Alzheimer’s Disease-Associated SNP rs708727 in SLC41A1 May Increase Risk for Parkinson’s Disease: Report from Enlarged Slovak Study
Abstract
:1. Introduction
2. Results
2.1. Sequencing of SLC41A1 Promoter Region
2.2. Genetic Analyses
2.3. RandomForest Machine Learning (RF-ML)
3. Discussion
4. Materials and Methods
4.1. Study Participants (Basic Characteristics)
4.2. Sample Processing
4.3. Genotyping
4.4. Sanger Sequencing
4.5. RFLP (Restriction Fragment Length Polymorphism) Analysis
4.6. Data Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Tatarkova, Z.; de Baaij, J.H.F.; Grendar, M.; Aschenbach, J.R.; Racay, P.; Bos, C.; Sponder, G.; Hoenderop, J.G.J.; Röntgen, M.; Turcanova Koprusakova, M.; et al. Dietary Mg2+ Intake and the Na+/Mg2+ Exchanger SLC41A1 Influence Components of Mitochondrial Energetics in Murine Cardiomyocytes. Int. J. Mol. Sci. 2020, 21, 8221. [Google Scholar] [CrossRef] [PubMed]
- Yamanaka, R.; Tabata, S.; Shindo, Y.; Hotta, K.; Suzuki, K.; Soga, T.; Oka, K. Mitochondrial Mg2+ homeostasis decides cellular energy metabolism and vulnerability to stress. Sci. Rep. 2016, 6, 30027. [Google Scholar] [CrossRef] [PubMed]
- Dudev, T.; Grauffel, C.; Lim, C. How Native and Alien Metal Cations Bind ATP: Implications for Lithium as a Therapeutic Agent. Sci. Rep. 2017, 7, 42377. [Google Scholar] [CrossRef] [PubMed]
- Kolisek, M.; Zsurka, G.; Samaj, J.; Weghuber, J.; Schweyen, R.J.; Schweigel, M. Mrs2p is an essential component of the major electrophoretic Mg2+ influx system in mitochondria. EMBO J. 2003, 22, 1235–1244. [Google Scholar] [CrossRef] [PubMed]
- Schindl, R.; Weghuber, J.; Romanin, C.; Schweyen, R.J. Mrs2p forms a high conductance Mg2+ selective channel in mitochondria. Biophys. J. 2007, 93, 3872–3883. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kolisek, M.; Sponder, G.; Pilchova, I.; Cibulka, M.; Tatarkova, Z.; Werner, T.; Racay, P. Magnesium Extravaganza: A Critical Compendium of Current Research into Cellular Mg2+ Transporters Other than TRPM6/7. Rev. Physiol. Biochem. Pharmacol. 2019, 176, 65–105. [Google Scholar] [CrossRef]
- Kubota, T.; Shindo, Y.; Tokuno, K.; Komatsu, H.; Ogawa, H.; Kudo, S.; Kitamura, Y.; Suzuki, K.; Oka, K. Mitochondria are intracellular magnesium stores: Investigation by simultaneous fluorescent imagings in PC12 cells. Biochim. Biophys. Acta 2005, 1744, 19–28. [Google Scholar] [CrossRef] [Green Version]
- Sponder, G.; Abdulhanan, N.; Fröhlich, N.; Mastrototaro, L.; Aschenbach, J.R.; Röntgen, M.; Pilchova, I.; Cibulka, M.; Racay, P.; Kolisek, M. Overexpression of Na+/Mg2+ exchanger SLC41A1 attenuates pro-survival signaling. Oncotarget 2017, 9, 5084–5104. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yamaguchi, H.; Wang, H.G. The protein kinase PKB/Akt regulates cell survival and apoptosis by inhibiting Bax conformational change. Oncogene 2001, 20, 7779–7786. [Google Scholar] [CrossRef] [Green Version]
- Vauzour, D.; Vafeiadou, K.; Rice-Evans, C.; Williams, R.J.; Spencer, J.P. Activation of pro-survival Akt and ERK1/2 signalling pathways underlie the anti-apoptotic effects of flavanones in cortical neurons. J. Neurochem. 2007, 103, 1355–1367. [Google Scholar] [CrossRef]
- Muddapu, V.R.; Dharshini, S.A.P.; Chakravarthy, V.S.; Gromiha, M.M. Neurodegenerative Diseases—Is Metabolic Deficiency the Root Cause? Front. Neurosci. 2020, 14, 213. [Google Scholar] [CrossRef] [PubMed]
- Pathak, D.; Berthet, A.; Nakamura, K. Energy failure: Does it contribute to neurodegeneration? Ann. Neurol. 2013, 74, 506–516. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dharshini, S.A.P.; Taguchi, Y.H.; Gromiha, M.M. Investigating the energy crisis in Alzheimer disease using transcriptome study. Sci. Rep. 2019, 9, 18509. [Google Scholar] [CrossRef] [PubMed]
- Twig, G.; Shirihai, O.S. The interplay between mitochondrial dynamics and mitophagy. Antioxid. Redox Signal. 2011, 14, 1939–1951. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhao, W.; Zhang, W.; Ma, H.; Yang, M. NIPA2 regulates osteoblast function by modulating mitophagy in type 2 diabetes osteoporosis. Sci. Rep. 2020, 10, 3078. [Google Scholar] [CrossRef] [Green Version]
- Nadler, M.J.; Hermosura, M.C.; Inabe, K.; Perraud, A.L.; Zhu, Q.; Stokes, A.J.; Kurosaki, T.; Kinet, J.P.; Penner, R.; Scharenberg, A.M.; et al. LTRPC7 is a Mg.ATP-regulated divalent cation channel required for cell viability. Nature 2001, 411, 590–595. [Google Scholar] [CrossRef]
- Kolisek, M.; Nestler, A.; Vormann, J.; Schweigel-Röntgen, M. Human gene SLC41A1 encodes for the Na+/Mg2+ exchanger. Am. J. Physiol. Cell Physiol. 2012, 302, C318–C326. [Google Scholar] [CrossRef] [Green Version]
- Sturgeon, M.; Wu, P.; Cornell, R. SLC41A1 and TRPM7 in magnesium homeostasis and genetic risk for Parkinson’s disease. J. Neurol. Neuromed. 2016, 1, 23–28. [Google Scholar] [CrossRef]
- Tucci, A.; Nalls, M.A.; Houlden, H.; Revesz, T.; Singleton, A.B.; Wood, N.W.; Hardy, J.; Paisán-Ruiz, C. Genetic variability at the PARK16 locus. Eur. J. Hum. Genet. 2010, 18, 1356–1359. [Google Scholar] [CrossRef]
- Kolisek, M.; Sponder, G.; Mastrototaro, L.; Smorodchenko, A.; Launay, P.; Vormann, J.; Schweigel-Röntgen, M. Substitution p.A350V in Na⁺/Mg²⁺ exchanger SLC41A1, potentially associated with Parkinson’s disease, is a gain-of-function mutation. PLoS ONE 2013, 8, e71096. [Google Scholar] [CrossRef] [Green Version]
- Lin, C.H.; Wu, Y.R.; Chen, W.L.; Wang, H.C.; Lee, C.M.; Lee-Chen, G.J.; Chen, C.M. Variant R244H in Na+/Mg2+ exchanger SLC41A1 in Taiwanese Parkinson’s disease is associated with loss of Mg2+ efflux function. Parkinsonism Relat. Disord. 2014, 20, 600–603. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Ou, R.; Chen, Y.; Gu, X.; Wei, Q.; Cao, B.; Zhang, L.; Hou, Y.; Liu, K.; Chen, X.; et al. Mutation analysis of seven SLC family transporters for early-onset Parkinson’s disease in Chinese population. Neurobiol. Aging 2021, 103, 152-e1. [Google Scholar] [CrossRef] [PubMed]
- Lin, L.; Ke, Z.; Lv, M.; Lin, R.; Wu, B.; Zheng, Z. Effects of MgSO4 and magnesium transporters on 6-hydroxydopamine-induced SH-SY5Y cells. Life Sci. 2017, 172, 48–54. [Google Scholar] [CrossRef] [PubMed]
- Pihlstrøm, L.; Rengmark, A.; Bjørnarå, K.A.; Dizdar, N.; Fardell, C.; Forsgren, L.; Holmberg, B.; Larsen, J.P.; Linder, J.; Nissbrandt, H.; et al. Fine mapping and resequencing of the PARK16 locus in Parkinson’s disease. J. Hum. Genet. 2015, 60, 357–362. [Google Scholar] [CrossRef]
- Wang, L.; Cheng, L.; Li, N.N.; Yu, W.J.; Sun, X.Y.; Peng, R. Genetic analysis of SLC41A1 in Chinese Parkinson’s disease patients. Am. J. Med. Genet. B Neuropsychiatr. Genet. 2015, 168, 706–711. [Google Scholar] [CrossRef]
- Madadi, F.; Khaniani, M.S.; Shandiz, E.E.; Ayromlou, H.; Najmi, S.; Emamalizadeh, B.; Taghavi, S.; Jamshidi, J.; Tafakhori, A.; Shahidi, G.A.; et al. Genetic Analysis of the ZNF512B, SLC41A1, and ALDH2 Polymorphisms in Parkinson’s Disease in the Iranian Population. Genet. Test. Mol. Biomark. 2016, 20, 629–632. [Google Scholar] [CrossRef]
- Sanchez-Mut, J.V.; Heyn, H.; Silva, B.A.; Dixsaut, L.; Garcia-Esparcia, P.; Vidal, E.; Sayols, S.; Glauser, L.; Monteagudo-Sánchez, A.; Perez-Tur, J.; et al. PM20D1 is a quantitative trait locus associated with Alzheimer’s disease. Nat. Med. 2018, 24, 598–603. [Google Scholar] [CrossRef]
- Chang, X.L.; Mao, X.Y.; Li, H.H.; Zhang, J.H.; Li, N.N.; Burgunder, J.M.; Peng, R.; Tan, E.K. Association of GWAS loci with PD in China. Am. J. Med. Genet. B Neuropsychiatr. Genet. 2011, 156, 334–339. [Google Scholar] [CrossRef]
- Miyake, Y.; Tanaka, K.; Fukushima, W.; Kiyohara, C.; Sasaki, S.; Tsuboi, Y.; Oeda, T.; Shimada, H.; Kawamura, N.; Sakae, N.; et al. PARK16 polymorphisms, interaction with smoking, and sporadic Parkinson’s disease in Japan. J. Neurol. Sci. 2016, 362, 47–52. [Google Scholar] [CrossRef]
- Chung, S.J.; Jung, Y.; Hong, M.; Kim, M.J.; You, S.; Kim, Y.J.; Kim, J.; Song, K. Alzheimer’s disease and Parkinson’s disease genome-wide association study top hits and risk of Parkinson’s disease in Korean population. Neurobiol. Aging 2013, 34, 2695-e1. [Google Scholar] [CrossRef]
- Yan, Y.P.; Mo, X.Y.; Tian, J.; Zhao, G.H.; Yin, X.Z.; Jin, F.Y.; Zhang, B.R. An association between the PARK16 locus and Parkinson’s disease in a cohort from eastern China. Parkinsonism Relat. Disord. 2011, 17, 737–739. [Google Scholar] [CrossRef] [PubMed]
- Mata, I.F.; Yearout, D.; Alvarez, V.; Coto, E.; de Mena, L.; Ribacoba, R.; Lorenzo-Betancor, O.; Samaranch, L.; Pastor, P.; Cervantes, S.; et al. Replication of MAPT and SNCA, but not PARK16-18, as susceptibility genes for Parkinson’s disease. Mov. Disord. 2011, 26, 819–823. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gopalai, A.A.; Ahmad-Annuar, A.; Li, H.H.; Zhao, Y.; Lim, S.Y.; Tan, A.H.; Lim, T.T.; Eow, G.B.; Santhi, P.; Shanthi, V.; et al. PARK16 is associated with PD in the Malaysian population. Am. J. Med. Genet. B Neuropsychiatr. Genet. 2016, 171, 839–847. [Google Scholar] [CrossRef] [PubMed]
- Bai, Y.; Dong, L.; Huang, X.; Zheng, S.; Qiu, P.; Lan, F. Associations of rs823128, rs1572931, and rs823156 polymorphisms with reduced Parkinson’s disease risks. Neuroreport 2017, 28, 936–941. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kolisek, M.; Launay, P.; Beck, A.; Sponder, G.; Serafini, N.; Brenkus, M.; Froschauer, E.M.; Martens, H.; Fleig, A.; Schweigel, M. SLC41A1 is a novel mammalian Mg2+ carrier. J. Biol. Chem. 2008, 283, 16235–16247. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mastrototaro, L.; Tietjen, U.; Sponder, G.; Vormann, J.; Aschenbach, J.R.; Kolisek, M. Insulin Modulates the Na+/Mg2+ Exchanger SLC41A1 and Influences Mg2+ Efflux from Intracellular Stores in Transgenic HEK293 Cells. J. Nutr. 2015, 145, 2440–2447. [Google Scholar] [CrossRef] [Green Version]
- Cibulka, M.; Brodnanova, M.; Grendar, M.; Grofik, M.; Kurca, E.; Pilchova, I.; Osina, O.; Tatarkova, Z.; Dobrota, D.; Kolisek, M. SNPs rs11240569, rs708727, and rs823156 in SLC41A1 Do Not Discriminate Between Slovak Patients with Idiopathic Parkinson’s Disease and Healthy Controls: Statistics and Machine-Learning Evidence. Int. J. Mol. Sci. 2019, 20, 4688. [Google Scholar] [CrossRef] [Green Version]
- Sandelin, A.; Wasserman, W.W.; Lenhard, B. ConSite: Web-based prediction of regulatory elements using cross-species comparison. Nucleic Acids Res. 2004, 32, W249–W252. [Google Scholar] [CrossRef] [Green Version]
- Cohen, J. Statistical Power Analysis for the Behavioral Sciences, 2nd ed.; Lawrence Erlbaum Associates: Mahwah, NJ, USA, 1988. [Google Scholar]
- Deo, R.C. Machine Learning in Medicine. Circulation 2015, 132, 1920–1930. [Google Scholar] [CrossRef] [Green Version]
- Miko, I. Genetic dominance: Genotype-phenotype relationships. Nat. Educ. 2008, 1, 140. [Google Scholar]
- Wang, Q.; Chen, Y.; Readhead, B.; Chen, K.; Su, Y.; Reiman, E.M.; Dudley, J.T. Longitudinal data in peripheral blood confirm that PM20D1 is a quantitative trait locus (QTL) for Alzheimer’s disease and implicate its dynamic role in disease progression. Clin. Epigenet. 2020, 12, 189. [Google Scholar] [CrossRef] [PubMed]
- Popovic, M.; Fiano, V.; Fasanelli, F.; Trevisan, M.; Grasso, C.; Assumma, M.B.; Gillio-Tos, A.; Polidoro, S.; De Marco, L.; Rusconi, F.; et al. Differentially methylated DNA regions in early childhood wheezing: An epigenome-wide study using saliva. Pediatr. Allergy Immunol. 2019, 30, 305–314. [Google Scholar] [CrossRef] [PubMed]
- Larrick, J.W.; Larrick, J.W.; Mendelsohn, A.R. Uncoupling mitochondrial respiration for diabesity. Rejuvenation Res. 2016, 19, 337–340. [Google Scholar] [CrossRef] [PubMed]
- Long, J.Z.; Svensson, K.J.; Bateman, L.A.; Lin, H.; Kamenecka, T.; Lokurkar, I.A.; Lou, J.; Rao, R.R.; Chang, M.R.; Jedrychowski, M.P.; et al. The secreted enzyme PM20D1 regulates lipidated amino acid uncouplers of mitochondria. Cell 2016, 166, 424–435. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maltby, V.E.; Lea, R.A.; Sanders, K.A.; White, N.; Benton, M.C.; Scott, R.J.; Lechner-Scott, J. Differential methylation at MHC in CD4+ T cells is associated with multiple sclerosis independently of HLA-DRB1. Clin. Epigenet. 2017, 9, 71. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Simón-Sánchez, J.; Schulte, C.; Bras, J.M.; Sharma, M.; Gibbs, J.R.; Berg, D.; Paisan-Ruiz, C.; Lichtner, P.; Scholz, S.W.; Hernandez, D.G.; et al. Genome-wide association study reveals genetic risk underlying Parkinson’s disease. Nat. Genet. 2009, 41, 1308–1312. [Google Scholar] [CrossRef]
- Connor, M.; Vaughan, C.W.; Vandenberg, R.J. N-acyl amino acids and N-acyl neurotransmitter conjugates: Neuromodulators and probes for new drug targets. Brit. J. Pharmacol. 2010, 160, 1857–1871. [Google Scholar] [CrossRef]
- Song, N.; Fang, Y.; Zhu, H.; Liu, J.; Jiang, S.; Sun, S.; Xu, R.; Ding, J.; Hu, G.; Lu, M. Kir6.2 is essential to maintain neurite features by modulating PM20D1-reduced mitochondrial ATP generation. Redox Biol. 2021, 47, 102168. [Google Scholar] [CrossRef]
- Tseng, C.F.; Iwakami, S.; Mikajiri, A.; Shibuya, M.; Hanaoka, F.; Ebizuka, Y.; Padmawinata, K.; Sankawa, U. Inhibition of in vitro prostaglandin and leukotriene biosyntheses by cinnamoyl-beta-phenethylamine and N-acyldopamine derivatives. Chem. Pharm. Bull. 1992, 40, 396–400. [Google Scholar] [CrossRef] [Green Version]
- Kang, K.H.; Liou, H.H.; Hour, M.J.; Liou, H.C.; Fu, W.M. Protection of dopaminergic neurons by 5-lipoxygenase inhibitor. Neuropharmacology 2013, 73, 380–387. [Google Scholar] [CrossRef]
- Shekhar, S.; Yadav, S.K.; Rai, N.; Kumar, R.; Yadav, Y.; Tripathi, M.; Dey, A.B.; Dey, S. 5-LOX in Alzheimer’s Disease: Potential Serum Marker and In Vitro Evidences for Rescue of Neurotoxicity by Its Inhibitor YWCS. Mol. Neurobiol. 2018, 55, 2754–2762. [Google Scholar] [CrossRef] [PubMed]
- Compta, Y.; Parkkinen, L.; O’Sullivan, S.S.; Vandrovcova, J.; Holton, J.L.; Collins, C.; Lashley, T.; Kallis, C.; Williams, D.R.; de Silva, R.; et al. Lewy- and Alzheimer-type pathologies in Parkinson’s disease dementia: Which is more important? Brain J. Neurol. 2011, 134, 1493–1505. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Meireles, J.; Massano, J. Cognitive impairment and dementia in Parkinson’s disease: Clinical features, diagnosis, and management. Front. Neurol. 2012, 3, 88. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lin, M.; Lucas, H.C., Jr.; Shmueli, G. Research commentary—Too big to fail: Large samples and the p-value problem. Inf. Syst. Res. 2013, 24, 906–917. [Google Scholar] [CrossRef] [Green Version]
- Sun, Y.; Sukumaran, P.; Singh, B.B. Magnesium-Induced Cell Survival Is Dependent on TRPM7 Expression and Function. Mol. Neurobiol. 2020, 57, 528–538. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jakobsdottir, J.; Gorin, M.B.; Conley, Y.P.; Ferrell, R.E.; Weeks, D.E. Interpretation of genetic association studies: Markers with replicated highly significant odds ratios may be poor classifiers. PLoS Genet. 2009, 5, e1000337. [Google Scholar] [CrossRef] [Green Version]



| Gene | SNP | Sequence | Allele | Prot. Level | Reference |
|---|---|---|---|---|---|
| A1 | I | C | G > A | p.Thr113Thr | www.ncbi.nlm.nih.gov/snp/?term=rs11240569 (accessed on 2 August 2021) |
| II | C | G > A | p.Asn252Asn | www.ncbi.nlm.nih.gov/snp/?term=rs708727 (accessed on 2 August 2021) | |
| III | NC/intron | A > G | www.ncbi.nlm.nih.gov/snp/?term=rs823156 (accessed on 2 August 2021) | ||
| IV | NC/P | A > G | www.ncbi.nlm.nih.gov/snp/?term=rs9438393 (accessed on 2 August 2021) | ||
| V | NC/P | T > C | www.ncbi.nlm.nih.gov/snp/?term=rs56152218 (accessed on 2 August 2021) | ||
| VI | NC/P | G > T | www.ncbi.nlm.nih.gov/snp/?term=rs61822602 (accessed on 2 August 2021) |
| SNP | Analyzed CS Sequence | TF Change |
|---|---|---|
| IV | GGCTCCACAGGGACGT/CTTACCGGTCTTCCCG | +SP1 −FREAC-4 |
| V | GCGCTCCAGGCGCATA/GGAGCCGGCTCCCGGTT | +YY1 −Gata2 |
| VI | ATCCCGCCCCCTCCCC/AAGTCCCTGATTGGCT | No change |
| rs144056491 | ATGGAGGGGGGGGGGTGCCACCCAGTCTGC (G > -,GG,GGG) | No change (p50) |
| SNP | Cohort | Allele | Count | fq (%) | Genotype | Count | fq (%) |
|---|---|---|---|---|---|---|---|
| (I) | PD | G | 692 (210) | 68.1 (70) | GG | 237(73) | 46.7(48) |
| A | 324 (90) | 31.9 (30) | AG | 218(64) | 42.9(43) | ||
| AA | 53(13) | 10.4(9) | |||||
| C | G | 628 (166) | 66.5 (69) | GG | 214(57) | 45.3(48) | |
| A | 316 (74) | 33.5 (31) | AG | 200(52) | 42.4(43) | ||
| AA | 58(11) | 12.3(9) | |||||
| (II) | PD | G | 596 (179) | 58.7 (60) | GG | 171 (54) | 33.7 (36) |
| A | 420 (121) | 41.3 (40) | AG | 254 (71) | 50.0 (47) | ||
| AA | 83 (25) | 16.3 (17) | |||||
| C | G | 588 (136) | 62.3 (57) | GG | 193 (40) | 40.9 (33) | |
| A | 356 (104) | 37.7 (43) | AG | 202 (56) | 42.8 (47) | ||
| AA | 77 (24) | 16.3 (20) | |||||
| (III) | PD | A | 836 (243) | 82.3 (81) | AA | 345 (100) | 67.9 (67) |
| G | 180 (57) | 17.7 (19) | AG | 146 (43) | 28.7 (29) | ||
| GG | 17 (7) | 3.4 (5) | |||||
| C | A | 791 (204) | 83.8 (85) | AA | 330 (87) | 69.9 (73) | |
| G | 153 (36) | 16.2 (15) | AG | 131 (30) | 27.8 (25) | ||
| GG | 11 (3) | 2.3 (2) | |||||
| (IV) | PD | A | 120 | 62.5 | AA | 39 | 40.6 |
| G | 72 | 37.5 | AG | 42 | 43.8 | ||
| GG | 15 | 15.6 | |||||
| C | A | 116 | 58.0 | AA | 33 | 33 | |
| G | 84 | 42.0 | AG | 50 | 50 | ||
| GG | 17 | 17 | |||||
| (V) | PD | T | 113 | 58.85 | TT | 35 | 36.5 |
| C | 79 | 41.15 | TC | 43 | 44.8 | ||
| CC | 18 | 18.7 | |||||
| C | T | 131 | 65.5 | TT | 41 | 41 | |
| C | 69 | 34.5 | TC | 49 | 49 | ||
| CC | 10 | 10 | |||||
| (VI) | PD | G | 170 | 88.54 | GG | 76 | 79.2 |
| T | 22 | 11.46 | GT | 18 | 18.7 | ||
| TT | 2 | 2.1 | |||||
| C | G | 174 | 87 | GG | 76 | 76 | |
| T | 26 | 13 | GT | 22 | 22 | ||
| TT | 2 | 2 |
| SNP | rs11240569 (G > A) Cohort | rs708727 (G > A) Cohort | rs823156 (A > G) Cohort | |||
|---|---|---|---|---|---|---|
| PD N (O/E) | C N (O/E) | PD N (O/E) | C N (O/E) | PD N (O/E) | C N (O/E) | |
| GG (com.) | 237/235.66 | 214/20.89 | ||||
| AG | 218/220.68 | 200/210.22 | ||||
| AA (rar.) | 53/51.66 | 58/52.89 | ||||
| X2 | 0.07 | 1.12 | ||||
| p-val | 0.78 | 0.29 | ||||
| GG (com.) | 171/174.81 | 193/183.13 | ||||
| AG | 254/246.38 | 202/221.74 | ||||
| AA (rar.) | 83/86.81 | 77/67.13 | ||||
| X2 | 0.49 | 3.74 | ||||
| p-val | 0.49 | >0.05 | ||||
| AA (com.) | 345/343.94 | 330/331.40 | ||||
| AG | 146/148.12 | 131/128.20 | ||||
| GG (rar.) | 17/15.94 | 11/12.40 | ||||
| X2 | 0.10 | 0.22 | ||||
| p-val | 0.75 | 0.64 | ||||
| SNP | rs9438393 (G > A) Cohort | rs56152218 (T > C) Cohort | rs61822602 (G > T) Cohort | |||
| PD N (O/E) | C N (O/E) | PD N (O/E) | C N (O/E) | PD N (O/E) | C N (O/E) | |
| AA (com.) | 39/37.5 | 33/33.64 | ||||
| AG | 42/45 | 50/48.72 | ||||
| GG (rar.) | 15/13.5 | 17/17.64 | ||||
| X2 | 0.43 | 0.07 | ||||
| p-val | 0.51 | 0.79 | ||||
| TT (com.) | 35/33.25 | 41/42.90 | ||||
| TC | 43/46.50 | 49/45.20 | ||||
| CC (rar.) | 18/16.25 | 10/11.90 | ||||
| X2 | 0.54 | 0.71 | ||||
| p-val | 0.46 | 0.40 | ||||
| GG (com.) | 76/75.26 | 76/75.69 | ||||
| GT | 18/19.48 | 22/22.62 | ||||
| TT (rar.) | 2/1.26 | 2/1.69 | ||||
| X2 | 0.55 | 0.08 | ||||
| p-val | 0.46 | 0.78 | ||||
| 95% CI | 95% CI | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| SNP | MA | OR | ll | uL | p-Val | Genotype | OR | ll | uL | p-Val |
| I | A | 0.93 | 0.77 | 1.12 | 0.47 | AA | 0.83 | 0.54 | 1.25 | 0.40 |
| (G > A) | GA | 0.98 | 0.75 | 1.28 | 0.95 | |||||
| II | A | 1.16 | 0.97 | 1.40 | 0.11 | AA | 1.22 | 0.84 | 1.77 | 0.34 |
| (G > A) | GA | 1.42 | 1.08 | 1.87 | 0.01 | |||||
| III | G | 1.33 | 0.82 | 2.17 | 0.25 | GG | 1.48 | 0.68 | 3.20 | 0.34 |
| (A > G) | AG | 1.07 | 0.81 | 1.41 | 0.67 | |||||
| IV | G | 0.83 | 0.55 | 1.24 | 0.41 | GG | 0.75 | 0.32 | 1.72 | 0.53 |
| (A > G) | AG | 0.71 | 0.38 | 1.32 | 0.35 | |||||
| V | C | 1.33 | 0.88 | 2.00 | 0.18 | CC | 2.11 | 0.86 | 5.16 | 0.13 |
| (T > C) | TC | 1.03 | 0.56 | 1.89 | 1.00 | |||||
| VI | T | 0.87 | 0.47 | 1.59 | 0.65 | TT | 1.00 | 0.14 | 7.28 | 1.00 |
| (G > T) | GT | 0.82 | 0.41 | 1.65 | 0.60 | |||||
| 95% CI | ||||||
|---|---|---|---|---|---|---|
| SNP | Genetic Model | OR | ll | uL | p-Val | z |
| I | GG vs. GA + AA (D) | 0.95 | 0.74 | 1.22 | 0.68 | 0.41 |
| GG + GA vs. AA (R) | 0.83 | 0.56 | 1.24 | 0.36 | 0.92 | |
| GG + AA vs. GG (COD) | 1.02 | 0.79 | 1.32 | 0.86 | 0.75 | |
| II | GG vs. GA + AA (D) | 1.36 | 1.05 | 1.77 | 0.02 | 2.34 |
| GG + GA vs. AA (R) | 1.00 | 0.71 | 1.41 | 0.99 | 0.01 | |
| GG + AA vs. GA (COD) | 1.34 | 1.04 | 1.72 | 0.02 | 2.26 | |
| III | AA vs. AG + GG (D) | 1.10 | 0.84 | 1.44 | 0.50 | 0.68 |
| AA + AG vs. GG (R) | 1.45 | 0.67 | 3.13 | 0.34 | 0.95 | |
| AA + GG vs. AG (COD) | 1.05 | 0.80 | 1.39 | 0.73 | 0.34 | |
| IV | AA vs. AG + GG (D) | 0.73 | 0.68 | 2.15 | 0.26 | 1.12 |
| AA + AG vs. GG (R) | 0.90 | 0.42 | 1.93 | 0.80 | 0.26 | |
| AA + GG vs. AG (COD) | 0.78 | 0.44 | 1.37 | 0.38 | 0.88 | |
| V | TT vs. TC + CC (D) | 1.21 | 0.68 | 1.15 | 0.51 | 0.65 |
| TT + TC vs. CC (R) | 2.08 | 0.91 | 4.77 | 0.08 | 1.73 | |
| TT + CC vs. TC (COD) | 0.84 | 0.48 | 1.48 | 0.56 | 0.59 | |
| VI | GG vs. GT + TT (D) | 0.83 | 0.43 | 1.63 | 0.60 | 0.53 |
| GG + GT vs. TT (R) | 1.04 | 0.14 | 7.55 | 0.97 | 0.04 | |
| GG + TT vs. GT (COD) | 0.82 | 0.41 | 1.64 | 0.57 | 0.56 | |
| SNP | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| I | II | III | IV | V | IV | PD/C | X2 | df | p-Val | h | Nsss | sl | pw |
| (N/N) | |||||||||||||
| AG | AG | 15/6 | 3.79 | 1 | 0.05 * | 0.318 | 78 | 0.06 | 0.8 | ||||
| AG | GG | 8/1 | 4.45 | 1 | 0.04 | 0.385 | 53 | 0.05 | 0.8 | ||||
| AG | GG | AG | 14/5 | 4.10 | 1 | 0.04 | 0.333 | 71 | 0.05 | 0.8 | |||
| AG | GG | CC | 15/6 | 3.79 | 1 | 0.05 * | 0.318 | 78 | 0.06 | 0.8 | |||
| AG | TT | GG | 8/1 | 4.45 | 1 | 0.04 | 0.385 | 53 | 0.05 | 0.8 | |||
| AG | GG | CC | 8/1 | 4.45 | 1 | 0.04 | 0.385 | 53 | 0.05 | 0.8 | |||
| GG | AG | CC | 12/1 | 8.69 | 1 | 0.003 | 0.522 | 29 | 0.05 | 0.8 | |||
| GG | GG | CC | 18/8 | 4.03 | 1 | 0.05 | 0.322 | 76 | 0.05 | 0.8 | |||
| AG | TT | CC | 10/1 | 6.52 | 1 | 0.01 | 0.457 | 38 | 0.05 | 0.8 | |||
| AG | TT | GG | CC | 8/1 | 4.45 | 1 | 0.04 | 0.385 | 53 | 0.05 | 0.8 | ||
| GG | AG | TT | CC | 10/1 | 6.52 | 1 | 0.01 | 0.457 | 38 | 0.05 | 0.8 | ||
| GG | TT | GG | CC | 18/8 | 4.03 | 1 | 0.05 | 0.322 | 76 | 0.05 | 0.8 | ||
| SNPs I–III (N = 980) | SNPs I–VI (N = 196) | ||||
|---|---|---|---|---|---|
| Predictor | AUC (%) | Predictor | AUC (%) | Predictor | AUC (%) |
| I | 24.7 | I | 32.1 | II–III–V | 38.8 |
| II | 35.8 | II | 34.9 | II–III–VI | 42.1 |
| III | 25.6 | III | 23.8 | II–IV–V | 44.3 |
| I–II | 45.9 | IV | 27.2 | II–IV–VI | 33.4 |
| I–III | 28.6 | V | 17.5 | II–V–VI | 44.5 |
| II–III | 44.7 | VI | 17.4 | III–IV–V | 44.7 |
| I–II–III | 49.9 | I–II | 47.9 | III–IV–VI | 47.8 |
| I–III | 38.1 | III–V–VI | 45.0 | ||
| I–IV | 42.2 | IV–V–VI | 43.9 | ||
| I–V | 19.5 | I–II–III–IV | 42.0 | ||
| I–VI | 35.1 | I–II–III–V | 43.0 | ||
| II–III | 28.8 | I–II–III–VI | 45.8 | ||
| II–IV | 27.7 | I–II–IV–V | 44.2 | ||
| II–V | 46.8 | I–II–IV–VI | 43.9 | ||
| II–VI | 31.6 | I–II–V–VI | 44.3 | ||
| III–IV | 32.7 | I–III–IV–V | 43.3 | ||
| III–V | 16.1 | I–II–IV–VI | 44.9 | ||
| III–VI | 20.1 | I–III–V–VI | 44.8 | ||
| IV–V | 42.2 | I–IV–V–VI | 40.8 | ||
| IV–VI | 27.7 | II–III–IV–V | 41.2 | ||
| V–VI | 44.7 | II–III–IV–VI | 42.2 | ||
| I–II–III | 43.6 | II–III–V–VI | 44.6 | ||
| I–II–IV | 42.8 | II–IV–V–VI | 44.3 | ||
| I–II–V | 43.5 | III–IV–V–VI | 46.8 | ||
| I–II–VI | 46.8 | I–II–III–IV–V | 40.9 | ||
| I–III–IV | 42.4 | I–II–III–IV–VI | 44.2 | ||
| I–III–V | 43.6 | I–II–III–V–VI | 44.7 | ||
| I–III–VI | 47.4 | I–II–IV–V–VI | 43.7 | ||
| I–IV–V | 40.7 | I–III–IV–V–VI | 46.0 | ||
| I–IV–VI | 39.2 | II–III–IV–V–VI | 42.5 | ||
| I–V–VI | 41.1 | I–II–III–IV–V–VI | 42.6 | ||
| II–III–IV | 31.2 | ||||
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cibulka, M.; Brodnanova, M.; Grendar, M.; Necpal, J.; Benetin, J.; Han, V.; Kurca, E.; Nosal, V.; Skorvanek, M.; Vesely, B.; et al. Alzheimer’s Disease-Associated SNP rs708727 in SLC41A1 May Increase Risk for Parkinson’s Disease: Report from Enlarged Slovak Study. Int. J. Mol. Sci. 2022, 23, 1604. https://doi.org/10.3390/ijms23031604
Cibulka M, Brodnanova M, Grendar M, Necpal J, Benetin J, Han V, Kurca E, Nosal V, Skorvanek M, Vesely B, et al. Alzheimer’s Disease-Associated SNP rs708727 in SLC41A1 May Increase Risk for Parkinson’s Disease: Report from Enlarged Slovak Study. International Journal of Molecular Sciences. 2022; 23(3):1604. https://doi.org/10.3390/ijms23031604
Chicago/Turabian StyleCibulka, Michal, Maria Brodnanova, Marian Grendar, Jan Necpal, Jan Benetin, Vladimir Han, Egon Kurca, Vladimir Nosal, Matej Skorvanek, Branislav Vesely, and et al. 2022. "Alzheimer’s Disease-Associated SNP rs708727 in SLC41A1 May Increase Risk for Parkinson’s Disease: Report from Enlarged Slovak Study" International Journal of Molecular Sciences 23, no. 3: 1604. https://doi.org/10.3390/ijms23031604
APA StyleCibulka, M., Brodnanova, M., Grendar, M., Necpal, J., Benetin, J., Han, V., Kurca, E., Nosal, V., Skorvanek, M., Vesely, B., Stanclova, A., Lasabova, Z., Pös, Z., Szemes, T., Stuchlik, S., Grofik, M., & Kolisek, M. (2022). Alzheimer’s Disease-Associated SNP rs708727 in SLC41A1 May Increase Risk for Parkinson’s Disease: Report from Enlarged Slovak Study. International Journal of Molecular Sciences, 23(3), 1604. https://doi.org/10.3390/ijms23031604

