Simultaneous Inhibition of Histone Deacetylases and RNA Synthesis Enables Totipotency Reprogramming in Pig SCNT Embryos
Abstract
:1. Introduction
2. Results
2.1. How Long Can Transcription Be Inhibited in Pig Embryos without Affecting Their Development?
2.2. Impact of Transcriptional Inhibition on Development of SCNT Embryos
2.3. Transcriptional Activity in SCNT Embryos That Were Treated with Histone Deacetylase and RNA Synthesis Inhibitors
2.4. Post-Implantation Development of SCNT Embryos Treated with Histone Deacetylase and RNA Synthesis Inhibitors
3. Discussion
4. Materials and Methods
4.1. Chemicals
4.2. Collection of Oocytes and In Vitro Maturation
4.3. Parthenogenetic Activation
4.4. In Vitro Fertilization
4.5. Somatic Cell Nuclear Transfer
4.6. Embryo Culture and Treatments
4.7. Embryo Transfer
4.8. Assessment of RNA Synthesis in Porcine Fetal Fibroblasts and Embryos
4.9. Embryo Staining for Cell Counting
4.10. RNA Extraction, Reverse Transcription and Quantitative PCR
4.11. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Gutierrez, K.; Dicks, N.; Glanzner, W.G.; Agellon, L.B.; Bordignon, V. Efficacy of the porcine species in biomedical research. Front Genet 2015, 6, 293. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wilmut, I.; Schnieke, A.E.; McWhir, J.; Kind, A.J.; Campbell, K.H. Viable offspring derived from fetal and adult mammalian cells. Nature 1997, 385, 810–813. [Google Scholar] [CrossRef]
- de Macedo, M.P.; Glanzner, W.G.; Gutierrez, K.; Bordignon, V. Chromatin role in early programming of embryos. Anim. Front. 2021, 11, 57–65. [Google Scholar] [CrossRef] [PubMed]
- Ezashi, T.; Telugu, B.P.V.L.; Alexenko, A.P.; Sachdev, S.; Sinha, S.; Roberts, R.M. Derivation of induced pluripotent stem cells from pig somatic cells. Proc. Natl. Acad. Sci. USA 2009, 106, 10993–10998. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gao, X.; Nowak-Imialek, M.; Chen, X.; Chen, D.; Herrmann, D.; Ruan, D.; Chen, A.C.H.; Eckersley-Maslin, M.A.; Ahmad, S.; Lee, Y.L.; et al. Establishment of porcine and human expanded potential stem cells. Nat. Cell Biol. 2019, 21, 687–699. [Google Scholar] [CrossRef] [Green Version]
- Xu, J.; Yu, L.; Guo, J.; Xiang, J.; Zheng, Z.; Gao, D.; Shi, B.; Hao, H.; Jiao, D.; Zhong, L.; et al. Generation of pig induced pluripotent stem cells using an extended pluripotent stem cell culture system. Stem. Cell. Res. Ther. 2019, 10, 193. [Google Scholar] [CrossRef]
- Bui, H.T.; Kwon, D.N.; Kang, M.H.; Oh, M.H.; Park, M.R.; Park, W.J.; Paik, S.S.; Van Thuan, N.; Kim, J.H. Epigenetic reprogramming in somatic cells induced by extract from germinal vesicle stage pig oocytes. Development 2012, 139, 4330–4340. [Google Scholar] [CrossRef] [Green Version]
- Glanzner, W.G.; Komninou, E.R.; Mahendran, A.; Rissi, V.B.; Gutierrez, K.; Bohrer, R.C.; Collares, T.; Gonçalves, P.B.; Bordignon, V. Exposure of Somatic Cells to Cytoplasm Extracts of Porcine Oocytes Induces Stem Cell-Like Colony Formation and Alters Expression of Pluripotency and Chromatin-Modifying Genes. Cell Reprogram. 2016, 18, 137–146. [Google Scholar] [CrossRef]
- Glanzner, W.G.; de Macedo, M.P.; Gutierrez, K.; Bordignon, V. Enhancement of Chromatin and Epigenetic Reprogramming in Porcine SCNT Embryos—Progresses and Perspectives. Front. Cell Dev. Biol. 2022, 10, 940197. [Google Scholar] [CrossRef]
- Papp, B.; Plath, K. Epigenetics of reprogramming to induced pluripotency. Cell 2013, 152, 1324–1343. [Google Scholar] [CrossRef]
- Jullien, J.; Vodnala, M.; Pasque, V.; Oikawa, M.; Miyamoto, K.; Allen, G.; David, S.A.; Brochard, V.; Wang, S.; Bradshaw, C.; et al. Gene Resistance to Transcriptional Reprogramming following Nuclear Transfer Is Directly Mediated by Multiple Chromatin-Repressive Pathways. Mol. Cell 2017, 65, 873–884.e8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cao, P.; Li, H.; Zuo, Y.; Nashun, B. Characterization of DNA Methylation Patterns and Mining of Epigenetic Markers During Genomic Reprogramming in SCNT Embryos. Front Cell Dev. Biol. 2020, 8, 570107. [Google Scholar] [CrossRef] [PubMed]
- Glanzner, W.G.; Rissi, V.B.; de Macedo, M.P.; Mujica, L.K.S.; Gutierrez, K.; Bridi, A.; de Souza, J.R.M.; Gonçalves, P.B.D.; Bordignon, V. Histone 3 lysine 4, 9, and 27 demethylases expression profile in fertilized and cloned bovine and porcine embryos†. Biol. Reprod. 2018, 98, 742–751. [Google Scholar] [CrossRef]
- Song, X.; Liu, Z.; He, H.; Wang, J.; Li, H.; Li, J.; Li, F.; Jiang, Z.; Huan, Y. Dnmt1s in donor cells is a barrier to SCNT-mediated DNA methylation reprogramming in pigs. Oncotarget 2017, 8, 34980–34991. [Google Scholar] [CrossRef] [Green Version]
- Zhao, J.; Hao, Y.; Ross, J.W.; Spate, L.D.; Walters, E.M.; Samuel, M.S.; Rieke, A.; Murphy, C.N.; Prather, R.S. Histone deacetylase inhibitors improve in vitro and in vivo developmental competence of somatic cell nuclear transfer porcine embryos. Cell Reprogram. 2010, 12, 75–83. [Google Scholar] [CrossRef]
- Jeong, P.S.; Yang, H.J.; Park, S.H.; Gwon, M.A.; Joo, Y.E.; Kim, M.J.; Kang, H.G.; Lee, S.; Park, Y.H.; Song, B.S.; et al. Combined Chaetocin/Trichostatin A Treatment Improves the Epigenetic Modification and Developmental Competence of Porcine Somatic Cell Nuclear Transfer Embryos. Front Cell Dev. Biol. 2021, 9, 709574. [Google Scholar] [CrossRef]
- Ongaratto, F.L.; Rodriguez-Villamil, P.; Bertolini, M.; Carlson, D.F. Influence of oocyte selection, activation with a zinc chelator and inhibition of histone deacetylases on cloned porcine embryo and chemically activated oocytes development. Zygote 2020, 28, 286–290. [Google Scholar] [CrossRef]
- Rissi, V.B.; Glanzner, W.G.; Mujica, L.K.; Antoniazzi, A.Q.; Gonçalves, P.B.; Bordignon, V. Effect of Cell Cycle Interactions and Inhibition of Histone Deacetylases on Development of Porcine Embryos Produced by Nuclear Transfer. Cell Reprogram. 2016, 18, 8–16. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Li, J.; Villemoes, K.; Pedersen, A.M.; Purup, S.; Vajta, G. An epigenetic modifier results in improved in vitro blastocyst production after somatic cell nuclear transfer. Cloning Stem. Cells 2007, 9, 357–363. [Google Scholar] [CrossRef] [PubMed]
- Shahbazian, M.D.; Grunstein, M. Functions of site-specific histone acetylation and deacetylation. Annu. Rev. Biochem. 2007, 76, 75–100. [Google Scholar] [CrossRef]
- Su, G.H.; Sohn, T.A.; Ryu, B.; Kern, S.E. A novel histone deacetylase inhibitor identified by high-throughput transcriptional screening of a compound library. Cancer Res. 2000, 60, 3137–3142. [Google Scholar]
- Zhang, L.; Huang, Y.; Wu, Y.; Si, J.; Huang, Y.; Jiang, Q.; Lan, G.; Guo, Y.; Jiang, H. Scriptaid Upregulates Expression of Development-Related Genes, Inhibits Apoptosis, and Improves the Development of Somatic Cell Nuclear Transfer Mini-Pig Embryos. Cell Reprogram. 2017, 19, 19–26. [Google Scholar] [CrossRef]
- Bohrer, R.C.; Duggavathi, R.; Bordignon, V. Inhibition of histone deacetylases enhances DNA damage repair in SCNT embryos. Cell Cycle 2014, 13, 2138–2148. [Google Scholar] [CrossRef] [Green Version]
- Zhao, J.; Ross, J.W.; Hao, Y.; Spate, L.D.; Walters, E.M.; Samuel, M.S.; Rieke, A.; Murphy, C.N.; Prather, R.S. Significant improvement in cloning efficiency of an inbred miniature pig by histone deacetylase inhibitor treatment after somatic cell nuclear transfer. Biol. Reprod. 2009, 81, 525–530. [Google Scholar] [CrossRef] [Green Version]
- Bui, H.T.; Seo, H.J.; Park, M.R.; Park, J.Y.; Thuan, N.V.; Wakayama, T.; Kim, J.H. Histone deacetylase inhibition improves activation of ribosomal RNA genes and embryonic nucleolar reprogramming in cloned mouse embryos. Biol. Reprod. 2011, 85, 1048–1056. [Google Scholar] [CrossRef] [Green Version]
- Glanzner, W.G.; Gutierrez, K.; Rissi, V.B.; de Macedo, M.P.; Lopez, R.; Currin, L.; Dicks, N.; Baldassarre, H.; Agellon, L.B.; Bordignon, V. Histone Lysine Demethylases KDM5B and KDM5C Modulate Genome Activation and Stability in Porcine Embryos. Front. Cell Dev. Biol. 2020, 8, 151. [Google Scholar] [CrossRef] [PubMed]
- Gao, S.; Chung, Y.G.; Williams, J.W.; Riley, J.; Moley, K.; Latham, K.E. Somatic cell-like features of cloned mouse embryos prepared with cultured myoblast nuclei. Biol. Reprod. 2003, 69, 48–56. [Google Scholar] [CrossRef]
- Matoba, S.; Liu, Y.; Lu, F.; Iwabuchi, K.A.; Shen, L.; Inoue, A.; Zhang, Y. Embryonic development following somatic cell nuclear transfer impeded by persisting histone methylation. Cell 2014, 159, 884–895. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ohi, Y.; Qin, H.; Hong, C.; Blouin, L.; Polo, J.M.; Guo, T.; Qi, Z.; Downey, S.L.; Manos, P.D.; Rossi, D.J.; et al. Incomplete DNA methylation underlies a transcriptional memory of somatic cells in human iPS cells. Nat. Cell Biol. 2011, 13, 541–549. [Google Scholar] [CrossRef]
- Ng, R.K.; Gurdon, J.B. Epigenetic memory of active gene transcription is inherited through somatic cell nuclear transfer. Proc. Natl. Acad. Sci. USA 2005, 102, 1957–1962. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rissi, V.B.; Glanzner, W.G.; de Macedo, M.P.; Mujica, L.K.S.; Campagnolo, K.; Gutierrez, K.; Bridi, A.; Baldassarre, H.; Gonçalves, P.B.D.; Bordignon, V. Inhibition of RNA synthesis during Scriptaid exposure enhances gene reprogramming in SCNT embryos. Reproduction 2019, 157, 123–133. [Google Scholar] [CrossRef]
- Abe, K.-I.; Funaya, S.; Tsukioka, D.; Kawamura, M.; Suzuki, Y.; Suzuki, M.G.; Schultz, R.M.; Aoki, F. Minor zygotic gene activation is essential for mouse preimplantation development. Proc. Natl. Acad. Sci. USA 2018, 115, E6780–E6788. [Google Scholar] [CrossRef] [Green Version]
- Edwards, J.L.; Schrick, F.N.; McCracken, M.D.; van Amstel, S.R.; Hopkins, F.M.; Welborn, M.G.; Davies, C.J. Cloning adult farm animals: A review of the possibilities and problems associated with somatic cell nuclear transfer. Am. J. Reprod. Immunol. 2003, 50, 113–123. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Djekidel, M.N.; Inoue, A.; Matoba, S.; Suzuki, T.; Zhang, C.; Lu, F.; Jiang, L.; Zhang, Y. Reprogramming of Chromatin Accessibility in Somatic Cell Nuclear Transfer Is DNA Replication Independent. Cell Rep. 2018, 23, 1939–1947. [Google Scholar] [CrossRef] [PubMed]
- Bordignon, V.; Clarke, H.J.; Smith, L.C. Developmentally Regulated Loss and Reappearance of Immunoreactive Somatic Histone H1 on Chromatin of Bovine Morula-Stage Nuclei Following Transplantation into Oocytes1. Biol. Reprod. 1999, 61, 22–30. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, Y.; Li, Y.; Luan, D.; Kang, J.; He, R.; Zhang, Y.; Quan, F. Dynamic replacement of H3.3 affects nuclear reprogramming in early bovine SCNT embryos. Theriogenology 2020, 154, 43–52. [Google Scholar] [CrossRef]
- Liu, W.; Liu, X.; Wang, C.; Gao, Y.; Gao, R.; Kou, X.; Zhao, Y.; Li, J.; Wu, Y.; Xiu, W.; et al. Identification of key factors conquering developmental arrest of somatic cell cloned embryos by combining embryo biopsy and single-cell sequencing. Cell Discov. 2016, 2, 16010. [Google Scholar] [CrossRef] [Green Version]
- Rybouchkin, A.; Kato, Y.; Tsunoda, Y. Role of Histone Acetylation in Reprogramming of Somatic Nuclei Following Nuclear Transfer1. Biol. Reprod. 2006, 74, 1083–1089. [Google Scholar] [CrossRef] [Green Version]
- Zhou, C.; Zhang, J.; Zhang, M.; Wang, D.; Ma, Y.; Wang, Y.; Wang, Y.; Huang, Y.; Zhang, Y. Transcriptional memory inherited from donor cells is a developmental defect of bovine cloned embryos. FASEB J. 2020, 34, 1637–1651. [Google Scholar] [CrossRef] [Green Version]
- Song, X.; Li, T.; Xiong, X.; Shan, H.; Feng, T.; Cui, K.; Shi, D.; Liu, Q.; Li, Z. RNA-Seq Reveals the Underlying Molecular Mechanism of First Cleavage Time Affecting Porcine Embryo Development. Genes 2022, 13, 1251. [Google Scholar] [CrossRef]
- Jarrell, V.L.; Day, B.N.; Prather, R.S. The transition from maternal to zygotic control of development occurs during the 4-cell stage in the domestic pig, Sus scrofa: Quantitative and qualitative aspects of protein synthesis. Biol. Reprod. 1991, 44, 62–68. [Google Scholar] [CrossRef]
- Cao, S.; Han, J.; Wu, J.; Li, Q.; Liu, S.; Zhang, W.; Pei, Y.; Ruan, X.; Liu, Z.; Wang, X.; et al. Specific gene-regulation networks during the pre-implantation development of the pig embryo as revealed by deep sequencing. BMC Genom. 2014, 15, 4. [Google Scholar] [CrossRef] [Green Version]
- Madeja, Z.E.; Pawlak, P.; Piliszek, A. Beyond the mouse: Non-rodent animal models for study of early mammalian development and biomedical research. Int. J. Dev. Biol. 2019, 63, 187–201. [Google Scholar] [CrossRef] [Green Version]
- Rissi, V.B.; Glanzner, W.G.; De Macedo, M.P.; Gutierrez, K.; Baldassarre, H.; Gonçalves, P.B.D.; Bordignon, V. The histone lysine demethylase KDM7A is required for normal development and first cell lineage specification in porcine embryos. Epigenetics 2019, 14, 1088–1101. [Google Scholar] [CrossRef] [PubMed]
- De Iaco, A.; Verp, S.; Offner, S.; Grun, D.; Trono, D. DUX is a non-essential synchronizer of zygotic genome activation. Development 2020, 147, dev177725. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Liu, X.; Song, L.; Di, A.; Su, G.; Bai, C.; Wei, Z.; Li, G. Transient Dux expression facilitates nuclear transfer and induced pluripotent stem cell reprogramming. EMBO Rep. 2020, 21, e50054. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Xie, Z.; Zhang, Y. DPPA2 and DPPA4 are dispensable for mouse zygotic genome activation and preimplantation development. Bio. RXIV 2021, 148, dev200178. [Google Scholar] [CrossRef]
- De Iaco, A.; Coudray, A.; Duc, J.; Trono, D. DPPA2 and DPPA4 are necessary to establish a 2C-like state in mouse embryonic stem cells. EMBO Rep. 2019, 20, e47382. [Google Scholar] [CrossRef] [PubMed]
- Eckersley-Maslin, M.; Alda-Catalinas, C.; Blotenburg, M.; Kreibich, E.; Krueger, C.; Reik, W. Dppa2 and Dppa4 directly regulate the Dux-driven zygotic transcriptional program. Genes Dev. 2019, 33, 194–208. [Google Scholar] [CrossRef] [Green Version]
- Kubinyecz, O.; Santos, F.; Drage, D.; Reik, W.; Eckersley-Maslin, M.A. Maternal Dppa2 and Dppa4 are dispensable for zygotic genome activation but important for offspring survival. Development 2021, 148, dev200191. [Google Scholar] [CrossRef]
- da Silva, Z.; Glanzner, W.G.; Currin, L.; de Macedo, M.P.; Gutierrez, K.; Guay, V.; Gonçalves, P.B.D.; Bordignon, V. DNA Damage Induction Alters the Expression of Ubiquitin and SUMO Regulators in Preimplantation Stage Pig Embryos. Int. J. Mol. Sci. 2022, 23, 9610. [Google Scholar] [CrossRef]
- Xu, D.; Bi, J.; Guan, Y.; Luo, X.; Chen, X.; Lv, Y.; Jin, Y. Effects of the E1 activating enzyme UBA2 on porcine oocyte maturation, apoptosis, and embryonic development in vitro. Anim. Sci. J. 2021, 92, e13548. [Google Scholar] [CrossRef]
- Magnani, L.; Johnson, C.M.; Cabot, R.A. Expression of eukaryotic elongation initiation factor 1A differentially marks zygotic genome activation in biparental and parthenogenetic porcine embryos and correlates with in vitro developmental potential. Reprod. Fertil. Dev. 2008, 20, 818–825. [Google Scholar] [CrossRef]
- de Macedo, M.P.; Glanzner, W.G.; Rissi, V.B.; Gutierrez, K.; Currin, L.; Baldassarre, H.; Bordignon, V. A fast and reliable protocol for activation of porcine oocytes. Theriogenology 2019, 123, 22–29. [Google Scholar] [CrossRef]
- Abeydeera, L.R.; Day, B.N. Fertilization and subsequent development in vitro of pig oocytes inseminated in a modified tris-buffered medium with frozen-thawed ejaculated spermatozoa. Biol. Reprod. 1997, 57, 729–734. [Google Scholar] [CrossRef] [Green Version]
- Lee, W.-J.; Jang, S.-J.; Lee, S.-C.; Park, J.-S.; Jeon, R.-H.; Subbarao, R.B.; Bharti, D.; Shin, J.-K.; Park, B.-W.; Rho, G.-J. Selection of reference genes for quantitative real-time polymerase chain reaction in porcine embryos. Reprod. Fertil. Dev. 2017, 29, 357–367. [Google Scholar] [CrossRef]
Donor Cell | DRB | Gilt (#) | Transferred Embryos (n) | Confirmed Pregnancy (D28-30) | Pregnancy Loss | Fetuses Collected | Piglets Born (n) |
---|---|---|---|---|---|---|---|
PFF A | - | 1 | 174 | No | - | - | |
- | 2 | 207 | No | - | - | - | |
+ | 3 | 165 | Yes | - | 6 | - | |
+ | 4 | 221 | Yes | - | 4 | ||
PFF B | - | 5 | 89 | Yes | Yes | - | - |
- | 7 | 103 | Yes | No | - | 4 | |
+ | 6 | 90 | Yes | No | - | 1 | |
+ | 8 | 107 | Yes | Yes | - | - | |
PFF C | + | 9 | 97 | Yes | No | - | 5 |
+ | 10 | 102 | Yes | No | - | 1 | |
Total | - | n = 4 | 573 | 2 | 1 | 0 | 4 |
+ | n = 6 | 782 | 6 | 1 | 10 | 7 |
Gene | Forward (5′ to 3′) | Reverse (3′ to 5′) | Reference or Accession Number |
---|---|---|---|
DCAF13 | TTCCTTGCTTCCCTGGATGG | CGTACAAAACCTTCATGCGC | [51] |
DNMT1 | ATTCTCTCCTTCGACACGCC | GCCTTTCAGCTCGCCTTTTC | [8] |
DPPA2 | TGAGTACCAGTGGCCAGAAAA | GACTGCAATCTGGTCTCCCA | XM_003358822.4 |
DPPA4 | CAGAGACGTTCTTCGGGCTT | TGTGGCAGGGAAGTCTTTTTG | XM_005654065.3 |
DUXA | AGAACACAGACGCAAGCCAA | TAGCTGGTCCGACATCGTCT | XM_021097581.1 |
EIF1AX | ACACCTCCCCGATAGGAGTC | TTGAGCACACTCTTGCCCAT | [26] |
EIF2A | AGGAGCGTCCTACTATGGGG | TGGCTGGCATGAAGCCATAA | [26] |
H2A | GGTGCTGGAGTATCTGACCG | GTTGAGCTCTTCGTCGTTGC | [13] |
KDM5B | GACGTGTGCCAGTTTTGGAC | TCGAGGACACAGCACCTCTA | [13] |
KDM5C | GGCATGGTCTTCTCAGCCTT | TGAGGGTACCCCATACCAGG | [13] |
KDM6A | AGCTTTTGTCGAGCCAAGGA | GCATTGGACAAAGTGCAGGG | [13] |
KDM7A | TCAGGAATAGACGGGCTGGA | TCAGTGCAGTGCAATCAGGT | [13] |
RNF114 | GTCCATAGCACGGACACCAA | CCGACGCTGGATGTGTTCTA | [51] |
UBA2 | GGAGCCGACTTCAAGCAGAT | TGGGGCATCACCAACAACTT | [51] |
UBC9 | CAAGCAGAGGCCTACACGAT | AAGGTCGCTGCTTATGAGGG | [51] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
de Macedo, M.P.; Glanzner, W.G.; Gutierrez, K.; Currin, L.; Guay, V.; Carrillo Herrera, M.E.; da Silva, Z.; Baldassarre, H.; McGraw, S.; Bordignon, V. Simultaneous Inhibition of Histone Deacetylases and RNA Synthesis Enables Totipotency Reprogramming in Pig SCNT Embryos. Int. J. Mol. Sci. 2022, 23, 14142. https://doi.org/10.3390/ijms232214142
de Macedo MP, Glanzner WG, Gutierrez K, Currin L, Guay V, Carrillo Herrera ME, da Silva Z, Baldassarre H, McGraw S, Bordignon V. Simultaneous Inhibition of Histone Deacetylases and RNA Synthesis Enables Totipotency Reprogramming in Pig SCNT Embryos. International Journal of Molecular Sciences. 2022; 23(22):14142. https://doi.org/10.3390/ijms232214142
Chicago/Turabian Stylede Macedo, Mariana Priotto, Werner Giehl Glanzner, Karina Gutierrez, Luke Currin, Vanessa Guay, Maria Elena Carrillo Herrera, Zigomar da Silva, Hernan Baldassarre, Serge McGraw, and Vilceu Bordignon. 2022. "Simultaneous Inhibition of Histone Deacetylases and RNA Synthesis Enables Totipotency Reprogramming in Pig SCNT Embryos" International Journal of Molecular Sciences 23, no. 22: 14142. https://doi.org/10.3390/ijms232214142