Intestinal Stem Cells Damaged by Deoxycholic Acid via AHR Pathway Contributes to Mucosal Barrier Dysfunction in High-Fat Feeding Mice
Abstract
:1. Introduction
2. Results
2.1. High-Fat Feeding Induces Disturbance of the Bile Acid Pool with an Increased DCA Level
2.2. High-Fat Feeding-Induced High Levels of DCA Impair the Differentiation of ISCs into GCs
2.3. High-Fat Feeding-Induced High Levels of DCA Disrupt AHR Signalling in ISCs
2.4. FICZ Restores the Disruption of DCA-Induced AHR Signalling and the Damage to the Differentiation Function of ISCs In Vitro
2.5. An HFD or DCA Diet Induces Changes of the Tryptophan Metabolism in Gut
2.6. DCA Downregulates IDO1 in PCs in Intestinal Crypts
2.7. DCA Downregulates IDO1 In Vitro
3. Discussion
4. Materials and Methods
4.1. Mice and Diets
4.2. Measurement of Faecal Bile Acid, KYN and Tryptophan Concentrations
4.3. Measurement of Serum Bile Acid
4.4. Periodic Acid-Schiff Staining
4.5. Immunoblot Analysis
4.6. RNA Extraction and RT-qPCR
4.7. Isolation of Crypts and Culture of Enteroids and Crypts In Vitro
4.8. Ileal Tissue Culture In Vitro
4.9. Immunofluorescence Staining
4.10. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Statovci, D.; Aguilera, M.; MacSharry, J.; Melgar, S. The impact of Western diet and nutrients on the microbiota and immune response at mucosal interfaces. Front. Immunol. 2017, 8, 838. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Albenberg, L.G.; Wu, G.D. Diet and the intestinal microbiome: Associations, functions, and implications for health and disease. Gastroenterology 2014, 146, 1564–1572. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Graf, D.; Di Cagno, R.; Fåk, F.; Flint, H.J.; Nyman, M.; Saarela, M.; Watzl, B. Contribution of diet to the composition of the human gut microbiota. Microb. Ecol. Health Dis. 2015, 26, 26164. [Google Scholar] [CrossRef] [PubMed]
- Llewellyn, S.R.; Britton, G.J.; Contijoch, E.J.; Vennaro, O.H.; Mortha, A.; Colombel, J.F.; Grinspan, A.; Clemente, J.C.; Merad, M.; Faith, J.J. Interactions between diet and the intestinal microbiota alter intestinal permeability and colitis severity in mice. Gastroenterology 2018, 154, 1037–1046.e2. [Google Scholar] [CrossRef] [PubMed]
- Nigro, N.D.; Campbell, R.L.; Singh, D.V.; Lin, Y.N. Effect of diet high in beef fat on the composition of fecal bile acids during intestinal carcinogenesis in the rat. J. Natl. Cancer Inst. 1976, 57, 883–888. [Google Scholar] [CrossRef]
- Cummings, J.H.; Wiggins, H.S.; Jenkins, D.J.; Houston, H.; Jivraj, T.; Drasar, B.S.; Hill, M.J. Influence of diets high and low in animal fat on bowel habit, gastrointestinal transit time, fecal microflora, bile acid, and fat excretion. J. Clin. Investig. 1978, 61, 953–963. [Google Scholar] [CrossRef] [Green Version]
- Zeng, H.; Safratowich, B.D.; Cheng, W.H.; Larson, K.J.; Briske-Anderson, M. Deoxycholic Acid Modulates Cell-Junction Gene Expression and Increases Intestinal Barrier Dysfunction. Molecules 2022, 27, 723. [Google Scholar] [CrossRef]
- Wang, Z.; Litterio, M.C.; Müller, M.; Vauzour, D.; Oteiza, P.I. (-)-Epicatechin and NADPH oxidase inhibitors prevent bile acid-induced Caco-2 monolayer permeabilization through ERK1/2 modulation. Redox Biol. 2020, 28, 101360. [Google Scholar] [CrossRef]
- Liu, L.; Dong, W.; Wang, S.; Zhang, Y.; Liu, T.; Xie, R.; Wang, B.; Cao, H. Deoxycholic acid disrupts the intestinal mucosal barrier and promotes intestinal tumorigenesis. Food Funct. 2018, 9, 5588–5597. [Google Scholar] [CrossRef] [Green Version]
- Hegyi, P.; Maléth, J.; Walters, J.R.; Hofmann, A.F.; Keely, S.J. Guts and Gall: Bile Acids in Regulation of Intestinal Epithelial Function in Health and Disease. Physiol. Rev. 2018, 98, 1983–2023. [Google Scholar] [CrossRef]
- Odenwald, M.A.; Turner, J.R. The intestinal epithelial barrier: A therapeutic target? Nat. Rev. Gastroenterol. Hepatol. 2017, 14, 9–21. [Google Scholar] [CrossRef] [PubMed]
- Johansson, M.E.; Hansson, G.C. Goblet cells need some stress. J. Clin. Investig. 2022, 132, e162030. [Google Scholar] [CrossRef] [PubMed]
- Sato, T.; van Es, J.H.; Snippert, H.J.; Stange, D.E.; Vries, R.G.; van den Born, M.; Barker, N.; Shroyer, N.F.; Van De Wetering, M.; Clevers, H. Paneth cells constitute the niche for Lgr5 stem cells in intestinal crypts. Nature 2011, 469, 415–418. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stockinger, B.; Shah, K.; Wincent, E. AHR in the intestinal microenvironment: Safeguarding barrier function. Nat. Rev. Gastroenterol. Hepatol. 2021, 18, 559–570. [Google Scholar] [CrossRef] [PubMed]
- Agus, A.; Planchais, J.; Sokol, H. Gut Microbiota Regulation of Tryptophan Metabolism in Health and Disease. Cell Host Microbe 2018, 23, 716–724. [Google Scholar] [CrossRef] [Green Version]
- Taleb, S. Tryptophan Dietary Impacts Gut Barrier and Metabolic Diseases. Front. Immunol. 2019, 10, 2113. [Google Scholar] [CrossRef]
- Metidji, A.; Omenetti, S.; Crotta, S.; Li, Y.; Nye, E.; Ross, E.; Li, V.; Maradana, M.R.; Schiering, C.; Stockinger, B. The Environmental Sensor AHR Protects from Inflammatory Damage by Maintaining Intestinal Stem Cell Homeostasis and Barrier Integrity. Immunity 2018, 49, 353–362.e5. [Google Scholar] [CrossRef] [Green Version]
- Park, J.H.; Choi, A.J.; Kim, S.J.; Cheong, S.W.; Jeong, S.Y. AHR activation by 6-formylindolo[3,2-b]carbazole and 2,3,7,8-tetrachlorodibenzo-p-dioxin inhibit the development of mouse intestinal epithelial cells. Environ. Toxicol. Pharmacol. 2016, 43, 44–53. [Google Scholar] [CrossRef]
- Alvarado, D.M.; Chen, B.; Iticovici, M.; Thaker, A.I.; Dai, N.; VanDussen, K.L.; Shaikh, N.; Lim, C.K.; Guillemin, G.; Tarr, P.I.; et al. Epithelial Indoleamine 2,3-Dioxygenase 1 Modulates Aryl Hydrocarbon Receptor and Notch Signaling to Increase Differentiation of Secretory Cells and Alter Mucus-Associated Microbiota. Gastroenterology 2019, 157, 1093–1108.e11. [Google Scholar] [CrossRef]
- Zelante, T.; Iannitti, R.G.; Cunha, C.; De Luca, A.; Giovannini, G.; Pieraccini, G.; Zecchi, R.; D’Angelo, C.; Massi-Benedetti, C.; Fallarino, F.; et al. Tryptophan catabolites from microbiota engage aryl hydrocarbon receptor and balance mucosal reactivity via interleukin-22. Immunity 2013, 39, 372–385. [Google Scholar] [CrossRef]
- Monteleone, I.; Rizzo, A.; Sarra, M.; Sica, G.; Sileri, P.; Biancone, L.; Macdonald, T.T.; Pallone, F.; Monteleone, G. Aryl hydrocarbon receptor-induced signals up-regulate IL-22 production and inhibit inflammation in the gastrointestinal tract. Gastroenterology 2011, 141, 237–248.e1. [Google Scholar] [CrossRef] [PubMed]
- Gronke, K.; Hernández, P.P.; Zimmermann, J.; Klose, C.S.N.; Kofoed-Branzk, M.; Guendel, F.; Witkowski, M.; Tizian, C.; Amann, L.; Schumacher, F.; et al. Interleukin-22 protects intestinal stem cells against genotoxic stress. Nature 2019, 566, 249–253. [Google Scholar] [CrossRef] [PubMed]
- Natividad, J.M.; Agus, A.; Planchais, J.; Lamas, B.; Jarry, A.C.; Martin, R.; Michel, M.-L.; Chong-Nguyen, C.; Roussel, R.; Straube, M.; et al. Impaired Aryl Hydrocarbon Receptor Ligand Production by the Gut Microbiota Is a Key Factor in Metabolic Syndrome. Cell Metab. 2018, 28, 737–749.e4. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Laurans, L.; Venteclef, N.; Haddad, Y.; Chajadine, M.; Alzaid, F.; Metghalchi, S.; Sovran, B.; Denis, R.G.P.; Dairou, J.; Cardellini, M.; et al. Genetic deficiency of indoleamine 2,3-dioxygenase promotes gut microbiota-mediated metabolic health. Nat. Med. 2018, 24, 1113–1120. [Google Scholar] [CrossRef] [PubMed]
- Zhou, H.; Zhou, S.Y.; Gillilland, M.; Li, J.Y.; Lee, A.; Gao, J.; Zhang, G.; Xu, X.; Owyang, C. Bile acid toxicity in Paneth cells contributes to gut dysbiosis induced by high-fat feeding. JCI Insight 2020, 5, e138881. [Google Scholar] [CrossRef] [PubMed]
- Huang, D.; Xiong, M.; Xu, X.; Wu, X.; Xu, J.; Cai, X.; Lu, L.; Zhou, H. Bile acids elevated by high-fat feeding induce endoplasmic reticulum stress in intestinal stem cells and contribute to mucosal barrier damage. Biochem. Biophys. Res. Commun. 2020, 529, 289–295. [Google Scholar] [CrossRef]
- Xu, J.; Huang, D.; Xu, X.; Wu, X.; Liu, L.; Niu, W.; Lu, L.; Zhou, H. An elevated deoxycholic acid level induced by high-fat feeding damages intestinal stem cells by reducing the ileal IL-22. Biochem. Biophys. Res. Commun. 2021, 579, 153–160. [Google Scholar] [CrossRef]
- Jonsson, M.E.; Franks, D.G.; Woodin, B.R.; Jenny, M.J.; Garrick, R.A.; Behrendt, L.; Hahn, M.E.; Stegeman, J.J. The tryptophan photoproduct 6-formylindolo[3,2-b]carbazole (FICZ) binds multiple AHRs and induces multiple CYP1 genes via AHR2 in zebrafish. Chem.-Biol. Interact. 2009, 181, 447–454. [Google Scholar] [CrossRef] [Green Version]
- Pflügler, S.; Svinka, J.; Scharf, I.; Crncec, I.; Filipits, M.; Charoentong, P.; Tschurtschenthaler, M.; Kenner, L.; Awad, M.; Stift, J.; et al. IDO1+ Paneth cells promote immune escape of colorectal cancer. Commun. Biol. 2020, 3, 252. [Google Scholar] [CrossRef]
- Fuchs, C.D.; Trauner, M. Role of bile acids and their receptors in gastrointestinal and hepatic pathophysiology. Nat. Rev. Gastroenterol. Hepatol. 2022, 19, 432–450. [Google Scholar] [CrossRef]
- Fu, T.; Coulter, S.; Yoshihara, E.; Oh, T.G.; Fang, S.; Cayabyab, F.; Zhu, Q.; Zhang, T.; Leblanc, M.; Liu, S.; et al. FXR Regulates Intestinal Cancer Stem Cell Proliferation. Cell 2019, 176, 1098–1112.e18. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bernstein, C.; Holubec, H.; Bhattacharyya, A.K.; Nguyen, H.; Payne, C.M.; Zaitlin, B.; Bernstein, H. Carcinogenicity of deoxycholate, a secondary bile acid. Arch. Toxicol. 2011, 85, 863–871. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rohr, M.W.; Narasimhulu, C.A.; Rudeski-Rohr, T.A.; Parthasarathy, S. Negative Effects of a High-Fat Diet on Intestinal Permeability: A Review. Adv. Nutr. 2020, 11, 77–91. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Perino, A.; Demagny, H.; Velazquez-Villegas, L.; Schoonjans, K. Molecular Physiology of Bile Acid Signaling in Health, Disease, and Aging. Physiol. Rev. 2021, 101, 683–731. [Google Scholar] [CrossRef] [PubMed]
- Cao, H.; Xu, M.; Dong, W.; Deng, B.; Wang, S.; Zhang, Y.; Wang, S.; Luo, S.; Wang, W.; Qi, Y.; et al. Secondary bile acid-induced dysbiosis promotes intestinal carcinogenesis. Int. J. Cancer 2017, 140, 2545–2556. [Google Scholar] [CrossRef] [Green Version]
- Yao, Y.; Li, X.; Xu, B.; Luo, L.; Guo, Q.; Wang, X.; Sun, L.; Zhang, Z.; Li, P. Cholecystectomy promotes colon carcinogenesis by activating the Wnt signaling pathway by increasing the deoxycholic acid level. Cell Commun. Signal. 2022, 20, 71. [Google Scholar] [CrossRef]
- Farhana, L.; Nangia-Makker, P.; Arbit, E.; Shango, K.; Sarkar, S.; Mahmud, H.; Hadden, T.; Yu, Y.; Majumdar, A.P.N. Bile acid: A potential inducer of colon cancer stem cells. Stem Cell Res. Ther. 2016, 7, 181. [Google Scholar] [CrossRef] [Green Version]
- Nguyen, T.T.; Ung, T.T.; Kim, N.H.; Jung, Y.D. Role of bile acids in colon carcinogenesis. World J. Clin. Cases 2018, 6, 577–588. [Google Scholar] [CrossRef]
- Postal, B.G.; Ghezzal, S.; Aguanno, D.; André, S.; Garbin, K.; Genser, L.; Brot-Laroche, E.; Poitou, C.; Soula, H.; Leturque, A.; et al. AHR activation defends gut barrier integrity against damage occurring in obesity. Mol. Metab. 2020, 39, 101007. [Google Scholar] [CrossRef]
- Yu, M.; Wang, Q.; Ma, Y.; Li, L.; Yu, K.; Zhang, Z.; Chen, G.; Li, X.; Xiao, W.; Xu, P.; et al. Aryl Hydrocarbon Receptor Activation Modulates Intestinal Epithelial Barrier Function by Maintaining Tight Junction Integrity. Int. J. Biol. Sci. 2018, 14, 69–77. [Google Scholar] [CrossRef]
- Yin, J.; Yang, K.; Zhou, C.; Xu, P.; Xiao, W.; Yang, H. Aryl hydrocarbon receptor activation alleviates dextran sodium sulfate-induced colitis through enhancing the differentiation of goblet cells. Biochem. Biophys. Res. Commun. 2019, 514, 180–186. [Google Scholar] [CrossRef] [PubMed]
- Park, J.H.; Lee, J.M.; Lee, E.J.; Hwang, W.B.; Kim, D.J. Indole-3-Carbinol Promotes Goblet-Cell Differentiation Regulating Wnt and Notch Signaling Pathways AHR-Dependently. Mol. Cells 2018, 41, 290–300. [Google Scholar] [PubMed]
- Van der Goot, A.T.; Nollen, E.A. Tryptophan metabolism: Entering the field of aging and age-related pathologies. Trends Mol. Med. 2013, 19, 336–344. [Google Scholar] [CrossRef] [PubMed]
- Harrington, L.; Srikanth, C.V.; Antony, R.; Rhee, S.J.; Mellor, A.L.; Shi, H.N.; Cherayil, B.J. Deficiency of indoleamine 2,3-dioxygenase enhances commensal-induced antibody responses and protects against Citrobacter rodentium-induced colitis. Infect. Immun. 2008, 76, 3045–3053. [Google Scholar] [CrossRef] [Green Version]
- Zhang, X.; Liu, X.; Zhou, W.; Du, Q.; Yang, M.; Ding, Y.; Hu, R. Blockade of IDO-kynurenine-AHR Axis Ameliorated Colitis-Associated Colon Cancer via Inhibiting Immune Tolerance. Cell. Mol. Gastroenterol. Hepatol. 2021, 12, 1179–1199. [Google Scholar] [CrossRef]
- De Araújo, E.F.; Feriotti, C.; Galdino, N.A.L.; Preite, N.W.; Calich, V.L.G.; Loures, F.V. The IDO-AHR Axis Controls Th17/Treg Immunity in a Pulmonary Model of Fungal Infection. Front. Immunol. 2017, 8, 880. [Google Scholar] [CrossRef] [Green Version]
- Ciorba, M.A.; Bettonville, E.E.; McDonald, K.G.; Metz, R.; Prendergast, G.C.; Newberry, R.D.; Stenson, W.F. Induction of IDO-1 by immunostimulatory DNA limits severity of experimental colitis. J. Immunol. 2010, 184, 3907–3916. [Google Scholar] [CrossRef] [Green Version]
- Opitz, C.A.; Litzenburger, U.M.; Sahm, F.; Ott, M.; Tritschler, I.; Trump, S.; Schumacher, T.; Jestaedt, L.; Schrenk, D.; Weller, M.; et al. An endogenous tumour-promoting ligand of the human aryl hydrocarbon receptor. Nature 2011, 478, 197–203. [Google Scholar] [CrossRef] [Green Version]
- Seok, S.H.; Ma, Z.X.; Feltenberger, J.B.; Chen, H.; Chen, H.; Scarlett, C. Trace derivatives of kynurenine potently activate the aryl hydrocarbon receptor (AHR). J. Biol. Chem. 2018, 293, 1994–2005. [Google Scholar] [CrossRef] [Green Version]
- Park, J.H.; Lee, J.M.; Lee, E.J.; Kim, D.J.; Hwang, W.B. Kynurenine promotes the goblet cell differentiation of HT-29 colon carcinoma cells by modulating Wnt, Notch and AHR signals. Oncol. Rep. 2018, 39, 1930–1938. [Google Scholar] [CrossRef]
- Takahashi, S.; Fukami, T.; Masuo, Y.; Brocker, C.N.; Xie, C.; Krausz, K.W.; Wolf, C.R.; Henderson, C.J.; Gonzalez, F.J. Cyp2c70 is re-sponsible for the species difference in bile acid metabolism between mice and humans. J. Lipid Res. 2016, 57, 2130–2137. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wahlström, A.; Kovatcheva-Datchary, P.; Ståhlman, M.; Khan, M.T.; Bäckhed, F.; Marschall, H.U. Induction of farnesoid X receptor signaling in germ-free mice colonized with a human microbiota. J. Lipid Res. 2017, 58, 412–419. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, J.; Dawson, P.A. Animal models to study bile acid metabolism. Biochim. Biophys. Acta Mol. Basis Dis. 2019, 1865, 895–911. [Google Scholar] [CrossRef] [PubMed]
- Hu, T.; An, Z.; Shi, C.; Li, P.; Liu, L. A sensitive and efficient method for simultaneous profiling of bile acids and fatty acids by UPLC-MS/MS. J. Pharm. Biomed. Anal. 2020, 178, 112815. [Google Scholar] [CrossRef] [PubMed]
- Yang, T.; Shu, T.; Liu, G.; Mei, H.; Zhu, X.; Huang, X.; Zhang, L.; Jiang, Z. Quantitative profiling of 19 bile acids in rat plasma, liver, bile and different intestinal section contents to investigate bile acid homeostasis and the application of temporal variation of endogenous bile acids. J. Steroid Biochem. Mol. Biol. 2017, 172, 69–78. [Google Scholar] [CrossRef] [PubMed]
- Chen, G.Y.; Zhong, W.; Zhou, Z.; Zhang, Q. Simultaneous determination of tryptophan and its 31 catabolites in mouse tissues by polarity switching UHPLC-SRM-MS. Anal. Chim. Acta 2018, 1037, 200–210. [Google Scholar] [CrossRef]
- Zhang, G.H.; Cong, A.R.; Xu, G.B.; Li, C.B.; Yang, R.F.; Xia, T.A. An enzymatic cycling method for the determination of serum total bile acids with recombinant 3alpha-hydroxysteroid dehydrogenase. Biochem. Biophys. Res. Commun. 2005, 326, 87–92. [Google Scholar] [CrossRef]
Gene (Mouse) | Primer Sequence (5′ to 3′) |
---|---|
GAPDH-F | CATCACTGCCACCCAGAAGACTG |
GAPDH-R | ATGCCAGTGAGCTTCCCGTTCAG |
AHR-F | CTGGTTGTCACAGCAGATGCCT |
AHR-R | CGGTCTTCTGTATGGATGAGCTC |
ATOH1-F | CCTTCAACAACGACAAGAAGCTG |
ATOH1-R | GCAACTCCGACAGAGCGTTG |
CYP1A1-F | ACCCTTACAAGTATTTGGTCGT |
CYP1A1-R | GTCATCATGGTCATAACGTTGG |
MUC2-F | AAACCTCCAACTGAATCCTCG |
MUC2-R | GAAGTGACGAATGGTGATGTTG |
IDO1-F | GGTCTCTGTGAGAAAGTTCCACCTC |
IDO1-R | AGTCCCTCTGCTTTCCACATTTG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, L.; Xu, J.; Xu, X.; Mao, T.; Niu, W.; Wu, X.; Lu, L.; Zhou, H. Intestinal Stem Cells Damaged by Deoxycholic Acid via AHR Pathway Contributes to Mucosal Barrier Dysfunction in High-Fat Feeding Mice. Int. J. Mol. Sci. 2022, 23, 15578. https://doi.org/10.3390/ijms232415578
Liu L, Xu J, Xu X, Mao T, Niu W, Wu X, Lu L, Zhou H. Intestinal Stem Cells Damaged by Deoxycholic Acid via AHR Pathway Contributes to Mucosal Barrier Dysfunction in High-Fat Feeding Mice. International Journal of Molecular Sciences. 2022; 23(24):15578. https://doi.org/10.3390/ijms232415578
Chicago/Turabian StyleLiu, Leheng, Jingxian Xu, Xianjun Xu, Tiancheng Mao, Wenlu Niu, Xiaowan Wu, Lungen Lu, and Hui Zhou. 2022. "Intestinal Stem Cells Damaged by Deoxycholic Acid via AHR Pathway Contributes to Mucosal Barrier Dysfunction in High-Fat Feeding Mice" International Journal of Molecular Sciences 23, no. 24: 15578. https://doi.org/10.3390/ijms232415578
APA StyleLiu, L., Xu, J., Xu, X., Mao, T., Niu, W., Wu, X., Lu, L., & Zhou, H. (2022). Intestinal Stem Cells Damaged by Deoxycholic Acid via AHR Pathway Contributes to Mucosal Barrier Dysfunction in High-Fat Feeding Mice. International Journal of Molecular Sciences, 23(24), 15578. https://doi.org/10.3390/ijms232415578