Long-Term Dietary Taurine Lowers Plasma Levels of Cholesterol and Bile Acids
Abstract
:1. Introduction
2. Results
2.1. Taurine Lowered Plasma Levels of Cholesterol and Bile Acids
2.2. Taurine Induced the Expression of the Cyp7a1 Gene and Suppressed the FGF21-ERK Signal in the Liver
2.3. Taurine Suppressed the Expression of FGF21 and Enhanced the Activity of Cyp7a1 Promoter in Hepa1-6 Cells
3. Discussion
4. Materials and Methods
4.1. Animal Experiments
4.2. Plasma Biochemical Analysis
4.3. Quantitative RT-PCR
4.4. Immunoblotting
4.5. Cell Culture and Treatment
4.6. Luciferase Assay for Cyp7a1 Promoter Activity
4.7. Measurement of Fecal Bile Acids
4.8. Isolation of Nuclear Fractions
4.9. Statistical Analyses
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kaste, M.; Koivisto, P. Risk of brain infarction in familial hypercholesterolemia. Stroke 1988, 19, 1097–1100. [Google Scholar] [CrossRef][Green Version]
- Austin, M.A.; Hutter, C.M.; Zimmern, R.L.; Humphries, S.E. Familial hypercholesterolemia and coronary heart disease: A HuGE association review. Am. J. Epidemiol. 2004, 160, 421–429. [Google Scholar] [CrossRef][Green Version]
- Kuai, R.; Li, D.; Chen, Y.E.; Moon, J.J.; Schwendeman, A. High-density lipoproteins: Nature’s multifunctional nanoparticles. ACS Nano 2016, 10, 3015–3041. [Google Scholar] [CrossRef][Green Version]
- Chico, Y.; Fresnedo, O.; Lacort, M.; Ochoa, B. Effect of estradiol and progesterone on cholesterol 7 α-hydroxylase activity in rats subjected to different feeding conditions. Steroids. 1994, 59, 528–535. [Google Scholar] [CrossRef]
- Chico, Y.; Fresnedo, O.; Botham, K.; Lacort, M.; Ochoa, B. Regulation of bile acid synthesis by estradiol and progesterone in primary cultures of rat hepatocytes. Exp. Clin. Endocrinol. Diabetes 1996, 104, 137–144. [Google Scholar] [CrossRef]
- Theiler-Schwetz, V.; Zaufel, A.; Schlager, H.; Obermayer-Pietsch, B.; Fickert, P.; Zollner, G. Bile acids and glucocorticoid metabolism in health and disease. Biochim. Biophys. Acta Mol. Basis Dis. 2019, 1865, 243–251. [Google Scholar] [CrossRef]
- Morimoto, K.; Itoh, H.; Watanabe, M. Developments in understanding bile acid metabolism. Expert. Rev. Endocrinol. Metab. 2013, 8, 59–69. [Google Scholar] [CrossRef] [PubMed]
- Bonde, Y.; Eggertsen, G.; Rudling, M. Mice abundant in muricholic bile acids show resistance to dietary induced steatosis, weight gain, and to impaired glucose metabolism. PLoS ONE 2016, 11, e0147772. [Google Scholar] [CrossRef]
- Bertaggia, E.; Jensen, K.K.; Castro-Perez, J.; Xu, Y.; Di Paolo, G.; Chan, R.B.; Wang, L.; Haeusler, R.A. Cyp8b1 ablation prevents Western diet-induced weight gain and hepatic steatosis because of impaired fat absorption. Am. J. Physiol. Endocrinol. Metab. 2017, 313, E121–E133. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Chen, W.; Nishimura, N.; Oda, H.; Yokogoshi, H. Effect of taurine on cholesterol degradation and bile acid pool in rats fed a high-cholesterol diet. Adv. Exp. Med. Biol. 2003, 526, 261–267. [Google Scholar] [CrossRef]
- Watanabe, M.; Houten, S.M.; Wang, L.; Moschetta, A.; Mangelsdorf, D.J.; Heyman, R.A.; Moore, D.D.; Auwerx, J. Bile acids lower triglyceride levels via a pathway involving FXR, SHP, and SREBP-1c. J. Clin. Investig. 2004, 113, 1408–1418. [Google Scholar] [CrossRef][Green Version]
- Watanabe, M.; Houten, S.M.; Mataki, C.; Christoffolete, M.A.; Kim, B.W.; Sato, H.; Messaddeq, N.; Harney, J.W.; Ezaki, O.; Kodama, T.; et al. Bile acids induce energy expenditure by promoting intracellular thyroid hormone activation. Nature 2006, 439, 484–489. [Google Scholar] [CrossRef]
- Matsuzaki, J.; Suzuki, H.; Tsugawa, H.; Watanabe, M.; Hossain, S.; Arai, E.; Saito, Y.; Sekine, S.; Akaike, T.; Kanai, Y.; et al. Bile acids increase levels of microRNAs 221 and 222, leading to degradation of CDX2 during esophageal carcinogenesis. Gastroenterology 2013, 145, 1300–1311. [Google Scholar] [CrossRef] [PubMed]
- Ichikawa, R.; Takayama, T.; Yoneno, K.; Kamada, N.; Kitazume, M.T.; Higuchi, H.; Matsuoka, K.; Watanabe, M.; Itoh, H.; Kanai, T.; et al. Bile acids induce monocyte differentiation toward interleukin-12 hypo-producing dendritic cells via a TGR5-dependent pathway. Immunology 2012, 136, 153–162. [Google Scholar] [CrossRef]
- Lan, T.; Morgan, D.A.; Rahmouni, K.; Sonoda, J.; Fu, X.; Burgess, S.C.; Holland, W.L.; Kliewer, S.A.; Mangelsdorf, D.J. FGF19, FGF21, and an FGFR1/β-klotho-activating antibody act on the nervous system to regulate body weight and glycemia. Cell Metab. 2017, 26, 709–718.e3. [Google Scholar] [CrossRef] [PubMed]
- Chiang, J.Y.L.; Ferrell, J.M. Up to date on cholesterol 7 alpha-hydroxylase (CYP7A1) in bile acid synthesis. Liver Res. 2020, 4, 47–63. [Google Scholar] [CrossRef] [PubMed]
- Chiang, J.Y. Bile acids: Regulation of synthesis. J. Lipid Res. 2009, 50, 1955–1966. [Google Scholar] [CrossRef][Green Version]
- Ahmad, T.R.; Haeusler, R.A. Bile acids in glucose metabolism and insulin signalling—Mechanisms and research needs. Nat. Rev. Endocrinol. 2019, 15, 701–712. [Google Scholar] [CrossRef] [PubMed]
- Al-Aqil, F.A.; Monte, M.J.; Peleteiro-Vigil, A.; Briz, O.; Rosales, R.; González, R.; Aranda, C.J.; Ocón, B.; Uriarte, I.; de Medina, F.S.; et al. Interaction of glucocorticoids with FXR/FGF19/FGF21-mediated ileum-liver crosstalk. Biochim. Biophys. Acta Mol. Basis. Dis. 2018, 1864, 2927–2937. [Google Scholar] [CrossRef]
- Kurosu, H.; Choi, M.; Ogawa, Y.; Dickson, A.S.; Goetz, R.; Eliseenkova, A.V.; Mohammadi, M.; Rosenblatt, K.P.; Kliewer, S.A.; Kuro-o, M. Tissue-specific expression of βKlotho and fibroblast growth factor (FGF) receptor isoforms determines metabolic activity of FGF19 and FGF21. J. Biol. Chem. 2007, 282, 26687–26695. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Wang, L.; Lee, Y.K.; Bundman, D.; Han, Y.; Thevananther, S.; Kim, C.S.; Chua, S.S.; Wei, P.; Heyman, R.A.; Karin, M.; et al. Redundant pathways for negative feedback regulation of bile acid production. Dev. Cell 2002, 2, 721–731. [Google Scholar] [CrossRef][Green Version]
- Gupta, S.; Stravitz, R.T.; Dent, P.; Hylemon, P.B. Down-regulation of cholesterol 7α-hydroxylase (CYP7A1) gene expression by bile acids in primary rat hepatocytes is mediated by the c-Jun N-terminal kinase pathway. J. Biol. Chem. 2001, 276, 15816–15822. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Pullinger, C.R.; Eng, C.; Salen, G.; Shefer, S.; Batta, A.K.; Erickson, S.K.; Verhagen, A.; Rivera, C.R.; Mulvihill, S.J.; Malloy, M.J.; et al. Human cholesterol 7α-hydroxylase (CYP7A1) deficiency has a hypercholesterolemic phenotype. J. Clin. Investig. 2002, 110, 109–117. [Google Scholar] [CrossRef]
- Chiang, J.Y.L.; Ferrell, J.M. Bile acid biology, pathophysiology, and therapeutics. Clin. Liver Dis. 2020, 15, 91–94. [Google Scholar] [CrossRef] [PubMed]
- De Fabiani, E.; Mitro, N.; Anzulovich, A.C.; Pinelli, A.; Galli, G.; Crestani, M. The negative effects of bile acids and tumor necrosis factor-α on the transcription of cholesterol 7α-hydroxylase gene (CYP7A1) converge to hepatic nuclear factor-4: A novel mechanism of feedback regulation of bile acid synthesis mediated by nuclear receptors. J. Biol. Chem. 2001, 276, 30708–30716. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Kharitonenkov, A.; Shiyanova, T.L.; Koester, A.; Ford, A.M.; Micanovic, R.; Galbreath, E.J.; Sandusky, G.E.; Hammond, L.J.; Moyers, J.S.; Owens, R.A.; et al. FGF-21 as a novel metabolic regulator. J. Clin. Investig. 2005, 115, 1627–1635. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Nishimura, T.; Nakatake, Y.; Konishi, M.; Itoh, N. Identification of a novel FGF, FGF-21, preferentially expressed in the liver. Biochim. Biophys. Acta 2000, 1492, 203–206. [Google Scholar] [CrossRef]
- Ding, X.; Boney-Montoya, J.; Owen, B.M.; Bookout, A.L.; Coate, K.C.; Mangelsdorf, D.J.; Kliewer, S.A. βKlotho is required for fibroblast growth factor 21 effects on growth and metabolism. Cell Metab. 2012, 16, 387–393. [Google Scholar] [CrossRef][Green Version]
- Ogawa, Y.; Kurosu, H.; Yamamoto, M.; Nandi, A.; Rosenblatt, K.P.; Goetz, R.; Eliseenkova, A.V.; Mohammadi, M.; Kuro-o, M. βKlotho is required for metabolic activity of fibroblast growth factor 21. Proc. Natl. Acad. Sci. USA 2007, 104, 7432–7437. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Coskun, T.; Bina, H.A.; Schneider, M.A.; Dunbar, J.D.; Hu, C.C.; Chen, Y.; Moller, D.E.; Kharitonenkov, A. Fibroblast growth factor 21 corrects obesity in mice. Endocrinology 2008, 149, 6018–6027. [Google Scholar] [CrossRef] [PubMed]
- Badman, M.K.; Pissios, P.; Kennedy, A.R.; Koukos, G.; Flier, J.S.; Maratos-Flier, E. Hepatic fibroblast growth factor 21 is regulated by PPARα and is a key mediator of hepatic lipid metabolism in ketotic states. Cell Metab. 2007, 5, 426–437. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Inagaki, T.; Dutchak, P.; Zhao, G.; Ding, X.; Gautron, L.; Parameswara, V.; Li, Y.; Goetz, R.; Mohammadi, M.; Esser, V.; et al. Endocrine regulation of the fasting response by PPARα-mediated induction of fibroblast growth factor 21. Cell Metab. 2007, 5, 415–425. [Google Scholar] [CrossRef][Green Version]
- Potthoff, M.J.; Inagaki, T.; Satapati, S.; Ding, X.; He, T.; Goetz, R.; Mohammadi, M.; Finck, B.N.; Mangelsdorf, D.J.; Kliewer, S.A.; et al. FGF21 induces PGC-1α and regulates carbohydrate and fatty acid metabolism during the adaptive starvation response. Proc. Natl. Acad. Sci. USA 2009, 106, 10853–10858. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Chen, M.M.; Hale, C.; Stanislaus, S.; Xu, J.; Véniant, M.M. FGF21 acts as a negative regulator of bile acid synthesis. J. Endocrinol. 2018, 237, 139–152. [Google Scholar] [CrossRef]
- Kim, K.H.; Lee, M.S. FGF21 as a stress hormone: The roles of FGF21 in stress adaptation and the treatment of metabolic diseases. Diabetes Metab. J. 2014, 38, 245–251. [Google Scholar] [CrossRef][Green Version]
- Zhang, X.; Yeung, D.C.; Karpisek, M.; Stejskal, D.; Zhou, Z.G.; Liu, F.; Wong, R.L.; Chow, W.S.; Tso, A.W.; Lam, K.S.; et al. Serum FGF21 levels are increased in obesity and are independently associated with the metabolic syndrome in humans. Diabetes 2008, 57, 1246–1253. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Dushay, J.; Chui, P.C.; Gopalakrishnan, G.S.; Varela-Rey, M.; Crawley, M.; Fisher, F.M.; Badman, M.K.; Martinez-Chantar, M.L.; Maratos-Flier, E. Increased fibroblast growth factor 21 in obesity and nonalcoholic fatty liver disease. Gastroenterology 2010, 139, 456–463. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Zhou, Y.; Holmseth, S.; Guo, C.; Hassel, B.; Höfner, G.; Huitfeldt, H.S.; Wanner, K.T.; Danbolt, N.C. Deletion of the γ-aminobutyric acid transporter 2 (GAT2 and SLC6A13) gene in mice leads to changes in liver and brain taurine contents. J. Biol. Chem. 2012, 287, 35733–35746. [Google Scholar] [CrossRef][Green Version]
- Yamaguchi, K.; Hosokawa, Y. Cysteine dioxygenase. Methods Enzymol. 1987, 143, 395–403. [Google Scholar] [CrossRef]
- Huxtable, R.J. Physiological actions of taurine. Physiol. Rev. 1992, 72, 101–163. [Google Scholar] [CrossRef][Green Version]
- Bai, J.; Yao, X.; Jiang, L.; Zhang, Q.; Guan, H.; Liu, S.; Wu, W.; Qiu, T.; Gao, N.; Yang, L.; et al. Taurine protects against As2O3-induced autophagy in livers of rat offsprings through PPARγ pathway. Sci. Rep. 2016, 6, 27733. [Google Scholar] [CrossRef][Green Version]
- Li, Y.; Hu, Z.; Chen, B.; Bu, Q.; Lu, W.; Deng, Y.; Zhu, R.; Shao, X.; Hou, J.; Zhao, J.; et al. Taurine attenuates methamphetamine-induced autophagy and apoptosis in PC12 cells through mTOR signaling pathway. Toxicol. Lett. 2012, 215, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Kaneko, H.; Kobayashi, M.; Mizunoe, Y.; Yoshida, M.; Yasukawa, H.; Hoshino, S.; Itagawa, R.; Furuichi, T.; Okita, N.; Sudo, Y.; et al. Taurine is an amino acid with the ability to activate autophagy in adipocytes. Amino Acids 2018, 50, 527–535. [Google Scholar] [CrossRef]
- Fengyan Piao, I.-U.-L.; Aadil, R.M.; Suleman, R.; Li, K.; Zhang, M.; Wu, P.; Shahbaz, M.; Ahmed, Z. Ameliorative effects of taurine against diabetes: A review. Amino Acids 2018, 50, 487–502. [Google Scholar] [CrossRef]
- Morsy, M.D.; Aboonq, M.S.; ALsleem, M.A.; Abusham, A.A. Taurine prevents high-fat diet-induced-hepatic steatosis in rats by direct inhibition of hepatic sterol regulatory element-binding proteins and activation of AMPK. Clin. Exp. Pharmacol. Physiol. 2020, 48, 72–85. [Google Scholar] [CrossRef] [PubMed]
- Dong, Y.; Li, X.; Liu, Y.; Gao, J.; Tao, J. The molecular targets of taurine confer anti-hyperlipidemic effects. Life Sci. 2021, 278, 119579. [Google Scholar] [CrossRef] [PubMed]
- Yokogoshi, H.; Mochizuki, H.; Nanami, K.; Hida, Y.; Miyachi, F.; Oda, H. Dietary taurine enhances cholesterol degradation and reduces serum and liver cholesterol concentrations in rats fed a high-cholesterol diet. J. Nutr. 1999, 129, 1705–1712. [Google Scholar] [CrossRef] [PubMed]
- Murakami, S.; Kondo, Y.; Toda, Y.; Kitajima, H.; Kameo, K.; Sakono, M.; Fukuda, N. Effect of taurine on cholesterol metabolism in hamsters: Up-regulation of low density lipoprotein (LDL) receptor by taurine. Life Sci. 2002, 70, 2355–2366. [Google Scholar] [CrossRef]
- Chen, W.; Guo, J.X.; Chang, P. The effect of taurine on cholesterol metabolism. Mol. Nutr. Food Res. 2012, 56, 681–690. [Google Scholar] [CrossRef]
- Danielsson, H. Present status of research on catabolism and excretion of cholesterol. Adv. Lipid Res. 1963, 1, 335–385. [Google Scholar] [CrossRef] [PubMed]
- Sjovall, J. Dietary glycine and taurine on bile acid conjugation in man; bile acids and steroids 75. Proc. Soc. Exp. Biol. Med. 1959, 100, 676–678. [Google Scholar] [CrossRef]
- Miyazaki, T.; Sasaki, S.I.; Toyoda, A.; Wei, F.Y.; Shirai, M.; Morishita, Y.; Ikegami, T.; Tomizawa, K.; Honda, A. Impaired bile acid metabolism with defectives of mitochondrial-tRNA taurine modification and bile acid taurine conjugation in the taurine depleted cats. Sci. Rep. 2020, 10, 4915. [Google Scholar] [CrossRef][Green Version]
- Abd Elwahab, A.H.; Ramadan, B.K.; Schaalan, M.F.; Tolba, A.M. A novel role of SIRT1/ FGF-21 in taurine protection against cafeteria diet-induced steatohepatitis in rats. Cell Physiol. Biochem. 2017, 43, 644–659. [Google Scholar] [CrossRef] [PubMed]
- Keinicke, H.; Sun, G.; Mentzel, C.M.J.; Fredholm, M.; John, L.M.; Andersen, B.; Raun, K.; Kjaergaard, M. FGF21 regulates hepatic metabolic pathways to improve steatosis and inflammation. Endocr. Connect. 2020, 9, 755–768. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Gupte, J.; Gong, Y.; Weiszmann, J.; Zhang, Y.; Lee, K.J.; Richards, W.G.; Li, Y. Chronic over-expression of fibroblast growth factor 21 increases bile acid biosynthesis by opposing FGF15/19 action. EBioMedicine 2017, 15, 173–183. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Adams, A.C.; Cheng, C.C.; Coskun, T.; Kharitonenkov, A. FGF21 requires βklotho to act in vivo. PLoS ONE 2012, 7, e49977. [Google Scholar] [CrossRef]
- Adams, A.C.; Yang, C.; Coskun, T.; Cheng, C.C.; Gimeno, R.E.; Luo, Y.; Kharitonenkov, A. The breadth of FGF21’s metabolic actions are governed by FGFR1 in adipose tissue. Mol. Metab. 2012, 2, 31–37. [Google Scholar] [CrossRef]
- Suzuki, M.; Uehara, Y.; Motomura-Matsuzaka, K.; Oki, J.; Koyama, Y.; Kimura, M.; Asada, M.; Komi-Kuramochi, A.; Oka, S.; Imamura, T. βKlotho is required for fibroblast growth factor (FGF) 21 signaling through FGF receptor (FGFR) 1c and FGFR3c. Mol. Endocrinol. 2008, 22, 1006–1014. [Google Scholar] [CrossRef][Green Version]
- Wu, S.; Levenson, A.; Kharitonenkov, A.; De Luca, F. Fibroblast growth factor 21 (FGF21) inhibits chondrocyte function and growth hormone action directly at the growth plate. J. Biol. Chem. 2012, 287, 26060–26067. [Google Scholar] [CrossRef][Green Version]
- Veto, B.; Bojcsuk, D.; Bacquet, C.; Kiss, J.; Sipeki, S.; Martin, L.; Buday, L.; Bálint, B.L.; Arányi, T. The transcriptional activity of hepatocyte nuclear factor 4 alpha is inhibited via phosphorylation by ERK1/2. PLoS ONE 2017, 12, e0172020. [Google Scholar] [CrossRef][Green Version]
- Chandra, V.; Holla, P.; Ghosh, D.; Chakrabarti, D.; Padigaru, M.; Jameel, S. The hepatitis E virus ORF3 protein regulates the expression of liver-specific genes by modulating localization of hepatocyte nuclear factor 4. PLoS ONE 2011, 6, e22412. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Guo, J.; Gao, Y.; Cao, X.; Zhang, J.; Chen, W. Cholesterol-lowing effect of taurine in HepG2 cell. Lipids Health Dis. 2017, 16, 56. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Jiang, G.; Nepomuceno, L.; Hopkins, K.; Sladek, F.M. Exclusive homodimerization of the orphan receptor hepatocyte nuclear factor 4 defines a new subclass of nuclear receptors. Mol. Cell. Biol. 1995, 15, 5131–5143. [Google Scholar] [CrossRef][Green Version]
- Guan, D.; Zhao, L.; Chen, D.; Yu, B.; Yu, J. Regulation of fibroblast growth factor 15/19 and 21 on metabolism: In the fed or fasted state. J. Transl. Med. 2016, 14, 63. [Google Scholar] [CrossRef][Green Version]
- Miyata, M.; Tanaka, T.; Takahashi, K.; Funaki, A.; Sugiura, Y. Cholesterol-lowering effects of taurine through the reduction of ileal FXR signaling due to the alteration of ileal bile acid composition. Amino Acids 2021, 53, 1523–1532. [Google Scholar] [CrossRef]
- Odermatt, A.; Klusonova, P. 11β-Hydroxysteroid dehydrogenase 1: Regeneration of active glucocorticoids is only part of the story. J. Steroid Biochem. Mol. Biol. 2015, 151, 85–92. [Google Scholar] [CrossRef] [PubMed]
- Schweizer, R.A.; Zürcher, M.; Balazs, Z.; Dick, B.; Odermatt, A. Rapid hepatic metabolism of 7-ketocholesterol by 11β-hydroxysteroid dehydrogenase type 1: Species-specific differences between the rat, human, and hamster enzyme. J. Biol. Chem. 2004, 279, 18415–18424. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Hult, M.; Elleby, B.; Shafqat, N.; Svensson, S.; Rane, A.; Jörnvall, H.; Abrahmsen, L.; Oppermann, U. Human and rodent type 1 11β-hydroxysteroid dehydrogenases are 7β-hydroxycholesterol dehydrogenases involved in oxysterol metabolism. Cell Mol. Life Sci. 2004, 61, 992–999. [Google Scholar] [CrossRef] [PubMed]
- Uozumi, Y.; Ito, T.; Takahashi, K.; Matsuda, T.; Mohri, T.; Kimura, Y.; Fujio, Y.; Azuma, J. Myogenic induction of taurine transporter prevents dexamethasone-induced muscle atrophy. Adv. Exp. Med. Biol. 2006, 583, 265–270. [Google Scholar] [CrossRef] [PubMed]
- Hirata, H.; Ueda, S.; Ichiseki, T.; Shimasaki, M.; Ueda, Y.; Kaneuji, A.; Kawahara, N. Taurine inhibits glucocorticoid-induced bone mitochondrial injury, preventing osteonecrosis in rabbits and cultured osteocytes. Int. J. Mol. Sci. 2020, 21, 6892. [Google Scholar] [CrossRef]
- Mizunoe, Y.; Kobayashi, M.; Sudo, Y.; Watanabe, S.; Yasukawa, H.; Natori, D.; Hoshino, A.; Negishi, A.; Okita, N.; Komatsu, M.; et al. Trehalose protects against oxidative stress by regulating the Keap1-Nrf2 and autophagy pathways. Redox Biol. 2018, 15, 115–124. [Google Scholar] [CrossRef]
Genes | Forward (5′ to 3′) | Reverse (5′ to 3′) |
---|---|---|
Cyp7a1 | AGCAACTAAACAACCTGCCAGTACTA | GTCCGGATATTCAAGGATGCA |
Fgf21 | GAAGCCCACCTGGAGATCAG | CAAAGTGAGGCGATCCATAGAG |
Fxr | CCAACCTGGGTTTCTACCC | CACACAGCTCATCCCCTTT |
Shp | CGATCCTCTTCAACCCAGATG | AGGGCTCCAAGACTTCACACA |
Lrh-1 | ACTGAGAAATTCGGACAGCTACTTC | AGGTAGTCTTCTGCCTGCTTGCT |
Fgfr4 | GACCAAACCAGCACCGTGGCTGTGAAGATG | GTTTCCCTTGGCGGCACATTCCACAATCAC |
Klb | CACTGTGGGACACAACCTGA | CCAAGCACAGAGGACATGGA |
Fgf15 | ACCGCTCCTTCTTTGAAAC | TACATCCTCCACCATCCTGAAC |
Tbp | CAGTACAGCAATCAACATCTCAGC | CAAGTTTACAGCCAAGATTCACG |
Rps18 | TGCGAGTACTCAACACCAACAT | CTTTCCTCAACACCACATGAGC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tagawa, R.; Kobayashi, M.; Sakurai, M.; Yoshida, M.; Kaneko, H.; Mizunoe, Y.; Nozaki, Y.; Okita, N.; Sudo, Y.; Higami, Y. Long-Term Dietary Taurine Lowers Plasma Levels of Cholesterol and Bile Acids. Int. J. Mol. Sci. 2022, 23, 1793. https://doi.org/10.3390/ijms23031793
Tagawa R, Kobayashi M, Sakurai M, Yoshida M, Kaneko H, Mizunoe Y, Nozaki Y, Okita N, Sudo Y, Higami Y. Long-Term Dietary Taurine Lowers Plasma Levels of Cholesterol and Bile Acids. International Journal of Molecular Sciences. 2022; 23(3):1793. https://doi.org/10.3390/ijms23031793
Chicago/Turabian StyleTagawa, Ryoma, Masaki Kobayashi, Misako Sakurai, Maho Yoshida, Hiroki Kaneko, Yuhei Mizunoe, Yuka Nozaki, Naoyuki Okita, Yuka Sudo, and Yoshikazu Higami. 2022. "Long-Term Dietary Taurine Lowers Plasma Levels of Cholesterol and Bile Acids" International Journal of Molecular Sciences 23, no. 3: 1793. https://doi.org/10.3390/ijms23031793