Indomethacin and Diclofenac Hybrids with Oleanolic Acid Oximes Modulate Key Signaling Pathways in Pancreatic Cancer Cells
Abstract
1. Introduction
2. Results
2.1. Conjugation with OAO Derivatives Increases the Cytotoxicity of Indomethacin and Diclofenac
2.2. IND and DCL-OAO Conjugates Diminish the Activation of NF-κB and COX-2 Expression in Pancreatic Cancer PSN-1 Cells
2.3. Conjugates with OAO Increased Activation and Expression of Nrf2 in PSN-1 Cells
2.4. Bead-Based Multiplex Immunoassay Revealed Possible Modulation of Protein Regulating Several Signaling Pathways by OAO-IND and OAO-DCL Conjugates
2.5. Conjugates of IND, DCL, and OAO Derivatives Do Not Change the Cell Cycle Distribution and Have No Effect on Cell Proliferation in Pancreatic Cancer Cells
3. Discussion
4. Materials and Methods
4.1. Chemistry
4.2. Biological Assays
4.2.1. Cell Culture and Viability Assay
4.2.2. Total RNA Isolation, cDNA Synthesis, and Quantitative Real-Time PCR (R-T PCR)
4.2.3. Nuclear and Cytosolic Fractions Preparation
4.2.4. Western Blot Analysis
4.2.5. Nrf2 and NF-ĸB Binding Assay
4.2.6. Cell Cycle Distribution
4.2.7. Proliferation Profile
4.2.8. ROS Generation
4.2.9. Bead-Based Immunoassay on the Luminex MAGPIX Instrument
4.3. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Nihr, J.K.; Biomedical, P.; Kleeff, J.; Korc, M.; Apte, M.; La Vecchia, C.; Johnson, C.D.; Biankin, A.V.; Neale, R.E.; Tempero, M.; et al. Pancreatic cancer. Nat. Rev. Dis. Primers 2016, 1, 16022. [Google Scholar] [CrossRef] [Scilit]
- Rayburn, E.R.; Ezell, S.J.; Zhang, R. Anti-Inflammatory Agents for Cancer Therapy. Mol. Cell. Pharmacol. 2009, 1, 29. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Taniguchi, K.; Karin, M. NF-κB, inflammation, immunity and cancer: Coming of age. Nat. Rev. Immunol. 2018, 18, 309–324. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qin, J.J.; Cheng, X.D.; Zhang, J.; Zhang, W.D. Dual roles and therapeutic potential of Keap1-Nrf2 pathway in pancreatic cancer: A systematic review. Cell. Commun. Signal. 2019, 17, 1–15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pramanik, K.C.; Makena, M.R.; Bhowmick, K.; Pandey, M.K. Advancement of NF-κB Signaling Pathway: A Novel Target in Pancreatic Cancer. Int. J. Mol. Sci. 2018, 19, 3890. [Google Scholar] [CrossRef] [Scilit]
- McMahon, M.; Thomas, N.; Itoh, K.; Yamamoto, M.; Hayes, J.D. Dimerization of substrate adaptors can facilitate cullin-mediated ubiquitylation of proteins by a “tethering” mechanism: A two-site interaction model for the Nrf2-Keap1 complex. J. Biol. Chem. 2006, 281, 24756–24768. [Google Scholar] [CrossRef] [Scilit]
- Tong, K.I.; Kobayashi, A.; Katsuoka, F.; Yamamoto, M. Two-site substrate recognition model for the Keap1-Nrf2 system: A hinge and latch mechanism. Biol. Chem. 2006, 387, 1311–1320. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Copple, I.M.; Goldring, C.E.; Kitteringham, N.R.; Park, B.K. The Keap1-Nrf2 Cellular Defense Pathway: Mechanisms of Regulation and Role in Protection Against Drug-Induced Toxicity. Handb. Exp. Pharmacol. 2010, 196, 233–266. [Google Scholar] [CrossRef] [Scilit]
- Lister, A.; Nedjadi, T.; Kitteringham, N.R.; Campbell, F.; Costello, E.; Lloyd, B.; Copple, I.M.; Williams, S.; Owen, A.; Neoptolemos, J.P.; et al. Nrf2 is overexpressed in pancreatic cancer: Implications for cell proliferation and therapy. Mol. Cancer 2011, 10, 37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sasaki, H.; Sato, H.; Kuriyama-Matsumura, K.; Sato, K.; Maebara, K.; Wang, H.; Tamba, M.; Itoh, K.; Yamamoto, M.; Bannai, S. Electrophile Response Element-mediated Induction of the Cystine/Glutamate Exchange Transporter Gene Expression. J. Biol. Chem. 2002, 277, 44765–44771. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maher, J.M.; Dieter, M.Z.; Aleksunes, L.M.; Slitt, A.L.; Guo, G.; Tanaka, Y.; Scheffer, G.L.; Chan, J.Y.; Manautou, J.E.; Chen, Y.; et al. Oxidative and electrophilic stress induces multidrug resistance–associated protein transporters via the nuclear factor-E2–related factor-2 transcriptional pathway. Hepatology 2007, 46, 1597–1610. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chanas, S.A.; Jiang, Q.; McMahon, M.; McWalter, G.K.; McLellan, L.I.; Elcombe, C.R.; Henderson, C.J.; Wolf, C.R.; Moffat, G.J.; Itoh, K.; et al. Loss of the Nrf2 transcription factor causes a marked reduction in constitutive and inducible expression of the glutathione S-transferase GSTA1, GSTA2, GSTM1, GSTM2, GSTM3 and GSTM4 genes in the livers of male and female mice. Biochem. J. 2002, 365, 405. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Itoh, K.; Chiba, T.; Takahashi, S.; Ishii, T.; Igarashi, K.; Katoh, Y.; Oyake, T.; Hayashi, N.; Satoh, K.; Hatayama, I.; et al. An Nrf2/Small Maf Heterodimer Mediates the Induction of Phase II Detoxifying Enzyme Genes through Antioxidant Response Elements. Biochem. Biophys. Res. Commun. 1997, 236, 313–322. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hayes, J.D.; McMahon, M. NRF2 and KEAP1 mutations: Permanent activation of an adaptive response in cancer. Trends Biochem. Sci. 2009, 34, 176–188. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Osburn, W.O.; Kensler, T.W. Nrf2 signaling: An adaptive response pathway for protection against environmental toxic insults. Mutat. Res. 2008, 659, 31. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arlt, A.; Schäfer, H.; Kalthoff, H. The ‘N-factors’ in pancreatic cancer: Functional relevance of NF-κB, NFAT and Nrf2 in pancreatic cancer. Oncogenesis 2012, 1, e35. [Google Scholar] [CrossRef] [Scilit]
- Lee, S.; Rauch, J.; Kolch, W. Targeting MAPK Signaling in Cancer: Mechanisms of Drug Resistance and Sensitivity. Int. J. Mol. Sci. 2020, 21, 1102. [Google Scholar] [CrossRef] [Scilit]
- Arlt, A.; Müerköster, S.S.; Schäfer, H. Targeting apoptosis pathways in pancreatic cancer. Cancer Lett. 2013, 332, 346–358. [Google Scholar] [CrossRef] [Scilit]
- Zappavigna, S.; Cossu, A.M.; Grimaldi, A.; Bocchetti, M.; Ferraro, G.A.; Nicoletti, G.F.; Filosa, R.; Caraglia, M. Anti-Inflammatory Drugs as Anticancer Agents. Int. J. Mol. Sci. 2020, 21, 2605. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Majchrzak-Celińska, A.; Misiorek, J.O.; Kruhlenia, N.; Przybyl, L.; Kleszcz, R.; Rolle, K.; Krajka-Kuźniak, V. COXIBs and 2,5-dimethylcelecoxib counteract the hyperactivated Wnt/β-catenin pathway and COX-2/PGE2/EP4 signaling in glioblastoma cells. BMC Cancer 2021, 21, 1–18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bradley, M.C.; Hughes, C.M.; Cantwell, M.M.; Napolitano, G.; Murray, L.J. Non-steroidal anti-inflammatory drugs and pancreatic cancer risk: A nested case–control study. Br. J. Cancer 2010, 102, 1415. [Google Scholar] [CrossRef] [Scilit]
- Narożna, M.; Krajka-Kuźniak, V.; Bednarczyk-Cwynar, B.; Kucińska, M.; Kleszcz, R.; Kujawski, J.; Piotrowska-Kempisty, H.; Plewiński, A.; Murias, M.; Baer-Dubowska, W. Conjugation of diclofenac with novel oleanolic acid derivatives modulate Nrf2 and NF-κB activity in hepatic cancer cells and normal hepatocytes leading to enhancement of its therapeutic and chemopreventive potential. Pharmaceuticals 2021, 14, 688. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pires, B.R.B.; Silva, R.C.M.C.; Ferreira, G.M.; Abdelhay, E. NF-kappaB: Two Sides of the Same Coin. Genes 2018, 9, 24. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Christian, F.; Smith, E.L.; Carmody, R.J. The Regulation of NF-κB Subunits by Phosphorylation. Cells 2016, 5, 12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Okami, J.; Yamamoto, H.; Fujiwara, Y.; Tsujie, M.; Kondo, M.; Noura, S.; Oshima, S.; Nagano, H.; Dono, K.; Umeshita, K.; et al. Overexpression of Cyclooxygenase-2 in Carcinoma of the Pancreas. Clin. Cancer Res. 1999, 5, 2018–2024. [Google Scholar] [PubMed]
- Liu, H.; Yang, Z.; Zang, L.; Wang, G.; Zhou, S.; Jin, G.; Yang, Z.; Pan, X. Downregulation of glutathione S-transferase A1 suppressed tumor growth and induced cell apoptosis in A549 cell line. Oncol. Lett. 2018, 16, 467–474. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Prabhu, L.; Mundade, R.; Korc, M.; Loehrer, P.J.; Lu, T. Critical role of NF-κB in pancreatic cancer. Oncotarget 2014, 5, 10969. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nomura, A.; Majumder, K.; Giri, B.; Dauer, P.; Dudeja, V.; Roy, S.; Banerjee, S.; Saluja, A.K. Inhibition of NF-kappa B pathway leads to deregulation of epithelial–mesenchymal transition and neural invasion in pancreatic cancer. Lab. Investig. 2016, 96, 1268–1278. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Narożna, M.; Krajka-Kuźniak, V.; Kleszcz, R.; Bednarczyk-Cwynar, B.; Szaefer, H.; Baer-Dubowska, W. Activation of the Nrf2 response by oleanolic acid oxime morpholide (3-hydroxyiminoolean-12-en-28-oic acid morpholide) is associated with its ability to induce apoptosis and inhibit proliferation in HepG2 hepatoma cells. Eur. J. Pharmacol. 2020, 883, 173307. [Google Scholar] [CrossRef] [Scilit]
- Krajka-Kuźniak, V.; Bednarczyk-Cwynar, B.; Paluszczak, J.; Szaefer, H.; Narożna, M.; Zaprutko, L.; Baer-Dubowska, W. Oleanolic acid oxime derivatives and their conjugates with aspirin modulate the NF-κB-mediated transcription in HepG2 hepatoma cells. Bioorg. Chem. 2019, 93, 103326. [Google Scholar] [CrossRef] [Scilit]
- Narożna, M.; Krajka-Kuźniak, V.; Bednarczyk-Cwynar, B.; Kleszcz, R.; Baer-Dubowska, W. The Effect of Novel Oleanolic Acid Oximes Conjugated with Indomethacin on the Nrf2-ARE And NF-κB Signaling Pathways in Normal Hepatocytes and Human Hepatocellular Cancer Cells. Pharmaceuticals 2021, 14, 32. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, Y.; Wan, Y.; Huang, C. The Biological Functions of NF-κB1 (p50) and its Potential as an Anti-Cancer Target. Curr. Cancer Drug Targets 2009, 9, 566. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Giridharan, S.; Srinivasan, M. Mechanisms of NF-κB p65 and strategies for therapeutic manipulation. J. Inflamm. Res. 2018, 11, 407. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vogel, C.; Marcotte, E.M. Insights into the regulation of protein abundance from proteomic and transcriptomic analyses. Nat. Rev. Genet. 2012, 13, 227–232. [Google Scholar] [CrossRef] [Scilit]
- Saha, S.; Buttari, B.; Panieri, E.; Profumo, E.; Saso, L. An Overview of Nrf2 Signaling Pathway and Its Role in Inflammation. Molecules 2020, 25, 5474. [Google Scholar] [CrossRef] [Scilit]
- Baird, L.; Yamamoto, M. The Molecular Mechanisms Regulating the KEAP1-NRF2 Pathway. Mol. Cell. Biol. 2020, 40, e00099-20. [Google Scholar] [CrossRef] [Scilit]
- Surh, Y.J.; Na, H.K. NF-κB and Nrf2 as prime molecular targets for chemoprevention and cytoprotection with anti-inflammatory and antioxidant phytochemicals. Genes Nutr. 2008, 2, 313–317. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kurutas, E.B. The importance of antioxidants which play the role in cellular response against oxidative/nitrosative stress: Current state. Nutr. J. 2016, 15, 71. [Google Scholar] [CrossRef] [Scilit]
- Geismann, C.; Grohmann, F.; Sebens, S.; Wirths, G.; Dreher, A.; Häsler, R.; Rosenstiel, P.; Hauser, C.; Egberts, J.H.; Trauzold, A.; et al. c-Rel is a critical mediator of NF-κB-dependent TRAIL resistance of pancreatic cancer cells. Cell Death Dis. 2014, 5, e1455. [Google Scholar] [CrossRef] [Scilit]
- Probst, B.L.; McCauley, L.; Trevino, I.; Wigley, W.C.; Ferguson, D.A. Cancer Cell Growth Is Differentially Affected by Constitutive Activation of NRF2 by KEAP1 Deletion and Pharmacological Activation of NRF2 by the Synthetic Triterpenoid, RTA 405. PLoS ONE 2015, 10, e0135257. [Google Scholar] [CrossRef] [Scilit]
- Rodríguez-Carballo, E.; Gámez, B.; Ventura, F. p38 MAPK signaling in osteoblast differentiation. Front. Cell Dev. Biol. 2016, 4, 40. [Google Scholar] [CrossRef] [Scilit]
- Yang, S.Y.; Pyo, M.C.; Nam, M.H.; Lee, K.W. ERK/Nrf2 pathway activation by caffeic acid in HepG2 cells alleviates its hepatocellular damage caused by t-butylhydroperoxide-induced oxidative stress. BMC Complement. Altern. Med. 2019, 19, 139. [Google Scholar] [CrossRef] [Scilit]
- Feng, J.; Zhang, P.; Chen, X.; He, G. PI3K and ERK/Nrf2 pathways are involved in oleanolic acid-induced heme oxygenase-1 expression in rat vascular smooth muscle cells. J. Cell. Biochem. 2011, 112, 1524–1531. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fernandes, J.V.; Cobucci, R.N.O.; Jatobá, C.A.N.; de Medeiros Fernandes, T.A.A.; de Azevedo, J.W.V.; de Araújo, J.M.G. The role of the mediators of inflammation in cancer development. Pathol. Oncol. Res. 2015, 21, 527–534. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, G.; Shi, L.Z.; Chi, H. Regulation of JNK and p38 MAPK in the immune system: Signal integration, propagation and termination. Cytokine 2009, 48, 161. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liou, G.Y.; Storz, P. Reactive oxygen species in cancer. Free Radic. Res. 2010, 44, 479–496. [Google Scholar] [CrossRef] [Scilit]
- Arensman, M.D.; Telesca, D.; Lay, A.R.; Kershaw, K.M.; Wu, N.; Donahue, T.R.; Dawson, D.W. The CREB-Binding Protein Inhibitor ICG-001 Suppresses Pancreatic Cancer Growth. Mol. Cancer Ther. 2014, 13, 2303–2314. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.-T.; Tang, F.; Hu, X.; Zheng, C.-X.; Gong, T.; Zhou, Y.; Luo, Y.; Min, L. Role of crosstalk between STAT3 and mTOR signaling in driving sensitivity to chemotherapy in osteosarcoma cell lines. IUBMB Life 2020, 72, 2146–2153. [Google Scholar] [CrossRef] [Scilit]
- Xiao, L.; Wang, Y.C.; Li, W.S.; Du, Y. The role of mTOR and phospho-p70S6K in pathogenesis and progression of gastric carcinomas: An immunohistochemical study on tissue microarray. J. Exp. Clin. Cancer Res. 2009, 28, 152. [Google Scholar] [CrossRef] [Scilit]
- Murakami, S.; Motohashi, H. Roles of Nrf2 in cell proliferation and differentiation. Free Radic. Biol. Med. 2015, 88, 168–178. [Google Scholar] [CrossRef] [Scilit]








| Compound | PSN-1 * | MS-1 * |
|---|---|---|
| OA | >150 | >150 |
| 2c | >150 | >150 |
| 2d | 126.56 ± 1.22 | >150 |
| IND | >150 | >150 |
| 3c | 87.55 ± 4.87 | 97.50 ± 1.49 |
| 3d | 71.89 ± 2.98 | 93.75 ± 0.85 |
| DCL | >150 | >150 |
| 4c | 103.13 ± 0.28 | 125.00 ± 2.44 |
| 4d | 55.21 ± 1.97 | 69.50 ± 1.83 |
| Gene | Forward Primer | Reverse Primer |
|---|---|---|
| NF-ĸB p50 | 5′ATCATCCACCTTCATTCTCAA | 5′AATCCTCCACCACATCTTCC |
| NF-ĸB p65 | 5′CGCCTGTCCTTTCTCATC | 5′ACCTCAATGTCCTCTTTCTG |
| COX-2 | 5′CCTGTGCCTGATGATTGC | 5′CAGCCCGTTGGTGAAAGC |
| Nrf2 | 5′ATTGCTACTAATCAGGCTCAG | 5′GTTTGGCTTCTGGACTTGG |
| SOD-1 | 5′CGACAGAAGGAAAGTAATG | 5′TGGATAGAGGATTAAAGTGAGG |
| NQO1 | 5′CAATTCAGAGTGGCATTC | 5′GAAGTTTAGGTCAAAGAGG |
| GSTA | 5′GGGAAAGACATAAAGGAGAGAG | 5′TCAAAGGCAGGGAAGTAGC |
| HO-1 | 5′CAGGCAGAGGGTGATAGAAGAG | 5′GGAGCGGGTGTTGAGTGG |
| GPx | 5′CAACCAGTTTGGGCATCAG | 5′TTCACCTCGCACTTCTCG |
| PBGD | 5′TCAGATAGCATACAAGAGACC | 5′TGGAATGTTACGAGCAGTG |
| TBP | 5′GGCACCACTCCACTGTATC | 5′GGGATTATATTCGGCGTTTCG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Narożna, M.; Krajka-Kuźniak, V.; Kleszcz, R.; Baer-Dubowska, W. Indomethacin and Diclofenac Hybrids with Oleanolic Acid Oximes Modulate Key Signaling Pathways in Pancreatic Cancer Cells. Int. J. Mol. Sci. 2022, 23, 1230. https://doi.org/10.3390/ijms23031230
Narożna M, Krajka-Kuźniak V, Kleszcz R, Baer-Dubowska W. Indomethacin and Diclofenac Hybrids with Oleanolic Acid Oximes Modulate Key Signaling Pathways in Pancreatic Cancer Cells. International Journal of Molecular Sciences. 2022; 23(3):1230. https://doi.org/10.3390/ijms23031230
Chicago/Turabian StyleNarożna, Maria, Violetta Krajka-Kuźniak, Robert Kleszcz, and Wanda Baer-Dubowska. 2022. "Indomethacin and Diclofenac Hybrids with Oleanolic Acid Oximes Modulate Key Signaling Pathways in Pancreatic Cancer Cells" International Journal of Molecular Sciences 23, no. 3: 1230. https://doi.org/10.3390/ijms23031230
APA StyleNarożna, M., Krajka-Kuźniak, V., Kleszcz, R., & Baer-Dubowska, W. (2022). Indomethacin and Diclofenac Hybrids with Oleanolic Acid Oximes Modulate Key Signaling Pathways in Pancreatic Cancer Cells. International Journal of Molecular Sciences, 23(3), 1230. https://doi.org/10.3390/ijms23031230
