, H.; Sun, L. p62 Promotes the Mitochondrial Localization of p53 through Its UBA Domain and Participates in Regulating the Sensitivity of Ovarian Cancer Cells to Cisplatin. Int. J. Mol. Sci. 2022, 23, 3290. https://doi.org/10.3390/ijms23063290
Kong Q, Yan X, Cheng M, Jiang X, Xu L, Shen L, Yu H, Sun L. p62 Promotes the Mitochondrial Localization of p53 through Its UBA Domain and Participates in Regulating the Sensitivity of Ovarian Cancer Cells to Cisplatin. International Journal of Molecular Sciences. 2022; 23(6):3290. https://doi.org/10.3390/ijms23063290
Chicago/Turabian StyleKong, Qinghuan, Xiaoyu Yan, Meiyu Cheng, Xin Jiang, Long Xu, Luyan Shen, Huimei Yu, and Liankun Sun. 2022. "p62 Promotes the Mitochondrial Localization of p53 through Its UBA Domain and Participates in Regulating the Sensitivity of Ovarian Cancer Cells to Cisplatin" International Journal of Molecular Sciences 23, no. 6: 3290. https://doi.org/10.3390/ijms23063290
APA StyleKong, Q., Yan, X., Cheng, M., Jiang, X., Xu, L., Shen, L., Yu, H., & Sun, L. (2022). p62 Promotes the Mitochondrial Localization of p53 through Its UBA Domain and Participates in Regulating the Sensitivity of Ovarian Cancer Cells to Cisplatin. International Journal of Molecular Sciences, 23(6), 3290. https://doi.org/10.3390/ijms23063290