Next Article in Journal
The New Version of the ANDDigest Tool with Improved AI-Based Short Names Recognition
Previous Article in Journal
Towards the Search for Potential Biomarkers in Osteosarcoma: State-of-the-Art and Translational Expectations
Previous Article in Special Issue
Combining Physio-Biochemical Characterization and Transcriptome Analysis Reveal the Responses to Varying Degrees of Drought Stress in Brassica napus L.
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 23
Issue 23
10.3390/ijms232314943
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Overexpression of CpADC from Chinese Cherry (Cerasus pseudocerasus Lindl. ‘Manaohong’) Promotes the Ability of Response to Drought in Arabidopsis thaliana

by
Jiaxin Ran
1,
Chunqiong Shang
2,
Lina Mei
2,
Shuang Li
1,
Tian Tian
1 and
Guang Qiao
1,*
1
Key Laboratory of Plant Resource Conservation and Germplasm Innovation in Mountainous Region (Ministry of Education), Institute of Agro-Bioengineering, College of Life Science, Guizhou University, Guiyang 550025, China
2
Institute for Forest Resources & Environment of Guizhou, College of Forestry, Guizhou University, Guiyang 550025, China
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2022, 23(23), 14943; https://doi.org/10.3390/ijms232314943
Submission received: 7 November 2022 / Revised: 21 November 2022 / Accepted: 25 November 2022 / Published: 29 November 2022
(This article belongs to the Special Issue Abiotic Stress: Signaling and Responses)
Browse Figures
Review Reports Versions Notes

Abstract

:
Polyamines (PA) play an important role in the growth, development and stress resistance of plants, and arginine decarboxylase (ADC) is one of the key enzymes in the biosynthetic pathway of polyamines. Previously, the transcriptional regulation of the ‘Manaohong’ cherry under the shelter covering was carried out, and the PA synthase-related genes, particularly the ADC gene, were differentially expressed as exposure to drought stress. However, the mechanisms of how ADC is involved in the response of cherry to abiotic stress (especially drought stress) are still unknown. In the present work, the full-length coding sequence of this gene was isolated and named CpADC. Bioinformatics analysis indicated that the coding sequence of CpADC was 2529 bp in length. Cluster analysis showed that CpADC had the highest homologies with those of sweet cherry (Prunus avium, XP_021806331) and peach (Prunus persica, XP_007200307). Subcellular localization detected that the CpADC was localized in the plant nucleus. The qPCR quantification showed that CpADC was differentially expressed in roots, stems, leaves, flower buds, flowers, and fruits at different periods. Drought stress treatments were applied to both wild-type (WT) and transgenic Arabidopsis lines, and relevant physiological indicators were measured, and the results showed that the putrescine content of transgenic Arabidopsis was higher than that of WT under high-temperature treatment. The results showed that the MDA content of WT was consistently higher than that of transgenic plants and that the degree of stress in WT was more severe than in transgenic Arabidopsis, indicating that transgenic CpADC was able to enhance the stress resistance of the plants. Both the transgenic and WT plants had significantly higher levels of proline in their leaves after the stress treatment than before, but the WT plant had lower levels of proline than that of transgenic Arabidopsis in both cases. This shows that the accumulation of proline in the transgenic plants was higher than that in the wild type under drought and high and low-temperature stress, suggesting that the transgenic plants are more stress tolerant than the WT. Taken together, our results reveal that, under drought stress, the increase in both expressions of CpADC gene and Put (putrescine) accumulation regulates the activity of ADC, the content of MDA and Pro to enhance the drought resistance of Arabidopsis thaliana.

1. Introduction

Polyamines (PAs), produced during the metabolism of organisms, is a kind of small molecular weight aliphatic nitrogenous alkali with biological activity [1]. Common polyamines mainly include putrescine (Put, diamine), spermidine (Spd, triamine), and spermine (Spm, tetraamine) in plants [2]. Polyamines have rich biological functions, playing important roles in plant growth and development, such as seed formation, flower bud differentiation, fruit ripening and abiotic stress [3,4,5]. As related studies have been reported, the main metabolic and regulatory pathways of polyamines have been largely revealed. Genes-encoded metabolic regulatory enzymes of polyamine biosynthesis in plants have been identified [6]. At the same time, some mutants related to polyamine biosynthesis have been obtained, and these transgenic plants and mutants have been studied, revealing that polyamines and anabolic-related enzymes were involved in physiological processes such as plant growth and development [7,8], and Arginine decarboxylase (ADC) was one of the key enzymes in the synthesis of plant polyamines [9]. Current studies have shown that ADC genes have been cloned in a large number of plants, such as mustard (Brassica juncea) [10], turnip (Brassica rapa var.) [11], apple (Malus pumila) [12], peach (P. persica) [7] and so on. Studies have shown that ADC plays an important role in participating in plant stress resistance [13]. For example, in the study of apple callus [14], although the Put content increased under salt stress, only the exogenous application of putrescine could alleviate the damage caused by salt stress. Some people think that endogenous putrescine has not reached the threshold for conversion to spermidine and spermidine [15]. Studies in which an oat ADC gene vector was constructed with an inducible promoter and introduced into rice plants showed that the transgenic plants obtained were significantly more resistant to salinity [16]. The low temperature, salt and dehydration treatments caught induced the transcriptional expression of the MdADC gene in apples, indicating that this gene was involved in the stress response of apples [12]. Some studies have reported that the expression of ADC was mostly related to the response of plants under stress conditions [17,18].
‘Manaohong’ cherry (Cerasus pseudocerasus Lindl.), a variant of sour cherry found in Nayong county, Guizhou province, China [19], approved and named by the Guizhou Provincial Variety Approval Committee, and was known as the “King of Southern China Cherry” [20]. Our previous study found that polyamine content in ‘Manaohong’ cherry leaves under rain culture was higher, and the expression of related enzyme genes, including ADC in polyamine synthesis pathway, was significantly increased [21,22]. The presence of rain shelter cultivation changes the growing environment of ‘Manaohong’ cherry plant to some extent, especially the water condition [23,24]. Studies have shown that the increased contents of Put, Spd or Spm are related to the improvement of stress tolerance in rice, Arabidopsis, tobacco and other plants [13,25,26]. Therefore, we speculate that CpADC plays an important role in the adaptation of the ‘Manaohong’ cherry to water deficit. Additionally, drought stress was among the most serious threats jeopardizing the economic yield of crop plants and fruits (For example, 50% deficit irrigation decreased both growth and pomological traits and the drought severity during the ripening phenological period has adverse effects on pomegranate (Punica granatum L.) fruit productivity, characteristics and composition.) [27,28]. As the severity of drought stress increased, with an accumulation of sodium and malondialdehyde, an incremental increase in osmolytes was observed, as well as an enhancement of the activity of antioxidant enzymes (peroxidase and catalase) [29]. To better understand the mechanisms of CpADC involved in drought stress and further clarify how the plant responds to abiotic stress is related to Put, Spd and Spm, we investigated the relationship between drought stress and CpADC gene function, and determined the contents of Put, Spd and Spm. CpADC was cloned and expressed in Arabidopsis thaliana to explore the mechanisms by which CpADC is involved in plant responses to drought stress.

2. Results

2.1. Obtaining of CpADC

The full-length coding sequence (CDS) of CpADC was isolated in the Chinese cherry leaves by designing primers (Table 1) in PCR amplification, and the length coding sequence of CpADC gene is 2529 bp (Figure 1A), including 22 open reading frames (ORFs). The longest ORF was 2178 bp and encodes the ADC zymogen with 735 amino acid residues, and the protein has a relative molecular mass of 77.7 KDa and an isoelectric point PI of 5.23.

2.2. Physiological Analysis and Sequence Alignment

Bioinformatics analysis revealed that it is an unstable protein with a typical PLPDE3 superfamily structure. Cluster analysis showed that the homologous relationship between CpADC and sweet cherry (XP_021806331) and peach (XP_007200307) with homology 98.90% and 98.07% was the highest, followed by flat peach and plum blossom with homology 98.90% and 98.07%, respectively. The amino acid sequences of 14 ADC enzymes from sweet cherry (Prunus avium, XP_021806331), plum blossom (P. mume, XP_016650770), honey peach (P. persica, XP_007200307), etc. were downloaded from the NCBI database, and the amino acids of the CpADC gene cloned from Chinese cherry were extracted. Sequences are compared, and a phylogenetic tree is constructed (Figure 1B). It can be seen in the phylogenetic tree that the relationship between CpADC and sweet cherry and honey peach has recently been clustered, which is consistent with the amino acid sequence similarity and multiple sequence alignments in conserved sequences.

2.3. Tissue-Specific Expression of CpADC Gene

The expression levels of CpADC gene in different tissues of ‘Manaohong’ cherry were analyzed using qRT-PCR, and the results showed that the CpADC is expressed in different tissues and varies depending on the tissue type. Furthermore, the highest expression was in mature fruits (55 days after full bloom), followed by flowers and the lowest expression in roots and leaves (Figure 1C).

2.4. CpADC Is Localized in the Nucleus

To further investigate the localization of the CpADC protein in plant cells, CpADC with deletion of termination codon was constructed to the expression vector pBWA(V)HS-GFP, which was named pBWA (V) HS-CpADC-GFP is driven by 35S promoter in this study. The control (GFP) and pBWA (V) HS-CpADC-GFP fusion protein expression vector were transformed into N. benthamian leaves by agrobacterium-mediated method while monitored by a Confocal microscope.
Confocal images showed that GFP fluorescence was green, nuclear marker fluorescence was red, fusion fluorescence was yellow, the colocalized marker was red, and the chloroplast fluorescence signal was also red, later adjusted to rose red for easy identification (Figure 1D). The results show that CpADC is localized in the nucleus, in agreement with the results predicted by the online software Plant-mPloc server.

2.5. Transformation and Characterization of Transgenic Arabidopsis thaliana

As shown that the plant overexpression vector was constructed, using Arabidopsis thaliana (Colombia wild type) as material, CpADC was genetically transformed into Arabidopsis thaliana by floral dip by Agrobacterium-mediated transformation, identification of plant tissues by GUS staining (Figure 2A), PCR method, and multiple generations of resistance screening, nine homozygous strains with overexpression of T3 generation were obtained (Figure 2B). To further confirm the CpADC transcript levels of positive overexpression lines, real-time PCR was applied to four randomly selected transgenic lines (#1–#9) and WT plants under normal conditions (Figure 2C) with the actin7 (Table 1, At-actin7-F/ At-actin7-R) was selected as a reference gene in Arabidopsis thaliana. The transgenic lines #7 with the highest CpADC transcript level and the lowest transgenic lines #4 were selected for further analysis along with the corresponding untransformed WT.

2.6. Quantification of Free Polyamine Contene

High-performance liquid chromatography (HPLC) was used to determine the contents of endogenous polyamines in transgenic Arabidopsis and WT under simulated drought stress in a PEG solution. Figure 3A–C shows a trend of increasing and then decreasing polyamine content in both transgenic and WT plants, with a more pronounced trend for Put and Spd, while the change in Spm content is not significant. All peaked at 12 h; compared to the wild type, the Put content of the transgenic strain CpADC-OE-7 and strain CpADC-OE-4 increased approximately 2.05-fold and 1.28-fold, respectively (Figure 3A), and the Spd content of the transgenic strain CpADC-OE-7 and strain CpADC-OE-4 increased approximately 2.11-fold, and 1.65-fold, respectively (Figure 3B) and the transgenic strain CpADC-OE-7 and strain CpADC-OE-4 showed an increase in Spm content by about 2.01-fold and 1.42-fold, respectively (Figure 3C). Phenotypically, the leaves of transgenic Arabidopsis thaliana appeared significantly different from those of the WT, which the leaves of the transgenic Arabidopsis thaliana were significantly larger than those of the WT (Figure 3D) and under drought treatment, Arabidopsis thaliana wilted and yellowed, but the transgenic strains did not wilt as severely as the wild type, and the physiological indicators corresponded (Figure 3E). Thus, overexpression of the CpADC gene in Chinese cherry increased the endogenous polyamines (Put, Spd and Spm) in Arabidopsis, and overexpression of the CpADC gene led to an increase in polyamine (PAs) content that played a role in the growth and development of Arabidopsis.

2.7. Exposure to Drought Environment Led to Enhanced ADC Activity in AtADC Overexpression Line

The ADC activities of the transgenic Arabidopsis and WT under simulated drought stress, stress was measured using ELISA (Figure 4A). The results showed that ADC activities of both transgenic and WT leaves showed a trend of increasing and then decreasing, and both reached the maximum at 12 h stress treatment. The ADC activity of CpADC-OE-7 reached the highest, which was 1.84 times that of the WT and 1.5 times that of the CpADC-OE-4. This result suggests that exposure to a drought environment leads to enhanced ADC activity in CpADC overexpression lines.

2.8. MDA and Pro Levels Were Increased in Transgenic Arabidopsis Plant under Drought Tress

In particular, the greater the MDA content, the more the plant is exposed to adversity and the less it is resistant to stress; Conversely, the resistance to stress is high. Hence, we detected the variations of MDA content in transgenic Arabidopsis strains CpADC-OE-7, CpADC-OE-4 and WT under drought stress, and the results showed that there was an increasing trend in both transgenic and WT (Figure 4B). In contrast, the increase in MDA content was more pronounced in WT than in the transgenic strain. These results indicate that under drought stress, the cell membrane system of WT is disrupted to a greater extent than that of the transgenic lines. Therefore, the transgenic lines show resistance to drought stress. Proline accumulation and metabolism are associated with mechanisms of abiotic stress avoidance in plants, which generally improve osmotic stress tolerance. In the research, the free proline content of each strain was measured under drought stress, and the result showed that there was no significant difference in all lines under normal culture (0 h) while the accumulates significantly highest proline by 12 h. Moreover, CpADC-OE-7 and CpADC-OE-4 had significantly higher proline content than WT (Figure 4C). These results suggested that under drought stress, transgenic strains were more drought tolerant than WT. Thus, these results support that CpADC gene played a role in drought stress response.

3. Discussion

With the reports of related studies, the main metabolic and regulatory pathways of polyamines have been basically revealed. Genes-encoded metabolic regulatory enzymes of polyamine biosynthesis in plants have been identified [30]. Its biosynthetic metabolic pathway has received much attention [31], and spermidine decarboxylase (ADC) is one of the key enzymes in the synthesis of plant polyamines, and putrescine (Put) is produced by spermidine decarboxylase catalyzing the synthesis of herring spermine followed by conversion [7,32]. Based on the current research progress, the physiological mechanism of PAs to improve plant drought resistance may be based on the following aspects: PAs can eliminate the active oxygen free radicals, reduce the degree of membrane lipid peroxidation, and protect the plasma membrane and biological macromolecules from damage by affecting the activities of nucleases and proteases, especially the protective enzymes; Secondly, PAs can also be used as an osmotic regulator to regulate the content of osmotic regulating substances, reduce the osmotic potential and enhance the water absorption [33]. However, thus far, little information is available on the ADC gene in cherries. In this study, we have cloned the coding sequences of the CpADC gene in ‘Manaohong’ cherry, which was the first cloned PAs-related synthase gene in this species. Phylogenetic analysis showed that the CpADC had more homologous to ADC from sweet cherries and peaches, partially reflecting the close genetic relationship between sweet cherries and peaches, suggesting that the gene is highly conserved among fruit plants. The highest expression of CpADC was found in ripe fruit and flowers, followed by flower buds and roots, while the lowest expression was found in leaves and stems. Tissue-specific analysis suggests that this gene may be widely involved in the growth and development of the ‘Manaohong’ cherry and may have an important role in fruit ripening development.
The ADC carried out the production of agmatine from arginine, which was the precursor of the first PA known as putrescine; Subsequently, putrescine was turned into the higher PAs, spermidine and spermine [34]. Previous studies had proposed that the different functions of PAs in plants were associated with differential activation of the Put biosynthetic pathway catalyzed by ADC [35]. The study suggested that the same enzyme (ADC) could play different roles depending on its subcellular localization, e.g., the chloroplastic ADC form could be involved in photosynthesis, whereas the nuclear ADC form could play a role in cellular signalling [36]. In Arabidopsis thaliana, PA production occurred only from arginine, and this step was initiated by two ADC paralogues, AtADC1 and AtADC2 [37]. Similarly, subcellular localization resulted in this research showed that the fusion expression vector GFP fluorescent protein material was present in the nucleus, confirming that the metabolites of the CpADC gene were expressed in the nucleus, i. e., that the ADC protein acts mainly in the nucleus, which validated that the CpADC gene functions mainly by the ADC pathway in transgenic Arabidopsis. Furthermore, ADC localization in the nucleus somehow suggested that CpADC might function as a regulator for gene expression. The same implication was also documented in mustard [10].
Pas, as a class of very potent bioactive substances, were closely related to plant physiological activities, such as participation in plant growth and development and physiological stress responses [38]. Current research on PAs focuses on Put, Spd and Spm, and the levels of different endogenous PAs and the conversion between them had positive physiological functions in plant stress responses. Increased levels of endogenous Put, Spd and Spm were an adaptive response of plants to adversity, and the conversion ability of Put to Spd and Spm became an indicator of plant tolerance to multiple stresses [5]. Previous study using oat ADC transgenic genetic transformation of rice found that overexpression of this gene increased plant drought resistance under drought conditions [15]. Overexpression of AtADC2 and increased Put content also improved drought resistance in Arabidopsis by inducing stomatal closure to reduce water loss [13], and citrus Overexpression of PtADC promoted Put synthesis in Arabidopsis adc2 mutants [39]. Additionally, there was a study treated wheat seedlings with 0.5 MPa polyethylene glycol (PEG) 6000 for 7 d and found a significant increase in free Spd and Spm content in drought-tolerant wheat leaves, while only Put content increased in sensitive wheat leaves [40]). The overexpressed and genetically transformed the PtADC gene in citrus, which improved the drought and cold resistance of the transgenic plants in addition to the dwarfism exhibited by the transgenic strains [41], and overexpression of the MdADC gene in apple improved the resistance to biotic stresses such as drought, low-temperature tolerance and salt resistance in tobacco when using drought, low temperature and salt stress treatments [42].
Similarly, in the present study, Arabidopsis thaliana was genetically modified using overexpression of the CpADC gene and showed higher levels of putrescine than the WT under drought stress. Measurement of ADC activity by ELISA different treatments revealed that the transgenic Arabidopsis had higher ADC activity than that of the WT and showed a positive correlation with the putrescine accumulation. Thus, these results showed that under drought stress (PEG simulation), the transgenic plants accumulated putrescine rapidly within a short period of time, and the ADC activity was enhanced to participate in the plant’s stress resistance response.
MDA is the final reaction product of membrane lipid peroxidation in plants. The amount of MDA content was usually used as an indicator of membrane lipid peroxidation, which can reflect the degree of stress tolerance in plants [43]. MDA variation analysis showed that the increase in MDA content in the transgenic strains was not as pronounced as in the wild type (Figure 4B), and the cell membrane system was less disrupted in the strains with high expression of the transgene than in those with low expression, which promoted the drought tolerance of Arabidopsis thaliana. Furthermore, in plants, Pro is one of the high protein fractions of plants. Its accumulation changes significantly when subjected to adversity stress, and the accumulation of proline is closely related to plant stress resistance [44]. Pro variation analysis showed a significant increase in Pro content in the transgenic Arabidopsis compared to the WT and that the CpADC gene plays a role in drought stress responses.
In conclusion, we have cloned the coding sequence of the ‘Manaohong’ cherry CpADC gene, the first cloned ADC in this species. Our results reveal that, under drought stress, increased expression of CpADC gene and Put accumulation regulates the activity of ADC, MDA and Pro content to enhance the drought resistance in Arabidopsis thaliana.

4. Materials and Methods

4.1. Plant Materials Growth Conditions and Drought Stress Treatment

Materials used in the experiment were 5-year-old cherry plants in a public orchard in Nayong (26°77′ N; 105°38′ E), which is in the Northwest of Guizhou province, China. The different tissues: roots, stems, leaves, flower buds, flowers, first fruits (35 days after full bloom), expanded fruits (45 days after full bloom) and mature fruits (55 days after full bloom) were collected for the gene clone and expression respectively of the cherry ADC gene from January to April in 2021.
The plants of wild-type (WT) Arabidopsis thaliana and CpADC-OE transgenic lines were grown in an artificial climate chamber for 30 d under conditions of 23 °C, with 16 h of light/8 h of darkness and 65–75% relative humidity. Plants with uniform and healthy growth were selected for drought stress treatment, and physiological parameters were measured. Drought stress treatment: After watering the plant with the same amount of water (maintaining the same water potential, all plant lines were planted with the same soil weight and area), we used 20% polyethylene glycol to simulate the drought treatment: The leaves were collected at 0 h, 6 h, 12 h, 24 h and 48 h stress treatments, flash-frozen in liquid nitrogen and stored in an ultra-low temperature refrigerator.

4.2. Cloning of CpADC Cording Sequence

Total RNA in the leaves was extracted by polysaccharide polyphenol plant kit (SENO, Zhangjiakou, China) according to the manufacturer’s instructions, and the first strand of cDNA was synthesized using a PrimeScript RT reagent Kit with gDNA Eraser (TaKaRa, Beijing, China) according to the manufacturer’s protocol. Based on the ADC EST sequences from the cherry transcriptome data, the upstream and downstream primers CpADC-F1/ CpADC-R1 (Table 1) were designed respectively by Primer 5.0 software. They were synthesized by Sangon Biotech Company (Shanghai, China). The total reaction volume of RT–PCRs was 10 μL: 5 μL of PreMix (Tiangen, Wuhan, China), 2 μL of template cDNA, 2 μL of ddH2O, and 5 μL of reverse and forward primers (10 μmol L−1). The PCR program included an initial denaturation step at 95 °C for 10 s, followed by 35 cycles of 5 s at 95 °C, and annealing and extension at 58 °C for 30 s. The PCR product was detected on a 1% agarose gel with GoldView (10,000×) (Solarbio, Beijing, China) staining, imaging under the SYNGENE G: Box system (Syngene, Shanghai, China) and was recovered using Takara MiniBest Agarose Gel DNA Extraction Kit (9762) gel recovery kit. The recovered product was directly connected to the pEASY-Blunt cloning vector, and the total volume of the ligation system was 5 μL containing 1.0 μL pEASY-Blunt cloning Vector and 4.0 μL PCR product. After transfection for 15–25 min at 37 °C, Trans1-T1 competent cells were transformed and plated on ampicillin-containing plates for 16–20 h at 37 °C. After incubation with LB liquid, the clones were identified by PCR as positive clones and then sequenced by Industrial Bioengineering Co., Ltd. (Shanghai, China).

4.3. Sequence Analysis of CpADC

The amino acid sequence of the ADC gene was deduced and compared using NCBI BLAST server (http://www.banana-genome.cirad.fr/blast, accessed on 10 April 2021), and the nucleic acid and amino acid sequence of the enzyme gene was uploaded to GenBank by Sequin. The molecular weights (kDa) and isoelectric points (pI) of the CpADC proteins were predicted using the ProParam tool (http://www.expasy.ch/tools/pitool.html, accessed on 10 April 2021). Multiple sequence alignments and Cluster analysis were performed using the Clustal W software (MEGA 7.0), combined with ADC gene sequences from other plants in GenBank. The phylogenetic tree was constructed using MEGA 6.0 software by the Neighbor-joining tree method.

4.4. Subcellular Localization of CpADC Protein

Primer ADC-F2, and ADC-R2 (Table 1) were designed with the first strand of cherry cDNA as a template, and the amplified target fragment was recovered by gel. After detection, the termination code was removed and ligated into the expression vector pBWA (V) HS-GLosgfp, 10 μL of E. coli competent DH5α was cultured overnight, the colony PCR was performed, sequenced and the plasmids were extracted for later use. Agrobacterium competent cell GV3101 was taken out, placed on ice for plasmid transformation, added liquid LB medium 600 μL, and cultured with shaking for 3 h (temperature 28 °C, shaker speed 150 r·min−1); The cells were collected by centrifugation at room temperature, resuspended the bacterial liquid, and evenly spread on a solid LB plate containing 50 mg·L−1 kanamycin (Kan) and 100 mg·L−1 rifampicin (Rif), and placed incubate at 28 °C for 48 h. The monoclonal strains were picked up in 1 mL LB liquid medium and cultured with shaking at 28–30 °C for 24 h. Transfer 1 mL of Agrobacterium cultured overnight to 25 mL LB liquid medium with 50 mg·L−1 Kan and 100 mg·L−1 Rif, and then add 2 µL of 100 mmol·L−1 acetyl Syringone (AS) and 100 µL 0.5 mol·L−1 MES were cultured in a shaker at 28 °C. The cells were collected by centrifugation at room temperature. Resuspend the bacteria in LB medium containing 10 mmol·L−1 MgCl2, add 2 μL 100 mmol·L−1 AS per ml of bacterial solution, and let stand for more than 3 h. For the tobacco leaves that were taken in the growing period, pierce some small holes on the reverse side of the leaves with a needle, put the infection solution into a 5 mL syringe, pressed the reverse side of the syringe with your thumb to inject the liquid from the lower surface of the leaves into the tobacco leaves. Cultured in the dark for 72 h, the leaf epidermis was removed, and the fluorescence signal was detected by a laser confocal fluorescence microscope (EVOS700, China). The parameters are as follows: chlorophyll fluorescence excitation light at 560 nm, and emission light at 650 nm; Green fluorescent protein (GFP) excites light at 488 nm, and emits light at 510 nm; The nuclear marker fusion fluorescent protein excites light at 561 nm, and emits light at 580 nm.

4.5. Analysis of CpADC Gene Expression by Quantitative Real-Time PCR (qRT-PCR)

Based on CpADC gene sequence, the primer pairs were designed for qRT-PCR listed in Table 1 (ADC-qF/ADC-qR). The PCR reaction consisted of 5 µL of 2 × SYBR Green PCR Master Mix (TaKaRa), 0.5 μL primers, 1 μL cDNA template of different tissues which contained roots, stems, leaves, flower buds, flowers, first fruits (35 days after full bloom), expanded fruits (45 days after full bloom) and mature fruits (55 days after full bloom), and 3 μL ddH2O up to the total volume of 10 µL. The qRT-PCR amplification was performed by an initial denaturation step at 95 °C for 30 s, followed by 40 cycles of 5 s at 95 °C, and annealing and extension at 60 °C for 30 s. The EF gene (Table 1) was selected as a reference gene as per the previous report [45]. Transcript abundance was normalized against the reference gene and the relative gene expression was calculated using the 2−ΔΔCt method using the CFX Connect™ Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA).

4.6. Generation of Transgenic Plants Arabidopsis thaliana by Agrobacterium Tumefaciens Mediated Transformation

CpADC cDNA was amplified with specific primers (CpADC-cF/CpADC-cR) containing BsaI or BsmBI restriction sites. The CpADC target fragment was constructed on the expression vector pBWA(V)KS-GUS that 35 s promoter driven by the seamless cloning method (Table 1), and the successful construction of the plant expression vector pBWA(V)KS-ADC-GUS was verified by the PCR product. The newly constructed pBWA(V)KS-ADC-GUS plant expression vector was transferred into A. tumefaciens strain GV1301 by heat shock. Later, the overexpression vector was used for the transformation of Arabidopsis thaliana by floral dip by Agrobacterium-mediated transformation [46]. The Arabidopsis thaliana seeds received after infection were vernalized for 2–3 days at 4 °C, and sterilized with 75% ethanol and 10% sodium hypochlorite for 30 s and 8–10 min in a sterile environment, respectively. After washing with aseptic water 3–5 times, evenly the sterilized seeds were sprinkled on the medium (MS + 50 mg/L Timentin + 50 mg/L Kanamycin) containing resistant hormones and cultivated for 10–14 days in an artificial climate box at 23 °C under 16 h light/8 h dark conditions. GUS identification of the grow-up transgenic Arabidopsis leaves was performed using the Plant Tissue GUS Staining Kit, following the kit method, as the Arabidopsis seedlings grew to about 30 d. The Arabidopsis genomic DNA identified by GUS was then extracted using the new Plant Genomic DNA Extraction Kit (Tiangen, Wuhan, China) according to the instructions, and specific primers (Table 1, CpADC-JF/CpADC-JR) were designed for positive PCR identification. The PCR reaction system and procedure are the same as described above for the CpADC gene cloning.

4.7. Quantification of Free Polyamine Content

Free PAs were analyzed by high-performance liquid chromatography (Waters e2695, Guizhou, China) separation of benzoyl chloride-derivatized PAs. The material handling and derivatization reactions were referenced by Zhang, et al. (2020) [32]. Grind 0.2 g plant leaves with liquid nitrogen, add the ground powder to the centrifuge tube of 2 mL, add precooled 5% perchloric acid 1.5 mL, vortex mix, and put it in a refrigerator at 4 °C or ice for 1 h. 30 min was centrifuged by 5000× g at 4 °C, and the supernatant of 1 mL was prepared (stored at 4 °C). Then the supernatant of 1 mL was added to the 10 mL centrifuge tube, 10 µL benzoyl chloride was added to it, and then 1 mL 2 mol/L NaOH solution was added for 20 s. After bathing at 37 °C for 30 min, adding 2 mL saturated NaCl solution, mixing and adding 2 mL ether to extract, and shaking violently. 6000× g centrifugation for 5 min, 1 mL ether phase was placed in a 2 mL centrifuge tube, dried with nitrogen, then resuspended with 1 mL ether, and dried again with nitrogen. After adding 500 µL 60% methanol vortex to dissolve, the 0.22 µm filter membrane was filtered into the inner lining tube and placed in the brown injection bottle to be tested.

4.8. Arginine Decarboxylase Activity Determination, MDA and Pro Content Measurement

The activity of ADC is determined by enzyme-linked immunosorbent assay (ELISA). The pre-grinded sample was weighed and added to 0.1 mM, pH7.4 phosphate buffer pre-cooled to 4 °C (Phosphate buffered saline, PBS), homogenized according to the weight and volume of 1:9. It was then added to the glass homogenizer for manual grinding, extracted for 2 h at 4 °C, centrifuge at 3000 r for 5 min to take the supernatant for use. Then we followed the instructions that came with the kit.
For the determination of malondialdehyde (MDA) and proline (Pro) content, we followed the relevant kit (Suzhou Comin Biotechnology Co., Ltd., Suzhou, China) instructions for the experiment. Additionally, for all the leaves used for biochemical analysis, a fourth leaf from the transgenic Arabidopsis plant was taken, and biological replicates were performed.

4.9. Statistical Analysis

All data reported in the experiment were assessed using Duncan and Tukey test at significantly different levels with the SPSS 21.0 statistics package (Chicago, IL, USA). All the presented data are the means and standard deviations (SDs) of at least three replicates. The graphs were constructed with Excel and Origin 9.0 (Origin Lab, Northampton, MA, USA).

5. Conclusions

In conclusion, the coding sequence of the ‘Manaohong’ cherry CpADC gene has been cloned, the first cloned ADC in this species. Phylogenetic analysis showed that the CpADC had more homologous to ADC from sweet cherries and peaches, partially reflecting the close genetic relationship between sweet cherries and peaches, suggesting that the gene is highly conserved among fruit plants. The highest expression of CpADC was found in ripe fruit and flowers, followed by flower buds and roots, while the lowest expression was found in leaves and stems. Tissue-specific analysis suggests that this gene may be widely involved in the growth and development of the ‘Manaohong’ cherry and may have an important role in fruit ripening development. subcellular localization resulted in this research showed that the fusion expression vector GFP fluorescent protein material was present in the nucleus, confirming that the metabolites of the CpADC gene were expressed in the nucleus, i.e., that the ADC protein acts mainly in the nucleus, which validated that the CpADC gene functions mainly by the ADC pathway in transgenic Arabidopsis. Measurement of ADC activity by ELISA different treatments revealed that the transgenic Arabidopsis had higher ADC activity than that of the WT and showed a positive correlation with the putrescine accumulation. Thus, these results showed that under drought stress (PEG simulation), the transgenic plants were able to accumulate putrescine rapidly within a short period of time, and the ADC activity was enhanced to participate in the plant’s stress resistance response. MDA variation analysis showed that the increase in MDA content in the transgenic strains was not as pronounced as in the wild type. Pro variation analysis showed a significant increase in Pro content in the transgenic Arabidopsis compared to the WT and that the CpADC gene plays a role in drought stress responses. Thus, these results reveal that, under drought stress, increased expression of CpADC gene and Put accumulation regulates the activity of ADC, MDA and Pro content to enhance the drought resistance in Arabidopsis thaliana.

Author Contributions

Conceived and designed the experiment: G.Q. and J.R.; Performed the experiments: J.R., C.S., L.M., S.L. and T.T. Analyzed the data: J.R. and C.S.; Wrote the manuscript: J.R. and G.Q. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (32160700), the key project of Guizhou Provincial Department of Education (Qiankehe[2021]038) and the Guizhou Provincial Science and Technology Projects ([2020] 1Y114 and [2021] Yiban231).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Rastogi, R.; Dulson, J.; Rothstein, S.J. Cloning of tomato (Lycopersicon esculentum Mill.) arginine decarboxylase gene and its expression during fruit ripening. Plant Physiol. 1993, 103, 829–834. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Berberich, T.; Takahashi, Y.; Kusano, T.; Yamaguchi, K. Advances in polyamine research in 2007. J. Plant Res. 2007, 120, 345–350. [Google Scholar] [CrossRef]
  3. Groppa, M.D.; Benavides, M.P. Polyamines and abiotic stress: Recent advances Review Article. Amino Acids 2008, 34, 35–45. [Google Scholar] [CrossRef]
  4. Sarfraz, S.; Ali, M.; Ahmad, M.; Siddique, K.H.M. Polyamines: Natural and engineered abiotic and biotic stress tolerance in plants. Biotechnol. Adv. 2011, 29, 300–311. [Google Scholar] [CrossRef]
  5. Chen, D.; Shao, Q.; Yin, L.; Younis, A.; Zheng, B. Polyamine function in plants: Metabolism, regulation on development, and roles in abiotic stress responses. Front. Plant Sci. 2019, 9, 1–13. [Google Scholar] [CrossRef] [PubMed]
  6. Walden, K.; Robertson, H.M. Letter to the Editor: Ancient DNA from Amber Fossil Bees? Mol. Biol. Evol. 1997, 14, 1075–1077. [Google Scholar] [CrossRef] [Green Version]
  7. Liu, J.; Nada, K.; Pang, X.; Honda, C.; Kitashiba, H.; Moriguchi, T. Role of polyamines in peach fruit development and storage. Tree Physiol. 2006, 26, 791–798. [Google Scholar] [CrossRef] [Green Version]
  8. Fu, Y.; Guo, C.; Wu, H.; Chen, C. Arginine decarboxylase ADC2 enhances salt tolerance through increasing ROS scavenging enzyme activity in Arabidopsis thaliana. Plant Growth Regul. 2017, 83, 253–263. [Google Scholar] [CrossRef]
  9. Lenis, Y.Y.; Elmetwally, M.A.; Maldonado-estrada, J.G.; Bazer, F.W. Physiological importance of polyamines 3. Zygote 2017, 25, 244–255. [Google Scholar] [CrossRef]
  10. Mo, H.; Pua, E.C. Up-regulation of arginine decarboxylase gene expression and accumulation of polyamines in mustard (Brassica juncea) in response to stress. Physiol. Plant. 2002, 114, 439–449. [Google Scholar] [CrossRef]
  11. Yin, X.; Yang, Y.; Lv, Y.; Li, Y.; Yang, D.; Yue, Y.; Yang, Y. BrrICE1.1 is associated with putrescine synthesis through regulation of the arginine decarboxylase gene in freezing tolerance of turnip (Brassica rapa var. rapa). BMC Plant Biol. 2020, 20, 1–16. [Google Scholar] [CrossRef] [PubMed]
  12. Hao, Y.J.; Kitashiba, H.; Honda, C.; Nada, K.; Moriguchi, T. Expression of arginine decarboxylase and ornithine decarboxylase genes in apple cells and stressed shoots. J. Exp. Bot. 2005, 56, 1105–1115. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Alcázar, R.; Altabella, T.; Marco, F.; Bortolotti, C.; Reymond, M.; Koncz, C.; Carrasco, P.; Tiburcio, A.F. Polyamines: Molecules with regulatory functions in plant abiotic stress tolerance. Planta 2010, 231, 1237–1249. [Google Scholar] [CrossRef]
  14. Liu, J.H.; Nada, K.; Honda, C.; Kitashiba, H.; Wen, X.P.; Pang, X.M.; Moriguchi, T. Polyamine biosynthesis of apple callus under salt stress: Importance of the arginine decarboxylase pathway in stress response. J. Exp. Bot. 2006, 57, 2589–2599. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Capell, T.; Bassie, L.; Christou, P. Modulation of the polyamine biosynthetic pathway in transgenic rice confers tolerance to drought stress. Proc. Natl. Acad. Sci. USA 2004, 101, 9909–9914. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Roy, M.; Wu, R. Arginine decarboxylase transgene expression and analysis of environmental stress tolerance in transgenic rice. Plant Sci. 2001, 160, 869–875. [Google Scholar] [CrossRef] [PubMed]
  17. Kou, S.; Chen, L.; Tu, W.; Scossa, F.; Wang, Y.; Liu, J.; Fernie, A.R.; Song, B.; Xie, C. The arginine decarboxylase gene ADC1, associated to the putrescine pathway, plays an important role in potato cold-acclimated freezing tolerance as revealed by transcriptome and metabolome analyses. Plant J. 2018, 96, 1283–1298. [Google Scholar] [CrossRef] [Green Version]
  18. Thomas, S.; Krishna, G.K.; Yadav, P.; Pal, M. Cloning and abiotic stress responsive expression analysis of arginine decarboxylase genes in contrasting rice genotypes. Indian J. Genet. Plant Breed 2019, 79, 411–419. [Google Scholar] [CrossRef]
  19. Song, C.M.; Wen, X.P. Using ISSR Marker to Explore the Origin of Guizhou Local Cherry (Prunus pseudocerasus Lindl. “Manaohong”). J. Beijing For. Univ. 2011, 33, 94–97. [Google Scholar]
  20. Chen, Z.Y.; Zheng, Y.H.; Xu, F.J. Breeding of a new early-maturing cherry (Prunus pseudocerasus Lindl) variety Manaohong. China Fruits 2013, 1, 8–10, 187. [Google Scholar]
  21. Tian, T.; Qiao, G.; Deng, B.; Wen, Z.; Hong, Y.; Wen, X. The effects of rain shelter coverings on the vegetative growth and fruit characteristics of Chinese cherry (Prunus pseudocerasus Lindl.). Sci. Hortic. 2019, 254, 228–235. [Google Scholar] [CrossRef]
  22. Wu, M.; Tian, T.; Liu, H.; Zhang, H.; Qiu, Z.; Qiao, G.; Wen, X. Shelter covering altered polyamines accumulation of cherry (Prunus pseudocerasus Lindl.) via elevating the expression of spermidine synthase (SPDS) gene. Sci. Hortic. 2020, 270, 109440. [Google Scholar] [CrossRef]
  23. Schmitz-Eiberger, M.A.; Blanke, M.M. Bioactive components in forced sweet cherry fruit (Prunus avium L.), antioxidative capacity and allergenic potential as dependent on cultivation under cover. LWT Food Sci. Technol. 2012, 46, 388–392. [Google Scholar] [CrossRef]
  24. Jin, L.F.; Guo, D.Y.; Ning, D.Y.; Hussain, S.B.; Liu, Y.Z. Covering the trees of Kinokuni tangerine with plastic film during fruit ripening improves sweetness and alters the metabolism of cell wall components. Acta Physiol. Plant. 2018, 40, 1–10. [Google Scholar] [CrossRef]
  25. Movahed, N.; Eshghi, S.; Jamali, B. Effects of polyamines on vegetative characteristics, growth, flowering and yield of strawberry (’Paros’ and’ Selva’). Acta Hortic. 2012, 926, 287–294. [Google Scholar] [CrossRef]
  26. Yariuchi, Y.; Okamoto, T.; Noutoshi, Y.; Takahashi, T. Responses of Polyamine-Metabolic Genes to Polyamines and Plant Stress Hormones in Arabidopsis Seedlings. Cells 2021, 10, 3283. [Google Scholar] [CrossRef]
  27. Hosseini, M.S.; Samsampour, D.; Zahedi, S.M.; Zamanian, K.; Rahman, M.M.; Mostofa, M.G.; Tran, L.P. Melatonin alleviates drought impact on growth and essential oil yield of lemon verbena by enhancing antioxidant responses, mineral balance, and abscisic acid content. Physiol Plant. 2021, 172, 1363–1375. [Google Scholar] [CrossRef]
  28. Zahedi, S.M.; Hosseini, M.S.; Naghmeh, D.H.M.; Abadia, J.; Germ, M.; Gholami, R.; Abdelrahman, M. Evaluation of drought tolerance in three commercial pomegranate cultivars using photosynthetic pigments, yield parameters and biochemical traits as biomarkers. Agric. Water Manag. 2022, 261, 107357. [Google Scholar] [CrossRef]
  29. Gholami, R.; Fahadi Hoveizeh, N.; Zahedi, S.M.; Gholami, H.; Carillo, P. Effect of three water-regimes on morpho-physiological, biochemical and yield responses of local and foreign olive cultivars under field conditions. BMC Plant Biol. 2022, 22, 477. [Google Scholar] [CrossRef]
  30. Takahashi, Y.; Uemura, T.; Teshima, Y. Polyamine oxidase 2 is involved in regulating excess spermidine contents during seed germination and early seedling development in Arabidopsis thaliana. Biochem. Biophys. Res. Commun. 2019, 516, 1248–1251. [Google Scholar] [CrossRef]
  31. Zhang, Q.X.; Xu, J.G.; Bao, M.Y.; Liu, M.M.; Xie, A.Q.; Zhang, D.L.; Sun, X. Effect of waterlogging stress on root morphology and in vivo polyamine content of Paeonia lactiflora. J. Plant Physiol. 2020, 56, 1445–1457. [Google Scholar]
  32. Shi, H.T.; Chan, Z.L. Improvement of plant abiotic stress tolerance through modulation of the polyamine pathway. J. Integr. Plant Biol. 2014, 56, 114–121. [Google Scholar] [CrossRef] [PubMed]
  33. Shaddad, M.; EI-Samad, M.; Mohammed, H.T. Interactive Effects of Drought Stress and Phytohormones or Polyamines on Growth and Yield of Two M (Zea maize L.) Genotypes. Am. J. Plant Sci. 2011, 2, 790–807. [Google Scholar] [CrossRef]
  34. Mattoo, A.K.; Handa, A.K. Higher polyamines restore and enhance metabolic memory in ripening fruit. Plant Sci. 2008, 174, 386–393. [Google Scholar] [CrossRef]
  35. Vuosku, J.; Karppinen, K.; Muilu-Mäkelä, R.; Kusano, T.; Sagor, G.H.M.; Avia, K.; Alakärppä, E.; Kestilä, J.; Suokas, M.; Nickolov, K.; et al. Scots pine aminopropyltransferases shed new light on evolution of the polyamine biosynthesis pathway in seed plants. Ann. Bot. 2018, 121, 1243–1256. [Google Scholar] [CrossRef] [Green Version]
  36. Bortolotti, C.; Cordeiro, A.; Alcázar, R.; Borrell, A.; Culiañez-Macià, F.A.; Tiburcio, A.F.; Altabella, T. Localization of arginine decarboxylase in tobacco plants. Physiol. Plant. 2004, 120, 84–92. [Google Scholar] [CrossRef]
  37. Maruri-López, I.; Jiménez-Bremont, J.F. Hetero- and homodimerization of Arabidopsis thaliana arginine decarboxylase AtADC1 and AtADC2. Biochem. Biophys. Res. Commun. 2017, 484, 508–513. [Google Scholar] [CrossRef]
  38. Sánchez-Rangel, D.; Chávez-Martínez, A.I.; Rodríguez-Hernández, A.A.; Maruri-López, I.; Urano, K.; Shinozaki, K.; Jiménez-Bremont, J.F. Simultaneous silencing of two arginine decarboxylase genes alters development in arabidopsis. Front. Plant Sci. 2016, 7, 1–13. [Google Scholar] [CrossRef] [Green Version]
  39. Wang, J.; Sun, P.P.; Chen, C.L.; Wang, Y.; Fu, X.Z.; Liu, J.H. An arginine decarboxylase gene PtADC from Poncirus trifoliata confers abiotic stress tolerance and promotes primary root growth in Arabidopsis. J. Exp. Bot. 2011, 62, 2899–2914. [Google Scholar] [CrossRef] [PubMed]
  40. Liu, H.P.; Dong, B.H.; Zhang, Y.Y.; Liu, Z.P.; Liu, Y.L. Relationship between osmotic stress and the levels of free, conjugated and bound polyamines in leaves of wheat seedlings. Plant Sci. 2004, 166, 1261–1267. [Google Scholar] [CrossRef]
  41. Wang, J. Cloning and Characterization of Two Polyamine Biosynthesis Genes and Changes in Polyamines Under Abiotic Stresses in Citrus Plants. Ph.D. Thesis, Huazhong Agricultural University, Wuhan, China, 2009. [Google Scholar]
  42. Wang, B.Q.; Zhang, X.N.; Li, G.H. Study of tomato dwarfism and late flowering due to overexpression of the PpADC gene in peach trees. Henan Agric. Sci. 2020, 49, 101–107. [Google Scholar]
  43. Del Rio, D.; Stewart, A.J.; Pellegrini, N. A review of recent studies on malondialdehyde as toxic molecule and biological marker of oxidative stress. Nutr. Metab. Cardiovasc. Dis. 2005, 15, 316–328. [Google Scholar] [CrossRef] [PubMed]
  44. Furlan, A.L.; Bianucci, E.; Giordano, W.; Castro, S.; Becker, D.F. Proline metabolic dynamics and implications in drought tolerance of peanut plants. Plant Physiol. Biochem. 2020, 151, 566–578. [Google Scholar] [CrossRef] [PubMed]
  45. Shen, T.; Wen, X.; Wen, Z.; Qiu, Z.; Hou, Q.; Li, Z.; Mei, L.; Yu, H.; Qiao, G. Genome-wide identification and expression analysis of bHLH transcription factor family in response to cold stress in sweet cherry (Prunus avium L.). Sci. Hortic. 2021, 279, 109905. [Google Scholar] [CrossRef]
  46. Ghedira, R.; De Buck, S.; Nolf, J.; Depicker, A. The efficiency of Arabidopsis thaliana floral dip transformation is determined not only by the Agrobacterium strain used but also by the physiology and the ecotype of the dipped plant. Mol. Plant-Microbe Interact. 2013, 26, 823–832. [Google Scholar] [CrossRef]
Ijms 23 14943 g001 550
Figure 1. Obtaining of CpADC and its analysis. (A) Cloning of CpADC cDNA sequence from the leaves of cherry. Note: M: DL 2000 DNA marker; 1–4: CpADC Target fragment (B) Phylogenetic analysis of CpADC. (C) Tissue-specific expression of CpADC gene in cherry tissues by real-time quantitative PCR. Note: Different letters are used to indicate means that differ significantly (p ≤ 0.05); the same blow (D). Subcellular localization analysis of CpADC, which is localized in the nucleus in N. benthamian Tobacco leaves. Note: Respectively, from left to right: GFP fluorescence (green), nucleus fluorescence (red), merged images (green and red) and bright-field chloroplast images are shown. Scale bars = 10 μm.
Figure 1. Obtaining of CpADC and its analysis. (A) Cloning of CpADC cDNA sequence from the leaves of cherry. Note: M: DL 2000 DNA marker; 1–4: CpADC Target fragment (B) Phylogenetic analysis of CpADC. (C) Tissue-specific expression of CpADC gene in cherry tissues by real-time quantitative PCR. Note: Different letters are used to indicate means that differ significantly (p ≤ 0.05); the same blow (D). Subcellular localization analysis of CpADC, which is localized in the nucleus in N. benthamian Tobacco leaves. Note: Respectively, from left to right: GFP fluorescence (green), nucleus fluorescence (red), merged images (green and red) and bright-field chloroplast images are shown. Scale bars = 10 μm.
Ijms 23 14943 g001
Ijms 23 14943 g002 550
Figure 2. Identification and expression analysis of transgenic strains (A) The histochemical staining of GUS from the transgenic plants. Note: a: WT; b,c,d: transgenic Arabidopsis plant. Scale bars = 2 mm (B) DNA detection of T1 generation of transgenic Arabidopsis plant. Note: M: DL 2000 DNA Marker; -: H2O, +: recombinant vector plasmid, #1–#9: transgenic Arabidopsis plant lines. (C) Expression analysis of CpADC in nice transgenic lines by qRT-PCR. #1–#9: transgenic Arabidopsis plant lines; Note: Different lowercase letters are used to indicate means that differ significantly (p ≤ 0.05), WT: Colombia wild type Arabidopsis.
Figure 2. Identification and expression analysis of transgenic strains (A) The histochemical staining of GUS from the transgenic plants. Note: a: WT; b,c,d: transgenic Arabidopsis plant. Scale bars = 2 mm (B) DNA detection of T1 generation of transgenic Arabidopsis plant. Note: M: DL 2000 DNA Marker; -: H2O, +: recombinant vector plasmid, #1–#9: transgenic Arabidopsis plant lines. (C) Expression analysis of CpADC in nice transgenic lines by qRT-PCR. #1–#9: transgenic Arabidopsis plant lines; Note: Different lowercase letters are used to indicate means that differ significantly (p ≤ 0.05), WT: Colombia wild type Arabidopsis.
Ijms 23 14943 g002
Ijms 23 14943 g003 550
Figure 3. PAs content in 30 d leves of WT, CpADC-OE-4 and CpADC-OE-7. (A) Free putrescine content. (B) Free spermidine content. (C) Free spermine content. Values are means of three biological replicates. Note: Different lowercase letters are used to indicate means that differ significantly (p ≤ 0.05); (D,E) Arabidopsis lines before and after drought treatment, respectively.
Figure 3. PAs content in 30 d leves of WT, CpADC-OE-4 and CpADC-OE-7. (A) Free putrescine content. (B) Free spermidine content. (C) Free spermine content. Values are means of three biological replicates. Note: Different lowercase letters are used to indicate means that differ significantly (p ≤ 0.05); (D,E) Arabidopsis lines before and after drought treatment, respectively.
Ijms 23 14943 g003
Ijms 23 14943 g004 550
Figure 4. Determination of physiological parameters of transgenic lines and WT. (A) ADC activity in WT, CpADC-OE-4 and CpADC-OE-7. (B) MDA contents in WT, CpADC-OE-4 and CpADC-OE-7. (C) Proline content in WT, CpADC-OE-4 and CpADC-OE-7. Note: Different lowercase letters are used to indicate means that differ significantly (p ≤ 0.05).
Figure 4. Determination of physiological parameters of transgenic lines and WT. (A) ADC activity in WT, CpADC-OE-4 and CpADC-OE-7. (B) MDA contents in WT, CpADC-OE-4 and CpADC-OE-7. (C) Proline content in WT, CpADC-OE-4 and CpADC-OE-7. Note: Different lowercase letters are used to indicate means that differ significantly (p ≤ 0.05).
Ijms 23 14943 g004
Table
Table 1. The sequences of primers used for CpADC cloning, its expression quantification and so on.
Table 1. The sequences of primers used for CpADC cloning, its expression quantification and so on.
Primer NamePrimer SequencePurpose
CpADC-F1GCCAGCCATTACAAACTCACAAClone for CpADC
CpADC-R1TAGAAGAGGCGGGAATAGGG
CpADC-F2CAGTCGTCTCACAACATGCCGGCCCTGGCTTGTTGSubcellular localization of CpADC protein
CpADC-R2CAGTCGTCTCATACAAGCACAGCAGTAAGACCACT
CpADC-qFAGACGTTCCCAATAGTCCCGAqRT-PCR for CpADC
CpADC-qRTGATAAGCCCCGCCCAAG
CpADC-cFCAGTCGTCTCACAACATGCCGGCCCTGGCTTGTTGConstructing plant expression vector
CpADC-cRCAGTCGTCTCATACATCAAGCACAGCAGTAAGACC
EF-FTGAGAGGCTGACTGTGCTGTTCInternal reference gene for qRT-PCR
EF-RGGAGTAGTGGCATCCATCTTGTT
CpADC-JFCCCACCCACGAGGAGCATCharacterization of transgenic Agrobacterium tumefaciens
CpADC-JRGCGAGCAAACAGAGCCAGAG
At-action7-FAGCTAGAGACAGCCAAGAGCInternal reference gene for transgenic line qRT-PCR
At-action7-RGCTTCCATTCCGATGAGCGA
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Ran, J.; Shang, C.; Mei, L.; Li, S.; Tian, T.; Qiao, G. Overexpression of CpADC from Chinese Cherry (Cerasus pseudocerasus Lindl. ‘Manaohong’) Promotes the Ability of Response to Drought in Arabidopsis thaliana. Int. J. Mol. Sci. 2022, 23, 14943. https://doi.org/10.3390/ijms232314943

AMA Style

Ran J, Shang C, Mei L, Li S, Tian T, Qiao G. Overexpression of CpADC from Chinese Cherry (Cerasus pseudocerasus Lindl. ‘Manaohong’) Promotes the Ability of Response to Drought in Arabidopsis thaliana. International Journal of Molecular Sciences. 2022; 23(23):14943. https://doi.org/10.3390/ijms232314943

Chicago/Turabian Style

Ran, Jiaxin, Chunqiong Shang, Lina Mei, Shuang Li, Tian Tian, and Guang Qiao. 2022. "Overexpression of CpADC from Chinese Cherry (Cerasus pseudocerasus Lindl. ‘Manaohong’) Promotes the Ability of Response to Drought in Arabidopsis thaliana" International Journal of Molecular Sciences 23, no. 23: 14943. https://doi.org/10.3390/ijms232314943

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop