The Role of Synovial Membrane in the Development of a Potential In Vitro Model of Osteoarthritis
Abstract
:1. Introduction
2. Results
2.1. Phenotypic Characterization of SFs
2.2. Impact of Stimulation on SFs Proliferation Rate
2.3. Cytokine and Chemokine Release in CM from OA Tissues
2.4. Effect of CM from OA Joint Tissues and Cytokines on the Release of Pro-Inflammatory and Anti-Inflammatory Molecules by SFs
2.5. Gene Expression by Stimulated SFs
3. Discussion
4. Materials and Methods
4.1. Harvesting of OA Tissues and Preparation of CM
4.2. Isolation and Characterization of SFs
4.3. Stimulation of SFs with CM from OA Tissues and Cytokines
4.4. The Proliferation Rate of Stimulated SFs
4.5. Characterization of CM from OA Tissues and CM from Stimulated SFs by Multiplex Immunoassay
4.6. Analysis of Gene Expression by RT-qPCR
4.7. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Chen, D.; Shen, J.; Zhao, W.W.; Wang, T.Y.; Han, L.; Hamilton, J.L.; Im, H.J. Osteoarthritis: Toward a comprehensive understanding of pathological mechanism. Bone Res. 2017, 5, 16044. [Google Scholar] [CrossRef] [PubMed]
- Goldring, M.B.; Goldring, S.R. Articular cartilage and subchondral bone in the pathogenesis of osteoarthritis. Ann. N. Y. Acad. Sci. 2010, 1192, 230–237. [Google Scholar] [CrossRef] [PubMed]
- Mora, J.C.; Przkora, R.; Cruz-Almeida, Y. Knee osteoarthritis: Pathophysiology and current treatment modalities. J. Pain Res. 2018, 11, 2189–2196. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Neogi, T. The epidemiology and impact of pain in osteoarthritis. Osteoarthr. Cartil. 2013, 21, 1145–1153. [Google Scholar] [CrossRef] [Green Version]
- Sellam, J.; Berenbaum, F. The role of synovitis in pathophysiology and clinical symptoms of osteoarthritis. Nat. Rev. Rheumatol. 2010, 6, 625–635. [Google Scholar] [CrossRef]
- Atukorala, I.; Kwoh, C.K.; Guermazi, A.; Roemer, F.W.; Boudreau, R.M.; Hannon, M.J. Synovitis in knee osteoarthritis: A precursor of disease? Ann. Rheum. Dis. 2016, 75, 390–395. [Google Scholar] [CrossRef]
- Benito, M.J.; Veale, D.J.; Fitzgerald, O.; van den Berg, W.B.; Bresnihan, B. Synovial tissue inflammation in early and late osteoarthritis. Ann. Rheum. Dis. 2005, 64, 1263–1267. [Google Scholar] [CrossRef] [Green Version]
- Clockaerts, S.; Bastiaansen-Jenniskens, Y.M.; Runhaar, J.; Van Osch, G.J.V.M.; Van Offel, J.F.; Verhaar, J.A.N.; De Clerck, L.S.; Somville, J. The infrapatellar fat pad should be considered as an active osteoarthritic joint tissue: A narrative review. Osteoarthr. Cartil. 2010, 18, 876–882. [Google Scholar] [CrossRef] [Green Version]
- Kalaitzoglou, E.; Griffin, T.M.; Humphrey, M.B. Innate Immune Responses and Osteoarthritis. Curr. Rheumatol. Rep. 2017, 19, 45. [Google Scholar] [CrossRef]
- Samvelyan, H.J.; Hughes, D.; Stevens, C.; Staines, K.A. Models of Osteoarthritis: Relevance and New Insights. Calcif. Tissue Int. 2021, 109, 243–256. [Google Scholar] [CrossRef] [Green Version]
- Johnson, C.I.; Argyle, D.J.; Clements, D.N. In Vitro models for the study of osteoarthritis. Vet. J. 2016, 209, 40–49. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Singh, Y.P.; Moses, J.C.; Bhardwaj, N.; Mandal, B.B. Overcoming the Dependence on Animal Models for Osteoarthritis Therapeutics—The Promises and Prospects of In Vitro Models. Adv. Healthc. Mater. 2021, 10, 2100961. [Google Scholar] [CrossRef] [PubMed]
- Novakofski, K.D.; Torre, C.J.; Fortier, L.A. Interleukin-1α, -6, and -8 decrease Cdc42 activity resulting in loss of articular chondrocyte phenotype. J. Orthop. Res. Off. Publ. Orthop. Res. Soc. 2012, 30, 246–251. [Google Scholar] [CrossRef] [PubMed]
- Beekhuizen, M.; Bastiaansen-Jenniskens, Y.M.; Koevoet, W.; Saris, D.B.; Dhert, W.J.; Creemers, L.B.; van Osch, G.J. Osteoarthritic synovial tissue inhibition of proteoglycan production in human osteoarthritic knee cartilage: Establishment and characterization of a long-term cartilage-synovium coculture. Arthritis Rheum. 2011, 63, 1918–1927. [Google Scholar] [CrossRef]
- Jiang, J.; Nicoll, S.B.; Lu, H.H. Co-culture of osteoblasts and chondrocytes modulates cellular differentiation in vitro. Biochem. Biophys. Res. Commun. 2005, 338, 762–770. [Google Scholar] [CrossRef]
- Sanchez, C.; Deberg, M.A.; Piccardi, N.; Msika, P.; Reginster, J.Y.; Henrotin, Y.E. Subchondral bone osteoblasts induce phenotypic changes in human osteoarthritic chondrocytes. Osteoarthr. Cartil. 2005, 13, 988–997. [Google Scholar] [CrossRef] [Green Version]
- Bartolotti, I.; Roseti, L.; Petretta, M.; Grigolo, B.; Desando, G. A Roadmap of In Vitro Models in Osteoarthritis: A Focus on Their Biological Relevance in Regenerative Medicine. J. Clin. Med. 2021, 10, 1920. [Google Scholar] [CrossRef]
- Wojdasiewicz, P.; Poniatowski, L.A.; Szukiewicz, D. The Role of Inflammatory and Anti-Inflammatory Cytokines in the Pathogenesis of Osteoarthritis. Mediat. Inflamm. 2014, 2014, 561459. [Google Scholar] [CrossRef] [Green Version]
- Richardson, D.W.; Dodge, G.R. Effects of interleukin-1 beta and tumor necrosis factor-alpha on expression of matrix-related genes by cultured equine articular chondrocytes. Am. J. Vet. Res. 2000, 61, 624–630. [Google Scholar] [CrossRef]
- Fan, Z.; Soder, S.; Ehler, S.; Fundel, K.; Aigner, T. Activation of interleukin-1 signaling cascades in normal and osteoarthritic articular cartilage. Am. J. Pathol. 2007, 171, 938–946. [Google Scholar] [CrossRef] [Green Version]
- Chang, X.; Shen, J.R.; Yang, H.W.; Xu, Y.N.; Gao, W.; Wang, J.L.; Zhang, H.Y.; He, S.H. Upregulated expression of CCR3 in osteoarthritis and CCR3 mediated activation of fibroblast-like synoviocytes. Cytokine 2016, 77, 211–219. [Google Scholar] [CrossRef] [PubMed]
- Kageyama, Y.; Koide, Y.; Yoshida, A.; Uchijima, M.; Arai, T.; Miyamoto, S.; Ozeki, T.; Hiyoshi, M.; Kushida, K.; Inoue, T. Reduced susceptibility to collagen-induced arthritis in mice deficient in IFN-gamma receptor. J. Immunol. 1998, 161, 1542–1548. [Google Scholar] [PubMed]
- ManourySchwartz, B.; Chiocchia, G.; Bessis, N.; AbehsiraAmar, O.; Batteux, F.; Muller, S.; Huang, S.; Boissier, M.C.; Fournier, C. High susceptibility to collagen-induced arthritis in mice lacking IFN-gamma receptors. J. Immunol. 1997, 158, 5501–5506. [Google Scholar]
- Ahmad, R.; El Mabrouk, M.; Sylvester, J.; Zafarullah, M. Human osteoarthritic chondrocytes are impaired in matrix metalloproteinase-13 inhibition by IFN-gamma due to reduced IFN-gamma receptor levels. Osteoarthr. Cartil. 2009, 17, 1049–1055. [Google Scholar] [CrossRef] [Green Version]
- Eymard, F.; Pigenet, A.; Citadelle, D.; Flouzat-Lachaniette, C.H.; Poignard, A.; Benelli, C.; Berenbaum, F.; Chevalier, X.; Houard, X. Induction of an Inflammatory and Prodegradative Phenotype in Autologous Fibroblast-like Synoviocytes by the Infrapatellar Fat Pad From Patients With Knee Osteoarthritis. Arthritis Rheumatol. 2014, 66, 2165–2174. [Google Scholar] [CrossRef]
- Belluzzi, E.; Olivotto, E.; Toso, G.; Cigolotti, A.; Pozzuoli, A.; Biz, C.; Trisolino, G.; Ruggieri, P.; Grigolo, B.; Ramonda, R.; et al. Conditioned media from human osteoarthritic synovium induces inflammation in a synoviocyte cell line. Connect. Tissue Res. 2019, 60, 136–145. [Google Scholar] [CrossRef]
- Cope, P.J.; Ourradi, K.; Li, Y.; Sharif, M. Models of osteoarthritis: The good, the bad and the promising. Osteoarthr. Cartil. 2019, 27, 230–239. [Google Scholar] [CrossRef] [Green Version]
- Stefani, R.M.; Halder, S.S.; Estell, E.G.; Lee, A.J.; Silverstein, A.M.; Sobczak, E.; Chahine, N.O.; Ateshian, G.A.; Shah, R.P.; Hung, C.T. A Functional Tissue-Engineered Synovium Model to Study Osteoarthritis Progression and Treatment. Tissue Eng. Part A 2019, 25, 538–553. [Google Scholar] [CrossRef]
- Dominici, M.; Le Blanc, K.; Mueller, I.; Slaper-Cortenbach, I.; Marini, F.; Krause, D.; Deans, R.; Keating, A.; Prockop, D.; Horwitz, E. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 2006, 8, 315–317. [Google Scholar] [CrossRef]
- Cappellesso-Fleury, S.; Puissant-Lubrano, B.; Apoil, P.A.; Titeux, M.; Winterton, P.; Casteilla, L.; Bourin, P.; Blancher, A. Human Fibroblasts Share Immunosuppressive Properties with Bone Marrow Mesenchymal Stem Cells. J. Clin. Immunol. 2010, 30, 607–619. [Google Scholar] [CrossRef]
- Manferdini, C.; Paolella, F.; Gabusi, E.; Silvestri, Y.; Gambari, L.; Cattini, L.; Filardo, G.; Fleury-Cappellesso, S.; Lisignoli, G. From osteoarthritic synovium to synovial-derived cells characterization: Synovial macrophages are key effector cells. Arthritis Res. Ther. 2016, 18, 83. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Deligne, C.; Casulli, S.; Pigenet, A.; Bougault, C.; Campillo-Gimenez, L.; Nourissat, G.; Berenbaum, F.; Elbim, C.; Houard, X. Differential expression of interleukin-17 and interleukin-22 in inflamed and non-inflamed synovium from osteoarthritis patients. Osteoarthr. Cartil. 2015, 23, 1843–1852. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Favero, M.; Belluzzi, E.; Trisolino, G.; Goldring, M.; Goldring, S.; Cigolotti, A.; Pozzuoli, A.; Ruggieri, P.; Ramonda, R.; Grigolo, B.; et al. Inflammatory molecules produced by meniscus and synovium in early and end-stage osteoarthritis: A coculture study. J. Cell. Physiol. 2018, 234, 11176–11187. [Google Scholar] [CrossRef] [PubMed]
- Furuzawa-Carballeda, J.; Macip-Rodriguez, P.M.; Cabral, A.R. Osteoarthritis and rheumatoid arthritis pannus have similar qualitative metabolic characteristics and pro-inflammatory cytokine response. Clin. Exp. Rheumatol. 2008, 26, 554–560. [Google Scholar]
- Furman, B.D.; Kent, C.L.; Huebner, J.L.; Kraus, V.B.; McNulty, A.L.; Guilak, F.; Olson, S.A. CXCL10 is upregulated in synovium and cartilage following articular fracture. J. Orthop. Res. 2018, 36, 1220–1227. [Google Scholar] [CrossRef] [Green Version]
- Maccoux, L.J.; Salway, F.; Day, P.J.R.; Clements, D.N. Expression profiling of select cytokines in canine osteoarthritis tissues. Vet. Immunol. Immunopathol. 2007, 118, 59–67. [Google Scholar] [CrossRef]
- Fujita, Y.; Hara, Y.; Nezu, Y.; Yamaguchi, S.; Schulz, K.S.; Tagawa, M. Direct and indirect markers of cartilage metabolism in synovial fluid obtained from dogs with hip dysplasia and correlation with clinical and radiographic variables. Am. J. Vet. Res. 2005, 66, 2028–2033. [Google Scholar] [CrossRef]
- Pelletier, J.P.; Martel-Pelletier, J.; Abramson, S.B. Osteoarthritis, an inflammatory disease—Potential implication for the selection of new therapeutic targets. Arthritis Rheum. 2001, 44, 1237–1247. [Google Scholar] [CrossRef]
- Kouroupis, D.; Willman, M.A.; Best, T.M.; Kaplan, L.D.; Correa, D. Infrapatellar fat pad-derived mesenchymal stem cell-based spheroids enhance their therapeutic efficacy to reverse synovitis and fat pad fibrosis. Stem Cell Res. Ther. 2021, 12, 44. [Google Scholar] [CrossRef]
- Utomo, L.; Bastiaansen-Jenniskens, Y.M.; Verhaar, J.A.; van Osch, G.J. Cartilage inflammation and degeneration is enhanced by pro-inflammatory (M1) macrophages in vitro, but not inhibited directly by anti-inflammatory (M2) macrophages. Osteoarthr. Cartil. 2016, 24, 2162–2170. [Google Scholar] [CrossRef] [Green Version]
- Haltmayer, E.; Ribitsch, I.; Gabner, S.; Rosser, J.; Gueltekin, S.; Peham, J.; Giese, U.; Dolezal, M.; Egerbacher, M.; Jenner, F. Co-culture of osteochondral explants and synovial membrane as in vitro model for osteoarthritis. PLoS ONE 2019, 14, e0214709. [Google Scholar] [CrossRef] [PubMed]
- Bondeson, J.; Wainwright, S.D.; Lauder, S.; Amos, N.; Hughes, C.E. The role of synovial macrophages and macrophage-produced cytokines in driving aggrecanases, matrix metalloproteinases, and other destructive and inflammatory responses in osteoarthritis. Arthritis Res. Ther. 2006, 8, R187. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Conrozier, T.; Carlier, M.C.; Mathieu, P.; Colson, F.; Debard, A.L.; Richard, S.; Favret, H.; Bienvenu, J.; Vignon, E. Serum levels of YKL-40 and C reactive protein in patients with hip osteoarthritis and healthy subjects: A cross sectional study. Ann. Rheum. Dis. 2000, 59, 828–831. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vaananen, T.; Koskinen, A.; Paukkeri, E.L.; Hamalainen, M.; Moilanen, T.; Moilanen, E.; Vuolteenaho, K. YKL-40 as a Novel Factor Associated with Inflammation and Catabolic Mechanisms in Osteoarthritic Joints. Mediat. Inflamm. 2014, 2014, 215140. [Google Scholar] [CrossRef] [Green Version]
- Wisniewski, H.G.; Colon, E.; Liublinska, V.; Karia, R.J.; Stabler, T.V.; Attur, M.; Abramson, S.B.; Band, P.A.; Kraus, V.B. TSG-6 activity as a novel biomarker of progression in knee osteoarthritis. Osteoarthr. Cartil. 2014, 22, 235–241. [Google Scholar] [CrossRef] [Green Version]
- Yoshioka, S.; Ochsner, S.; Russell, D.L.; Ujioka, T.; Fujii, S.; Richards, J.S.; Espey, L.L. Expression of tumor necrosis factor-stimulated gene-6 in the rat ovary in response to an ovulatory dose of gonadotropin. Endocrinology 2000, 141, 4114–4119. [Google Scholar] [CrossRef]
- Chou, C.H.; Attarian, D.E.; Wisniewski, H.G.; Band, P.A.; Kraus, V.B. TSG-6—A double-edged sword for osteoarthritis (OA). Osteoarthr. Cartil. 2018, 26, 245–254. [Google Scholar] [CrossRef] [Green Version]
- Karsdal, M.A.; Madsen, S.H.; Christiansen, C.; Henriksen, K.; Fosang, A.J.; Sondergaard, B.C. Cartilage degradation is fully reversible in the presence of aggrecanase but not matrix metalloproteinase activity. Arthritis Res. Ther. 2008, 10, R63. [Google Scholar] [CrossRef] [Green Version]
- Schaller, S.; Henriksen, K.; Hoegh-Andersen, P.; Søndergaard, B.C.; Sumer, E.U.; Tanko, L.B.; Qvist, P.; Karsdal, M.A. In Vitro, ex vivo, and in vivo methodological approaches for studying therapeutic targets of osteoporosis and degenerative joint diseases: How biomarkers can assist? Assay Drug Dev. Technol. 2005, 3, 553–580. [Google Scholar] [CrossRef]
- Harvanova, D.; Tothova, T.; Sarissky, M.; Amrichova, J.; Rosocha, J. Isolation and Characterization of Synovial Mesenchymal Stem Cells. Folia Biol. 2011, 57, 119–124. [Google Scholar]
- Amrichova, J.; Spakova, T.; Rosocha, J.; Harvanova, D.; Bacenkova, D.; Lacko, M.; Hornak, S. Effect of PRP and PPP on proliferation and migration of human chondrocytes and synoviocytes in vitro. Cent. Eur. J. Biol. 2014, 9, 139–148. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, research0034. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Cell Surface Markers | CD14 | CD34 | CD45 | CD106 | CD26 | CD54 | CD73 | CD105 | CD90 |
---|---|---|---|---|---|---|---|---|---|
mean % ± SD | 1.45 ± 0.46 | 0.46 ± 0.18 | 0.28 ± 0.46 | 4.15 ± 2.38 | 82.1 ± 20.2 | 33.6 ± 7.86 | 99.8 ± 1.48 | 98.3 ± 0.82 | 91.9 ± 3.61 |
Gene | Forward Primer 5′ → 3′ | Reverse Primer 5′ → 3′ |
---|---|---|
RPL13 | CTCAAGGTGTTTGACGGCATCC | TACTTCCAGCCAACCTCGTGAG |
GAPDH | GTCTCCTCTGACTTCAACAGCG | ACCACCCTGTTGCTGTAGCCAA |
IL-6 | AGACAGCCACTCACCTCTTCAG | TTCTGCCAGTGCCTCTTTGCTG |
IL-8 | GAGAGTGATTGAGAGTGGACCAC | CACAACCCTCTGCACCCAGTTT |
MMP-1 | ATGAAGCAGCCCAGATGTGGAG | TGGTCCACATCTGCTCTTGGCA |
MMP-3 | CACTCACAGACCTGACTCGGTT | AAGCAGGATCACAGTTGGCTGG |
RANTES | CCTGCTGCTTTGCCTACATTGC | ACACACTTGGCGGTTCTTTCGG |
MCP-1 | AGAATCACCAGCAGCAAGTGTCC | TCCTGAACCCACTTCTGCTTGG |
TSG-6 | TCACCTACGCAGAAGCTAAGGC | TCCAACTCTGCCCTTAGCCATC |
YKL-40 | CCACAGTCCATAGAATCCTCGG | TGCCTGTCCTTCAGGTACTGCA |
ADAMTS-5 | CCTGGTCCAAATGCACTTCAGC | TCGTAGGTCTGTCCTGGGAGTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Harvanova, D.; Matejova, J.; Slovinska, L.; Lacko, M.; Gulova, S.; Fecskeova, L.K.; Janockova, J.; Spakova, T.; Rosocha, J. The Role of Synovial Membrane in the Development of a Potential In Vitro Model of Osteoarthritis. Int. J. Mol. Sci. 2022, 23, 2475. https://doi.org/10.3390/ijms23052475
Harvanova D, Matejova J, Slovinska L, Lacko M, Gulova S, Fecskeova LK, Janockova J, Spakova T, Rosocha J. The Role of Synovial Membrane in the Development of a Potential In Vitro Model of Osteoarthritis. International Journal of Molecular Sciences. 2022; 23(5):2475. https://doi.org/10.3390/ijms23052475
Chicago/Turabian StyleHarvanova, Denisa, Jana Matejova, Lucia Slovinska, Marek Lacko, Slavomira Gulova, Livia Kolesar Fecskeova, Jana Janockova, Timea Spakova, and Jan Rosocha. 2022. "The Role of Synovial Membrane in the Development of a Potential In Vitro Model of Osteoarthritis" International Journal of Molecular Sciences 23, no. 5: 2475. https://doi.org/10.3390/ijms23052475