Next Article in Journal
Sex Hormone Candidate Gene Polymorphisms Are Associated with Endometriosis
Previous Article in Journal
Therapeutic and Metagenomic Potential of the Biomolecular Therapies against Periodontitis and the Oral Microbiome: Current Evidence and Future Perspectives
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Myostatin Knockout Affects Mitochondrial Function by Inhibiting the AMPK/SIRT1/PGC1α Pathway in Skeletal Muscle

1
State Key Laboratory of Reproductive Regulation and Breeding of Grassland Livestock, College of Life Science, Inner Mongolia University, Hohhot 010070, China
2
College of Animal Science, Inner Mongolia Agricultural University, Hohhot 010018, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Int. J. Mol. Sci. 2022, 23(22), 13703; https://doi.org/10.3390/ijms232213703
Submission received: 11 October 2022 / Revised: 2 November 2022 / Accepted: 6 November 2022 / Published: 8 November 2022
(This article belongs to the Section Molecular Biology)

Abstract

:

Simple Summary

Myostatin (Mstn) is a negative regulator of skeletal muscle mass, and its deletion leads to reduced mitochondrial function. However, the exact regulatory mechanism remains unclear. In this study, we used CRISPR/Cas9 to generate myostatin-knockout (Mstn-KO) mice via pronuclear microinjection. The skeletal muscle of Mstn-KO mice significantly increased, and the basal metabolic rate, muscle ATP synthesis, mitochondrial respiratory chain complex activity, tricarboxylic acid cycle (TCA), and thermogenesis decreased. In the muscle tissue of Mstn-KO mice, the expression of SIRT1 and pAMPK decreased, and the acetylation modification of PGC-1α increased. Furthermore, the treatment of isolated muscle cells from Mstn-KO and wild-type mice with AMPK activator (AICAR) and AMPK inhibitor (Compound C) found that Compound C down-regulated the expression of pAMPK and SIRT1 and the activity of citrate synthase (CS), isocitrate dehydrogenase (ICDHm) and α-ketoglutarate acid dehydrogenase (α-KGDH) similar to that of Mstn-KO. However, AICAR partially reversed the inhibitory effect of Mstn-KO on the expression of pAMPK and SIRT1 and activity of three enzymes. Thus, Mstn-KO affects mitochondrial function by inhibiting the AMPK/SIRT1/PGC1α signaling pathway.

Abstract

Myostatin (Mstn) is a major negative regulator of skeletal muscle mass and initiates multiple metabolic changes. The deletion of the Mstn gene in mice leads to reduced mitochondrial functions. However, the underlying regulatory mechanisms remain unclear. In this study, we used CRISPR/Cas9 to generate myostatin-knockout (Mstn-KO) mice via pronuclear microinjection. Mstn-KO mice exhibited significantly larger skeletal muscles. Meanwhile, Mstn knockout regulated the organ weights of mice. Moreover, we found that Mstn knockout reduced the basal metabolic rate, muscle adenosine triphosphate (ATP) synthesis, activities of mitochondrial respiration chain complexes, tricarboxylic acid cycle (TCA) cycle, and thermogenesis. Mechanistically, expressions of silent information regulator 1 (SIRT1) and phosphorylated adenosine monophosphate-activated protein kinase (pAMPK) were down-regulated, while peroxisome proliferator-activated receptor γ coactivator-1α (PGC-1α) acetylation modification increased in the Mstn-KO mice. Skeletal muscle cells from Mstn-KO and WT were treated with AMPK activator 5-aminoimidazole-4-carboxamide riboside (AICAR), and the AMPK inhibitor Compound C, respectively. Compared with the wild-type (WT) group, Compound C treatment further down-regulated the expression or activity of pAMPK, SIRT1, citrate synthase (CS), isocitrate dehydrogenase (ICDHm), and α-ketoglutarate acid dehydrogenase (α-KGDH) in Mstn-KO mice, while Mstn knockout inhibited the AICAR activation effect. Therefore, Mstn knockout affects mitochondrial function by inhibiting the AMPK/SIRT1/PGC1α signaling pathway. The present study reveals a new mechanism for Mstn knockout in regulating energy homeostasis.

1. Introduction

Myostatin (Mstn) is a negative regulator of skeletal muscle mass [1]. Mstn knockout mice increased muscle fiber number (hyperplasia) and fiber size (hypertrophy) during development, resulting in a significant increase in muscle mass [1,2]. Consistently, naturally occurring mutations in Mstn gene generate similar muscle hypertrophy phenotypes in many different mammalian species, including cattle, sheep, dogs, and humans [3]. This gene has also been experimentally edited in different mammals including pigs [4,5], dogs [6], rabbits [7], goats [8,9], sheep [10], and cattle [11].
In addition, the lack of Mstn leads to the decline of ATP synthesis capacity [12,13]. Mitochondria are the main energy-converting organelles in eukaryotic cells, producing adenosine triphosphate (ATP) through the tricarboxylic acid cycle (TCA cycle) and oxidative phosphorylation (OXPHOS), which is the basic energy molecule of the cell [14]. The OXPHOS system is embedded in the inner mitochondrial membrane and consists of five complexes, namely complex I (CI), complex II (CII), complex III (CIII), complex IV (CIV), and complex V (CV). These enzymes catalyze the oxidation of biological substrates and the synthesis of ATP [15]. It is possible to directly or indirectly represent the respiratory function of mitochondria through the respiratory chain complex enzyme activity [16]. It has also been reported that the mitochondrial membrane potential (ΔΨm) represents the energy stored in the mitochondrial electric field for the conversion of ADP to ATP [17]. There are reports that mice with deletion of the Mstn gene exhibit a marked decrease in mitochondria content and disturbance in respiratory function [18,19]. However, the signaling mechanisms by which Mstn regulates mitochondria activity are still unknown.
AMPK (AMP-activated protein kinase), a serine/threonine protein kinase, plays a critical role in intracellular energy homeostasis and is essential for regulating mitochondrial function [20]. SIRT1 (silent information regulator 1) belongs to the sirtuins family of NAD+-dependent deacetylases and plays a role in regulating mitochondrial function [21]. PGC-1α (peroxisome proliferator-activated receptor gamma coactivator 1 alpha) is a transcriptional coactivator that regulates mitochondrial biogenesis and oxidative metabolism [22]. Interestingly, cross-talk among these energy-sensing factors regulates mitochondrial function. AMPK stimulates PGC1α activity by enhancing SIRT1-mediated PGC1α deacetylation [23]. AMPK regulates SIRT1 activity through NAD+content [23]. SIRT1 can directly interact and deacetylate PGC-1α [24]. PGC-1α function is associated with the regulation of large gene clusters that control oxidative phosphorylation and mitochondrial activity [25]. Canagliflozin (Cana) promoted mitochondrial biogenesis, mitochondrial oxidative phosphorylation, and thermogenesis via an AMPK–SIRT1–PGC1α pathway [26]. However, whether Mstn knockout regulates mitochondrial metabolism through the AMPK/SIRT1/PGC1alpha pathway was unknown.
In this study, we built Mstn-KO mice by CRISPR/Cas9 to explore the mechanism that how Mstn regulated mitochondrial activity. We found that basal metabolic rate, mitochondrial electron transport chain complexes, mitochondrial membrane potential, and TCA cycle were inhibited in Mstn-KO mice. Meanwhile, the expression of SIRT1 and pAMPK was down-regulated and increased PGC-1α acetylation in the Mstn-KO mice. These results indicated that Mstn knockout suppressed mitochondrial function probably by inhibiting the AMPK/SIRT1/PGC1alpha pathway.

2. Results

2.1. Generation of Mstn-KO Mice by CRISPR/Cas9 System

To generate Mstn-KO mice by CRISPR/Cas9 techniques, we designed four guide RNAs to target exon 2 and exon 3 of the mouse MSTN gene, respectively (Figure 1a). Three transgenic founders were generated by pronuclear injection. To produce obvious phenotype Mstn-KO mice (F2), we mated only exon 3 deletion mutant F1 mice. A total of 10 mice (59%) among 17 F2 mice were identified as Mstn mutants, showing nine different genotypes with deletions ranging from 5 to 8 nt (Figure 1b). Phenotypic analysis showed that the Mstn-KO exhibited muscle hypertrophy in the skeletal muscle of Mstn-KO mice (Figure 1c). We isolated single muscle fibers from mice gastrocnemius and found that the Mstn-KO mice were significantly thicker than the WT mice (Figure 1d). Furthermore, MSTN protein expression was significantly decreased in the Mstn-KO mice compared with the WT mice (Figure 1e).

2.2. Growth Performance and Phenotypic Traits

We compared and analyzed growth performances and phenotypic characteristics between Mstn-KO and WT mice (from 3 to 10 weeks). The average body weights of Mstn-KO and WT mice increased continuously from 3 to 10 weeks (Figure 2a,b). After 6 weeks, the average body weight of Mstn-KO male mice was significantly higher than WT mice (Figure 2a). However, the average body weight of Mstn-KO female mice was continuously higher than WT mice from 7 weeks (Figure 2b). Moreover, compared with the WT mice, the weights of the liver, spleen, lungs, thyroid, pancreas, brain, testis, and ovary were decreased by 0.55%, 33.51%, 10.01%, 0.26%, 14.51%, 24.23%, 30.79%, and 14.51%, respectively, in Mstn-KO. The heart and kidney weight of Mstn-KO mice was higher at 22.13% and 2.59% (Table 1). We investigated the expression of Mstn in the skeletal muscle and internal organs of WT and Mstn-KO mice using real-time quantitative PCR. Mstn mRNA expression in the heart, liver, lungs, kidneys, pancreas, brain, and muscle was significantly lower in Mstn-KO mice than in WT mice, while no signal was detected in the spleen (Figure 2c).

2.3. Effect of Mstn Knockout on Basal Metabolic Rate and Body Temperature

Next, we evaluated the basal metabolic rate (BMR) in Mstn-KO and WT mice. The levels of VO2, VCO2, and respiratory quotient (CO2 release/O2 consumption, RQ) of the resting state were examined in the groups. Compared to the WT mice, Mstn-KO mice consumed less O2 (2.40 ± 0.47 ml/min for Mstn-KO and 2.57 ± 0.25 ml/min for WT) and released less CO2 (1.65 ± 0.34 ml/min for Mstn-KO and 1.95 ± 0.26 ml/min for WT) (Table 2). RQ was reduced in Mstn-KO mice. Mstn-KO mice have a lower BMR (basal metabolic rate) compared with the WT mice (Figure 3a). In a resting state, the two major components of energy expenditure are the basal metabolic rate and maintaining body temperature. The body temperature of mice was monitored in real time over seven consecutive days. We found that body temperature was slightly lower in either male or female Mstn-KO mice compared to WT mice, and females had slightly higher body temperatures than males within the same group. (Figure 3b). However, the body temperature of these groups was maintained in the normal range. These results suggest that Mstn knockout reduced energy expenditure in a resting state.

2.4. Mstn Knockout Reduced Mitochondria Activity

It is well-established that mitochondria are the center of cellular energy metabolism. The mitochondrial TCA cycle and the electron transport chain are the two main components that determine mitochondrial energy metabolism. Firstly, we measured the total ATP content of muscle tissues. The results were that ATP synthesis was significantly decreased in the Mstn-KO mice (Figure 4a). To further explore the effects of Mstn on the main processes of energy metabolism, we examined the individual activities of mitochondrial electron transport chain complexes I-V. The data showed that the activities of complexes I to V were reduced 0.6-fold, 0.74-fold, 0.77-fold, 0.53-fold, and 0.7-fold in Mstn-KO mice, respectively (Figure 4b–f). Furthermore, Mstn knockout decreased mitochondrial membrane potential compared with the WT mice (Figure 4g). We further investigated the mRNA levels of the mitochondrial activity gene by qPCR. Lower transcript levels of Tfam, Nrf, and CIpp genes were found in Mstn-KO mice (Figure 4h).

2.5. Mstn Knockout Inhibited the TCA Cycle

We further examined key enzymes and metabolites in the TCA cycle. Citrate synthase and citrate acids are enzymes and a product of the initial step in the TCA cycle. As shown in Figure 5a,b, citrate content and citrate synthase activity were reduced in the Mstn-KO mice compared to the WT mice. In addition, isocitrate dehydrogenase activity and α-ketoglutarate content were decreased in the Mstn-KO mice (Figure 5c,d). Isocitrate dehydrogenase converts isocitrate to α-ketoglutarate in the TCA cycle. These results indicated that Mstn knockout decreased mitochondrial function whether electron transport chain or TCA cycle.

2.6. Mstn Knockout Inhibited AMPK/SIRT1/PGC1alpha Pathway

Previous studies have demonstrated that AMPK regulates mitochondrial function [27]. Thus, we next determined whether the phosphorylation level AMPK changes in Mstn-KO mice skeletal muscle. As expected, compared to the WT mice, the expression of pAMPK was significantly downregulated (Figure 6a,b). We further examined the expression of SIRT1 of the downstream molecule of AMPK by Western blot. Mstn-KO mice had significantly decreased levels of SIRT1 (Figure 6a,c). Moreover, to investigate the acetylation level of PGC1α protein in Mstn-KO and WT mice, we detected the acetylated PGC1α protein in Mstn-KO and WT mice. Since no commercial acetylation antibody of PGC1α protein was available, the pan acetyllysine antibody was used to assess the acetylation level of PGC1α by IP analysis. Briefly, PGC1α was pulled down with the anti-PGC1α antibody, and an IP/Western blot assay was carried out to analyze the acetylation of PGC1α using the previously reported method [28,29]. Mstn knockout resulted in PGC1α acetylation increase, suggesting that PGC-1α activity was decreased (Figure 6d,e). This finding supports previous findings that PGC-1α expression is subject to auto-regulation in collaboration with SIRT1, which activates PGC-1α through deacetylation. Taken together, these findings show that Mstn knockout inhibited the AMPK/SIRT1/PGC1alpha pathway.

2.7. Expression of pAMPK and SIRT1 following Treatment with AICAR and Compound C

To further explore the relationship between MSTN and the AMPK/SIRT1/PGC1α pathway in skeletal muscle mitochondrial function, cells of Mstn-KO and WT mice were treated with AMPK activator AICAR and the AMPK inhibitor Compound C. AICAR is an AMP analog. Similar to AMP, AICAR binds to the γ subunit of AMPK, allosterically activates the enzyme, stimulates phosphorylation at Thr172 by liver kinase B1 (LKB1), and protects against pThr172 dephosphorylation [30]. Compound C is an ATP-competitive inhibitor and binds to the highly conserved active site of AMPK [31]. SIRT1 and pAMPK protein expression and activity of citrate synthase (CS), isocitrate dehydrogenase (ICDHm), and α-ketoglutarate acid dehydrogenase (α-KGDH) were determined by Western blotting analysis and biochemical detection methods, respectively. AICAR-treated cells exhibited increased pAMPK and SIRT1 expression compared to AICAR-untreated cells (Figure 7a–c). The expressions of pAMPK and SIRT1 proteins were decreased in MT cells compared with WT cells (Figure 7a–c). Meanwhile, the activity of CS, ICDHm, and α-KGDH in the treated and untreated cells obtained similar results (Figure 7d–f). The AICAR effects were inhibited by the Mstn knockout (Figure 7a–f). Furthermore, Mstn-KO cells showed dramatically decreased pAMPK and SIRT1 protein levels and activity of the three enzymes compared to WT cells, and the same results were also obtained in the treated group compared with the untreated group (Figure 7g–l). The SIRT1 and pAMPK expression and activity of the three enzymes of Mstn-KO cells were reduced further in response to compound c stimulation (Figure 7g–l). These results suggest that Mstn knockout reduces mitochondrial function by inhibiting AMPK–SIRT1 signaling.

3. Discussion

Mstn is a potent inhibitor of skeletal muscle mass [32]. Mstn knockout animals all showed a skeletal muscle hypertrophy phenotype [7,33,34,35,36,37,38]. The Mstn-knockout mice we obtained also showed a hypertrophic phenotype. In addition to the characteristic effects on the skeletal muscle, Mstn knockout can affect other organs. Currently, the weight of organs has previously been reported on cattle, mice, and piglets of Mstn deficiency. At 15 or 20 months of age, the weights of the heart, liver, spleen, and lungs of Charolais double muscle cattle decreased by 20%, 20%, 30%, and 10%, respectively [39]. Moreover, at 4, 8, and 12 weeks of age, the kidneys and liver of Mstn-deficient mice were lighter than those of WT mice, while the weight of the heart and lungs were similar [40]. In MSTN-KO piglets, the weights of the heart, liver, lungs, kidneys, and stomach were decreased by 21.4%, 21.3%, 29.8%, 16.7%, and 20.0% relative to body weight, respectively [41]. In the current study, the weights of the liver, spleen, lungs, thyroid, pancreas, brain, testis, and ovary were decreased by 0.55%, 33.51%, 10.01%, 0.26%, 14.51%, 24.23%, 30.79%, and 14.51%, respectively, whereas the heart and kidney weight of Mstn-KO mice was higher in 22.13% and 2.59%. We reasoned that Mstn might exert a different effect on organ weight in different species.
Mstn knockout is closely related to skeletal muscle metabolism [42,43]. Several studies have reported that Mstn knockout decreases ATP production during exercise [12,44]. Moreover, Li et al. found that knockout Mstn in loach significantly decreased ATP synthesis by directly measuring the total ATP content of loach muscle tissue [13]. In this study, we demonstrated that Mstn knockout muscle decreased ATP synthesis in the resting state of Mstn-KO mice. Interestingly, we also found that the basal metabolic rate and body temperature were significantly decreased in Mstn-KO mice correlating with the reduced ATP synthesis capacity. Indeed, mitochondria produce most of the ATP in cells [45]. Our present study confirmed that mitochondrial electron transport chain complexes, mitochondrial membrane potential, and TCA cycle were reduced in Mstn-KO mice muscle. These results further reveal that Mstn knockout impact mitochondrial function, as studied previously in Mstn KO animals [13,18,19].
AMPK, SIRT1 and PGC1α are all involved in regulating mitochondrial function [20,21,22]. According to Price and his colleagues [46], resveratrol improves mitochondrial biogenesis and function by activating SIRT1. SIRT1 activates PGC1α by deacetylation [47]. Melatonin prevents mitochondrial fission through the SIRT1–PGC1α pathway [48]. Meanwhile, salidroside may treat diabetic nephropathy in mice through SIRT1–PGC1α mediated mitochondrial biogenesis [49]. In addition, AMPK regulates SIRT1 activity by modulating intracellular NAD+ levels and thereby influencing PGC1α deacetylation [50]. We have found, for the first time, that Mstn knockout down-regulated the expressions of SIRT1 and pAMPK, enhancing PGC-1α acetylation. Skeletal muscle cells from Mstn-KO and WT were treated with AMPK activators AICAR and the AMPK inhibitor Compound C, respectively. Compared with WT mice, Compound C treatment further down-regulated the expression of pAMPK and SIRT1 expression and activity of CS, ICDHm, and α-KGDH in Mstn-KO mice, while Mstn knockout inhibited the AICAR activation effect. Therefore, Mstn knockout inhibited mitochondrial function via the AMPK/SIRT1/PGC1α signaling pathway.

4. Materials and Methods

4.1. Mstn-KO Mouse Production and Validation

The Mstn-KO mice were generated by pronuclear microinjection. The sgRNA oligos were synthesized and cloned into the pCas-Guide-EF1α-GFP plasmid downstream at the BamHⅠ and BsmBⅠ restriction sites to generate the pCas-Guide-EF1α-GFP-sgRNA recombinant plasmid. The positive clones were confirmed by Sanger sequencing. The purified transgene was microinjected into the male pronuclei of fertilized eggs from superovulated female mice and transferred to recipient pseudopregnant females. The mouse genotypes were determined by PCR-based assays; the primers used for genotyping are listed in Table 3.

4.2. Body Temperature Measurements

The body temperature of the animals was measured daily by a subcutaneously located temperature chip.

4.3. Metabolic Measurements

Mice were individually housed in the metabolic cages (Oxylet) and acclimatized for 24 h before recording. Their 24 h oxygen consumption (VO2), carbon dioxide production (VCO2), and respiratory quotient (RQ) were measured every hour for 3 min in each cage. Mice were maintained on their normal diet or water throughout the detection process.

4.4. Characterization and Analysis of Organs

Healthy mice from each group (Mstn-KO and WT) were euthanized and tissues were collected for experimental purposes. The organs analyzed were the spleen, brain, lungs, pancreas, heart, liver, kidney, thyroid, testicle, and ovary. Body weight and organ weight were calculated.

4.5. Western Blot

The total protein was extracted from the muscle and cells of Mstn-KO and WT mice according to our previously reported method [51]. Proteins were detected using primary antibodies, including anti-MSTN (Abcam, Cambridge, MA, USA, ab201954), anti-pAMPK (Abcam, Cambridge, MA, USA, ab133448), anti-PGC-1α (Santa Cruz Biotechnology, Santa Cruz, CA, USA, sc-518025), and anti-acetyllysine (PTM BIO, Hang Zhou, China, PTM-101).

4.6. Real-Time PCR

Real-time PCR was performed referring to our previous reported [51]. Primer sequences were as tabulated in Table 3.

4.7. Biochemical Detection

Enzyme activities and metabolites were assayed using an ATP content assay kit (ATP-1-Y), mitochondrial electron transport chain complexes I-V assay kit (FHTA-1-Y, FHTB-1-Y, FHTC-1-Y, FHTD-1-Y and FHTE-1-Y), citrate synthase activity assay kit (CS-1-Y), citrate acid content assay kit (CA-1-W), isocitrate dehydrogenase activity assay kit (ICDHM-1-Y), α-ketoglutarate acid dehydrogenase activity assay kit (KGDH-1-Y), and α-ketoglutarate content assay kit (KGA-4-Q) according to the manufacturer’s protocols from Comin (Su Zhou, China). The optical densities were measured using a microplate reader (Thermo, Waltham, MA, USA).

4.8. Co-Immunoprecipitation

Lysates of mice skeletal muscle tissue generated under the addition of proteinase inhibit cocktail Complete Mini (Thermo, Waltham, MA, USA) and phosphatase inhibitor cocktail PhosSTOP (Thermo, Waltham, MA, USA). The total protein of the lysates was measured by the Pierce BCA Protein Assay Kit (Thermo, Waltham, MA, USA). Co-immunoprecipitation (co-IP) was completed using the Thermo Scientific Pierce co-IP kit (#26149) following the manufacturer’s protocol. Ten micrograms of the antibody were incubated with the delivered resin and covalently coupled. The antibody-coupled resin was incubated with 200 µL of the whole mice skeletal muscle protein lysates overnight at 4 °C, respectively. The resin was washed, and the protein complexes bound to the antibody were eluted. Subsequent Western blot analyses were performed as described before.

4.9. Cell Culture and Treatment

Primary mouse skeletal muscle cell was cultured using a described method before [52]. Cells were treated with 1 mM AICAR (Selleck, Shanghai, China, S1802) or 5 µM Compound C (Selleck, Shang Hai, China, S7306).

4.10. Statistical Analysis

Comparisons between two observations in the same subjects were assessed by Student’s paired t-test. Results were expressed as the mean ± standard deviation (SD). The p-value of less than 0.05 was accepted as statistical significance.

5. Conclusions

This study demonstrated that Mstn knockout decrease basal metabolic rate, body temperature, and mitochondrial activity in skeletal muscle. The probable mechanism is that Mstn knockout suppressed mitochondrial function via inhibiting the AMPK/SIRT1/PGC1α signaling pathway (Figure 7m).

Author Contributions

Conceptualization: Z.W., L.Y. and G.L.; Methodology: M.G., Y.G. and D.W.; Investigation: X.W., M.G. and G.S.; Resources: L.Y. and G.L.; Funding acquisition: L.Y. and G.L.; Project administration: L.Y. and G.L.; Data curation: X.W., M.G. and X.L.; Writing—original draft preparation: M.G. and C.B.; Writing—review and editing: M.G., X.W., L.Y. and G.L. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by Inner Mongolia Autonomous Region Open Competition Projects (2022JBGS0025), Inner Mongolia Autonomous Region Science and Technology Major Project (2021ZD0009, 2021ZD0008, 2022ZD0008), Inner Mongolia Autonomous Region Science and Technology Leading Talent Team (2022LJRC0006), Inner Mongolia Hohhot City Science and Technology Project (2022-nong-4), the Engineering Research Center of the Ministry of Education on Excellent Livestock Scale Breeding Technology (JYBGCSYS2022), the Inner Mongolia University Chief Scientist Program (to G.L. and L.Y.).

Institutional Review Board Statement

The animal study protocol was approved by the Institutional Animal Care and Use Committee of Inner Mongolia University (No. IMU-MICE-2020-037, 20 December 2020).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Acknowledgments

We would like to thank Xinyu Zhou, Lin Zhu, Chao Hai, and Yunxi Wu for their technical assistance.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. McPherron, A.C.; Lawler, A.M.; Lee, S.J. Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature 1997, 387, 83–90. [Google Scholar] [CrossRef]
  2. Chen, J.L.; Colgan, T.D.; Walton, K.L.; Gregorevic, P.; Harrison, C.A. The TGF-β signalling network in muscle development, adaptation and disease. Adv. Exp. Med. Biol. 2016, 900, 97–131. [Google Scholar] [CrossRef]
  3. Stinckens, A.; Georges, M.; Buys, N. Mutations in the myostatin gene leading to hypermuscularity in mammals: Indications for a similar mechanism in fish? Anim. Genet. 2011, 42, 229–234. [Google Scholar] [CrossRef]
  4. Wang, K.; Ouyang, H.; Xie, Z.; Yao, C.; Guo, N.; Li, M.; Jiao, H.; Pang, D. Efficient generation of Myostatin mutations in pigs using the CRISPR/Cas9 system. Sci. Rep. 2015, 5, 16623. [Google Scholar] [CrossRef] [Green Version]
  5. Wang, K.; Tang, X.; Xie, Z.; Zou, X.; Li, M.; Yuan, H.; Guo, N.; Ouyang, H.; Jiao, H.; Pang, D. CRISPR/Cas9-mediated knockout of myostatin in Chinese indigenous Erhualian pigs. Transgenic Res. 2017, 26, 799–805. [Google Scholar] [CrossRef]
  6. Zou, Q.; Wang, X.; Liu, Y.; Ouyang, Z.; Long, H.; Wei, S.; Xin, J.; Zhao, B.; Lai, S.; Shen, J.; et al. Generation of gene-target dogs using CRISPR/Cas9 system. J. Mol. Cell Biol. 2015, 7, 580–583. [Google Scholar] [CrossRef] [Green Version]
  7. Lv, Q.; Yuan, L.; Deng, J.; Chen, M.; Wang, Y.; Zeng, J.; Li, Z.; Lai, L. Efficient generation of Myostatin gene mutated rabbit by CRISPR/Cas9. Sci. Rep. 2016, 6, 25029. [Google Scholar] [CrossRef] [Green Version]
  8. He, Z.; Zhang, T.; Jiang, L.; Zhou, M.; Wu, D.; Mei, J.; Cheng, Y. Use of CRISPR/Cas9 technology efficiently targetted goat myostatin through zygotes microinjection resulting in double-muscled phenotype in goats. Biosci. Rep. 2018, 38, BSR20180742. [Google Scholar] [CrossRef] [Green Version]
  9. Wang, X.; Yu, H.; Lei, A.; Zhou, J.; Zeng, W.; Zhu, H.; Dong, Z.; Niu, Y.; Shi, B.; Cai, B.; et al. Generation of gene-modified goats targeting MSTN and FGF5 via zygote injection of CRISPR/Cas9 system. Sci. Rep. 2015, 5, 13878. [Google Scholar] [CrossRef] [Green Version]
  10. Crispo, M.; Mulet, A.P.; Tesson, L.; Barrera, N.; Cuadro, F.; dos Santos-Neto, P.C.; Nguyen, T.H.; Crénéguy, A.; Brusselle, L.; Anegón, I.; et al. Efficient generation of myostatin knock-out Sheep using CRISPR/Cas9 technology and microinjection into zygotes. PLoS ONE 2015, 10, e0136690. [Google Scholar] [CrossRef]
  11. Proudfoot, C.; Carlson, D.F.; Huddart, R.; Long, C.R.; Pryor, J.H.; King, T.J.; Lillico, S.G.; Mileham, A.J.; McLaren, D.G.; Whitelaw, C.B.; et al. Genome edited sheep and cattle. Transgenic Res. 2015, 24, 147–153. [Google Scholar] [CrossRef] [Green Version]
  12. Giannesini, B.; Vilmen, C.; Amthor, H.; Bernard, M.; Bendahan, D. Lack of myostatin impairs mechanical performance and ATP cost of contraction in exercising mouse gastrocnemius muscle in vivo. Am. J. Physiol. Endocrinol. Metab. 2013, 305, E33–E40. [Google Scholar] [CrossRef] [Green Version]
  13. Li, J.; Yang, C.; Huang, L.; Zeng, K.; Cao, X.; Gao, J. Inefficient ATP synthesis by inhibiting mitochondrial respiration causes lipids to decrease in MSTN-lacking muscles of loach Misgurnus anguillicaudatus. Funct. Integr. Genom. 2019, 19, 889–900. [Google Scholar] [CrossRef]
  14. Cogliati, S.; Lorenzi, I.; Rigoni, G.; Caicci, F.; Soriano, M.E. Regulation of mitochondrial electron transport chain assembly. J. Mol. Biol. 2018, 430, 4849–4873. [Google Scholar] [CrossRef]
  15. Schapira, A.H. Mitochondrial disease. Lancet 2006, 368, 70–82. [Google Scholar] [CrossRef]
  16. Rustin, P.; Chretien, D.; Bourgeron, T.; Gérard, B.; Rötig, A.; Saudubray, J.M.; Munnich, A. Biochemical and molecular investigations in respiratory chain deficiencies. Clin. Chim. Acta 1994, 228, 35–51. [Google Scholar] [CrossRef]
  17. Kadenbach, B.; Ramzan, R.; Moosdorf, R.; Vogt, S. The role of mitochondrial membrane potential in ischemic heart failure. Mitochondrion 2011, 11, 700–706. [Google Scholar] [CrossRef]
  18. Ploquin, C.; Chabi, B.; Fouret, G.; Vernus, B.; Feillet-Coudray, C.; Coudray, C.; Bonnieu, A.; Ramonatxo, C. Lack of myostatin alters intermyofibrillar mitochondria activity, unbalances redox status, and impairs tolerance to chronic repetitive contractions in muscle. Am. J. Physiol. Endocrinol. Metab. 2012, 302, E1000–E1008. [Google Scholar] [CrossRef]
  19. Baati, N.; Feillet-Coudray, C.; Fouret, G.; Vernus, B.; Goustard, B.; Coudray, C.; Lecomte, J.; Blanquet, V.; Magnol, L.; Bonnieu, A.; et al. Myostatin deficiency is associated with lipidomic abnormalities in skeletal muscles. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2017, 1862, 1044–1055. [Google Scholar] [CrossRef] [Green Version]
  20. Jeon, S.M. Regulation and function of AMPK in physiology and diseases. Exp. Mol. Med. 2016, 48, e245. [Google Scholar] [CrossRef] [Green Version]
  21. Horio, Y.; Hayashi, T.; Kuno, A.; Kunimoto, R. Cellular and molecular effects of sirtuins in health and disease. Clin. Sci. 2011, 121, 191–203. [Google Scholar] [CrossRef] [Green Version]
  22. Bost, F.; Kaminski, L. The metabolic modulator PGC-1α in cancer. Am. J. Cancer Res. 2019, 9, 198–211. [Google Scholar]
  23. Cantó, C.; Gerhart-Hines, Z.; Feige, J.N.; Lagouge, M.; Noriega, L.; Milne, J.C.; Elliott, P.J.; Puigserver, P.; Auwerx, J. AMPK regulates energy expenditure by modulating NAD+ metabolism and SIRT1 activity. Nature 2009, 458, 1056–1060. [Google Scholar] [CrossRef] [Green Version]
  24. Rodgers, J.T.; Lerin, C.; Haas, W.; Gygi, S.P.; Spiegelman, B.M.; Puigserver, P. Nutrient control of glucose homeostasis through a complex of PGC-1alpha and SIRT1. Nature 2005, 434, 113–118. [Google Scholar] [CrossRef]
  25. Feige, J.N.; Auwerx, J. Transcriptional coregulators in the control of energy homeostasis. Trends Cell Biol. 2007, 17, 292–301. [Google Scholar] [CrossRef]
  26. Yang, X.; Liu, Q.; Li, Y.; Tang, Q.; Wu, T.; Chen, L.; Pu, S.; Zhao, Y.; Zhang, G.; Huang, C.; et al. The diabetes medication canagliflozin promotes mitochondrial remodelling of adipocyte via the AMPK-Sirt1-Pgc-1α signalling pathway. Adipocyte 2020, 9, 484–494. [Google Scholar] [CrossRef]
  27. Hou, B.Y.; Zhao, Y.R.; Ma, P.; Xu, C.Y.; He, P.; Yang, X.Y.; Zhang, L.; Qiang, G.F.; Du, G.H. Hypoglycemic activity of puerarin through modulation of oxidative stress and mitochondrial function via AMPK. Chin. J. Nat. Med. 2020, 18, 818–826. [Google Scholar] [CrossRef]
  28. Lin, X.; Tang, M.; Tao, Y.; Li, L.; Liu, S.; Guo, L.; Li, Z.; Ma, X.; Xu, J.; Cao, Y. Epstein-Barr virus-encoded LMP1 triggers regulation of the ERK-mediated Op18/stathmin signaling pathway in association with cell cycle. Cancer Sci. 2012, 103, 993–999. [Google Scholar] [CrossRef]
  29. Deshpande, D.; Agarwal, N.; Fleming, T.; Gaveriaux-Ruff, C.; Klose, C.S.N.; Tappe-Theodor, A.; Kuner, R.; Nawroth, P. Loss of POMC-mediated antinociception contributes to painful diabetic neuropathy. Nat. Commun. 2021, 12, 426. [Google Scholar] [CrossRef]
  30. Višnjić, D.; Lalić, H.; Dembitz, V.; Tomić, B.; Smoljo, T. AICAr, a Widely Used AMPK Activator with Important AMPK-Independent Effects: A Systematic Review. Cells 2021, 10, 1095. [Google Scholar] [CrossRef]
  31. Handa, N.; Takagi, T.; Saijo, S.; Kishishita, S.; Takaya, D.; Toyama, M.; Terada, T.; Shirouzu, M.; Suzuki, A.; Lee, S.; et al. Structural basis for compound C inhibition of the human AMP-activated protein kinase α2 subunit kinase domain. Acta Crystallogr. D Biol. Crystallogr. 2011, 67, 480–487. [Google Scholar] [CrossRef]
  32. Lee, S.J. Extracellular regulation of myostatin: A molecular rheostat for muscle mass. Immunol. Endocr. Metab. Agents Med. Chem. 2010, 10, 183–194. [Google Scholar] [CrossRef] [Green Version]
  33. Zhang, Y.; Wang, Y.; Yulin, B.; Tang, B.; Wang, M.; Zhang, C.; Zhang, W.; Jin, J.; Li, T.; Zhao, R.; et al. CRISPR/Cas9-mediated sheep MSTN gene knockout and promote sSMSCs differentiation. J. Cell Biochem. 2018, 120, 1794–1806. [Google Scholar] [CrossRef]
  34. Gu, H.; Cao, Y.; Qiu, B.; Zhou, Z.; Deng, R.; Chen, Z.; Li, R.; Li, X.; Wei, Q.; Xia, X.; et al. Establishment and phenotypic analysis of an Mstn knockout rat. Biochem. Biophys. Res. Commun. 2016, 477, 115–122. [Google Scholar] [CrossRef] [Green Version]
  35. Xu, K.; Han, C.X.; Zhou, H.; Ding, J.M.; Xu, Z.; Yang, L.Y.; He, C.; Akinyemi, F.; Zheng, Y.M.; Qin, C.; et al. Effective MSTN gene knockout by AdV-delivered CRISPR/Cas9 in postnatal chick leg muscle. Int. J. Mol. Sci. 2020, 21, 2584. [Google Scholar] [CrossRef] [Green Version]
  36. Zhu, X.X.; Zhan, Q.M.; Wei, Y.Y.; Yan, A.F.; Feng, J.; Liu, L.; Lu, S.S.; Tang, D.S. CRISPR/Cas9-mediated MSTN disruption accelerates the growth of Chinese Bama pigs. Reprod. Domest. Anim. 2020, 55, 1314–1327. [Google Scholar] [CrossRef]
  37. Wang, X.; Niu, Y.; Zhou, J.; Zhu, H.; Ma, B.; Yu, H.; Yan, H.; Hua, J.; Huang, X.; Qu, L.; et al. CRISPR/Cas9-mediated MSTN disruption and heritable mutagenesis in goats causes increased body mass. Anim. Genet. 2018, 49, 43–51. [Google Scholar] [CrossRef]
  38. Whittemore, L.A.; Song, K.; Li, X.; Aghajanian, J.; Davies, M.; Girgenrath, S.; Hill, J.J.; Jalenak, M.; Kelley, P.; Knight, A.; et al. Inhibition of myostatin in adult mice increases skeletal muscle mass and strength. Biochem. Biophys. Res. Commun. 2003, 300, 965–971. [Google Scholar] [CrossRef]
  39. Fiems, L.O. Double muscling in cattle: Genes, husbandry, carcasses and meat. Animals 2012, 2, 472–506. [Google Scholar] [CrossRef]
  40. Lin, J.; Arnold, H.B.; Della-Fera, M.A.; Azain, M.J.; Hartzell, D.L.; Baile, C.A. Myostatin knockout in mice increases myogenesis and decreases adipogenesis. Biochem. Biophys. Res. Commun. 2002, 291, 701–706. [Google Scholar] [CrossRef]
  41. Luo, Z.B.; Luo, Q.R.; Xuan, M.F.; Han, S.Z.; Wang, J.X.; Guo, Q.; Choe, Y.G.; Jin, S.S.; Kang, J.D.; Yin, X.J. Comparison of internal organs between myostatin mutant and wild-type piglets. J. Sci. Food Agric. 2019, 99, 6788–6795. [Google Scholar] [CrossRef]
  42. Allen, D.L.; Hittel, D.S.; McPherron, A.C. Expression and function of myostatin in obesity, diabetes, and exercise adaptation. Med. Sci. Sports Exerc. 2011, 43, 1828–1835. [Google Scholar] [CrossRef] [Green Version]
  43. Choi, S.J.; Yablonka-Reuveni, Z.; Kaiyala, K.J.; Ogimoto, K.; Schwartz, M.W.; Wisse, B.E. Increased energy expenditure and leptin sensitivity account for low fat mass in myostatin-deficient mice. Am. J. Physiol. Endocrinol. Metab. 2011, 300, E1031–E1037. [Google Scholar] [CrossRef]
  44. Amthor, H.; Macharia, R.; Navarrete, R.; Schuelke, M.; Brown, S.C.; Otto, A.; Voit, T.; Muntoni, F.; Vrbóva, G.; Partridge, T.; et al. Lack of myostatin results in excessive muscle growth but impaired force generation. Proc. Natl. Acad. Sci. USA 2007, 104, 1835–1840. [Google Scholar] [CrossRef] [Green Version]
  45. Ljubicic, V.; Joseph, A.M.; Saleem, A.; Uguccioni, G.; Collu-Marchese, M.; Lai, R.Y.; Nguyen, L.M.; Hood, D.A. Transcriptional and post-transcriptional regulation of mitochondrial biogenesis in skeletal muscle: Effects of exercise and aging. Biochim. Biophys. Acta 2010, 1800, 223–234. [Google Scholar] [CrossRef]
  46. Hubbard, B.P.; Gomes, A.P.; Dai, H.; Li, J.; Case, A.W.; Considine, T.; Riera, T.V.; Lee, J.E.; E, S.Y.; Lamming, D.W.; et al. Evidence for a common mechanism of SIRT1 regulation by allosteric activators. Science 2013, 339, 1216–1219. [Google Scholar] [CrossRef] [Green Version]
  47. Nemoto, S.; Fergusson, M.M.; Finkel, T. SIRT1 functionally interacts with the metabolic regulator and transcriptional coactivator PGC-1{alpha}. J. Biol. Chem. 2005, 280, 16456–16460. [Google Scholar] [CrossRef] [Green Version]
  48. Ding, M.; Feng, N.; Tang, D.; Feng, J.; Li, Z.; Jia, M.; Liu, Z.; Gu, X.; Wang, Y.; Fu, F.; et al. Melatonin prevents Drp1-mediated mitochondrial fission in diabetic hearts through SIRT1-PGC1α pathway. J. Pineal. Res. 2018, 65, e12491. [Google Scholar] [CrossRef] [Green Version]
  49. Xue, H.; Li, P.; Luo, Y.; Wu, C.; Liu, Y.; Qin, X.; Huang, X.; Sun, C. Salidroside stimulates the Sirt1/PGC-1α axis and ameliorates diabetic nephropathy in mice. Phytomedicine 2019, 54, 240–247. [Google Scholar] [CrossRef]
  50. Fulco, M.; Cen, Y.; Zhao, P.; Hoffman, E.P.; McBurney, M.W.; Sauve, A.A.; Sartorelli, V. Glucose restriction inhibits skeletal myoblast differentiation by activating SIRT1 through AMPK-mediated regulation of Nampt. Dev. Cell 2008, 14, 661–673. [Google Scholar] [CrossRef] [Green Version]
  51. Wu, D.; Gu, M.; Wei, Z.; Bai, C.; Su, G.; Liu, X.; Zhao, Y.; Yang, L.; Li, G. Myostatin knockout regulates bile acid metabolism by promoting bile acid synthesis in cattle. Animals 2022, 12, 205. [Google Scholar] [CrossRef]
  52. Gao, L.; Yang, M.; Wei, Z.; Gu, M.; Yang, L.; Bai, C.; Wu, Y.; Li, G. MSTN mutant promotes myogenic differentiation by increasing demethylase TET1 expression via the SMAD2/SMAD3 pathway. Int. J. Biol. Sci. 2020, 16, 1324–1334. [Google Scholar] [CrossRef]
Figure 1. Production of myostatin knockout (Mstn-KO) mice mediated by CRISPR/Cas9 techniques. (a) gRNA sequence of the MSTN gene for CRISPR/Cas9. (b) Mutant Mstn genotypes of derived progenies, red indicates a missing base. (c) Representative images of muscles of Mstn-KO and WT mice. (d) Images of teased single muscle fibers for muscle fibers in Mstn-KO and WT mice. (e) Expression of MSTN protein in Mstn-KO and WT mice (n = 3).
Figure 1. Production of myostatin knockout (Mstn-KO) mice mediated by CRISPR/Cas9 techniques. (a) gRNA sequence of the MSTN gene for CRISPR/Cas9. (b) Mutant Mstn genotypes of derived progenies, red indicates a missing base. (c) Representative images of muscles of Mstn-KO and WT mice. (d) Images of teased single muscle fibers for muscle fibers in Mstn-KO and WT mice. (e) Expression of MSTN protein in Mstn-KO and WT mice (n = 3).
Ijms 23 13703 g001
Figure 2. Comparison of growth performance between Mstn-KO and WT mice. (a) Comparison of body weights between Mstn-KO and WT male mice from 3 to 10 weeks. Body weight was slightly higher in Mstn-KO male mice than WT controls after 6 weeks (n = 3). (b) Comparison of body weights between Mstn-KO and WT female mice from 3 to 10 weeks. Body weight was slightly higher in Mstn-KO female mice than WT controls after 7 weeks (n = 3). (c) Mstn mRNA expression in organs of Mstn-KO and WT mice (n = 3). All data are presented as mean ± SD. * p < 0.05, ** p < 0.01; t-tests were used to calculate the p-values.
Figure 2. Comparison of growth performance between Mstn-KO and WT mice. (a) Comparison of body weights between Mstn-KO and WT male mice from 3 to 10 weeks. Body weight was slightly higher in Mstn-KO male mice than WT controls after 6 weeks (n = 3). (b) Comparison of body weights between Mstn-KO and WT female mice from 3 to 10 weeks. Body weight was slightly higher in Mstn-KO female mice than WT controls after 7 weeks (n = 3). (c) Mstn mRNA expression in organs of Mstn-KO and WT mice (n = 3). All data are presented as mean ± SD. * p < 0.05, ** p < 0.01; t-tests were used to calculate the p-values.
Ijms 23 13703 g002
Figure 3. Mstn knockout decreases basal metabolic rate and body temperature. (a) Comparison of basal metabolic rate between Mstn-KO and WT mice (n = 3). (b) Body temperature in WT compared with Mstn-KO male and female mice (n = 1). All data are presented as mean ± SD. * p < 0.05; t-tests were used to calculate the p-values.
Figure 3. Mstn knockout decreases basal metabolic rate and body temperature. (a) Comparison of basal metabolic rate between Mstn-KO and WT mice (n = 3). (b) Body temperature in WT compared with Mstn-KO male and female mice (n = 1). All data are presented as mean ± SD. * p < 0.05; t-tests were used to calculate the p-values.
Ijms 23 13703 g003
Figure 4. Mstn knockout reduced ATP content and mitochondria activity. (a) ATP content in Mstn-KO and WT mice muscle (n = 3). (bf) Mitochondrial complexes I–V activity was analyzed by biochemical detection (n = 3). (g) Measurement of the mitochondrial membrane potential of Mstn-KO and WT mice (n = 3). (h) mRNA levels of mitochondrial activity gene by qPCR (n = 3). All data are presented as mean ± SD. * p < 0.05, ** p < 0.01; t-tests were used to calculate the p-values.
Figure 4. Mstn knockout reduced ATP content and mitochondria activity. (a) ATP content in Mstn-KO and WT mice muscle (n = 3). (bf) Mitochondrial complexes I–V activity was analyzed by biochemical detection (n = 3). (g) Measurement of the mitochondrial membrane potential of Mstn-KO and WT mice (n = 3). (h) mRNA levels of mitochondrial activity gene by qPCR (n = 3). All data are presented as mean ± SD. * p < 0.05, ** p < 0.01; t-tests were used to calculate the p-values.
Ijms 23 13703 g004
Figure 5. Key enzymes and metabolites in the tricarboxylic acid (TCA) cycle. (a) Citrate acid content of the initial step product in the TCA cycle (n = 3). (b) Citrate synthase activity in Mstn-KO and WT mice (n = 3). (c) α-ketoglutarate content in Mstn-KO and WT mice (n = 3). (d) Isocitrate dehydrogenase activity in Mstn-KO and WT mice (n = 3). All data are presented as mean ± SD. * p < 0.05, ** p < 0.01; t-tests were used to calculate the p-values.
Figure 5. Key enzymes and metabolites in the tricarboxylic acid (TCA) cycle. (a) Citrate acid content of the initial step product in the TCA cycle (n = 3). (b) Citrate synthase activity in Mstn-KO and WT mice (n = 3). (c) α-ketoglutarate content in Mstn-KO and WT mice (n = 3). (d) Isocitrate dehydrogenase activity in Mstn-KO and WT mice (n = 3). All data are presented as mean ± SD. * p < 0.05, ** p < 0.01; t-tests were used to calculate the p-values.
Ijms 23 13703 g005
Figure 6. Mstn knockout inhibited the AMPK/SIRT1/PGC1alpha pathway. (a) The expression of SIRT1 and pAMPK at the protein level in Mstn-KO and WT mice. (b) Gray intensity analysis of pAMPK/α-Tubulin (n = 3). (c) Gray intensity analysis of SIRT1/α-Tubulin (n = 3). (d) Acetylation level of PGC1α protein by co-immunoprecipitation in Mstn-KO and WT mice. (e) Gray intensity analysis of acetylation level of PGC1α (n = 3). All data are presented as mean ± SD. ** p < 0.01; t-tests were used to calculate the p-values.
Figure 6. Mstn knockout inhibited the AMPK/SIRT1/PGC1alpha pathway. (a) The expression of SIRT1 and pAMPK at the protein level in Mstn-KO and WT mice. (b) Gray intensity analysis of pAMPK/α-Tubulin (n = 3). (c) Gray intensity analysis of SIRT1/α-Tubulin (n = 3). (d) Acetylation level of PGC1α protein by co-immunoprecipitation in Mstn-KO and WT mice. (e) Gray intensity analysis of acetylation level of PGC1α (n = 3). All data are presented as mean ± SD. ** p < 0.01; t-tests were used to calculate the p-values.
Ijms 23 13703 g006
Figure 7. Expression of pAMPK and SIRT1 following treatment with AICAR and Compound C. (a) The expression of SIRT1 and pAMPK with AICAR treatment Mstn-KO and WT cells. (b,c) Quantitative analysis showing the expression of pAMPK and SIRT1 following treatment with AICAR (n = 3). (d) Citrate synthase (CS) activity with AICAR treatment Mstn-KO and WT cells (n = 3). (e) α-ketoglutarate acid dehydrogenase (α-KGDH) activity with AICAR treatment Mstn-KO and WT cells (n = 3). (f) Isocitrate dehydrogenase (ICDHm) activity with AICAR treatment Mstn-KO and WT cells (n = 3). (g) The expression of SIRT1 and pAMPK with Compound C treatment Mstn-KO and WT cells. (h,i) Quantitative analysis showing the expression of pAMPK and SIRT1 following treatment with Compound C (n = 3). (j) Citrate synthase (CS) activity with Compound C treatment Mstn-KO and WT cells (n = 3). (k) α-ketoglutarate acid dehydrogenase (α-KGDH) activity with Compound C treatment Mstn-KO and WT cells (n = 3). (l) Isocitrate dehydrogenase (ICDHm) activity with Compound C treatment Mstn-KO and WT cells (n = 3). (m) Pattern of MSTN knockdown affecting mitochondrial function through the AMPK/SIRT1/PGC1α pathway. All data are presented as mean ± SD. ns, non-significant p > 0.05; * p < 0.05; ** p < 0.01; t-tests were used to calculate the p-values.
Figure 7. Expression of pAMPK and SIRT1 following treatment with AICAR and Compound C. (a) The expression of SIRT1 and pAMPK with AICAR treatment Mstn-KO and WT cells. (b,c) Quantitative analysis showing the expression of pAMPK and SIRT1 following treatment with AICAR (n = 3). (d) Citrate synthase (CS) activity with AICAR treatment Mstn-KO and WT cells (n = 3). (e) α-ketoglutarate acid dehydrogenase (α-KGDH) activity with AICAR treatment Mstn-KO and WT cells (n = 3). (f) Isocitrate dehydrogenase (ICDHm) activity with AICAR treatment Mstn-KO and WT cells (n = 3). (g) The expression of SIRT1 and pAMPK with Compound C treatment Mstn-KO and WT cells. (h,i) Quantitative analysis showing the expression of pAMPK and SIRT1 following treatment with Compound C (n = 3). (j) Citrate synthase (CS) activity with Compound C treatment Mstn-KO and WT cells (n = 3). (k) α-ketoglutarate acid dehydrogenase (α-KGDH) activity with Compound C treatment Mstn-KO and WT cells (n = 3). (l) Isocitrate dehydrogenase (ICDHm) activity with Compound C treatment Mstn-KO and WT cells (n = 3). (m) Pattern of MSTN knockdown affecting mitochondrial function through the AMPK/SIRT1/PGC1α pathway. All data are presented as mean ± SD. ns, non-significant p > 0.05; * p < 0.05; ** p < 0.01; t-tests were used to calculate the p-values.
Ijms 23 13703 g007
Table 1. Organ weight of Mstn-KO and WT mice.
Table 1. Organ weight of Mstn-KO and WT mice.
HeartLiverSpleenLungKidneyThyroidPancreasBrainTestisOvary
KO (g)0.20 ± 0.031.71 ± 0.450.07 ± 0.010.20 ± 0.010.48 ± 0.000.21 ± 0.010.26 ± 0.040.39 ± 0.010.17 ± 0.010.02 ± 0.00
WT (g)0.14 ± 0.001.47 ± 0.220.09 ± 0.010.19 ± 0.010.40 ± 0.000.18 ± 0.010.26 ± 0.010.44 ± 0.010.21 ± 0.010.02 ± 0.00
%22.13−0.55−33.51−10.012.59−0.26−14.51−24.23−30.79−14.51
All values are presented as mean ± SD (n = 6). KO, Mstn-KO mice; WT, WT mice.
Table 2. The basic energy metabolism of Mstn-KO and WT mice.
Table 2. The basic energy metabolism of Mstn-KO and WT mice.
O2CO2RQWeight/gBMR
KO2.40 ± 0.471.65 ± 0.340.69 ± 0.0227.23 ± 0.581.36
WT2.57 ± 0.251.95 ± 0.260.76 ± 0.1422.15 ± 0.841.69
All values are presented as mean ± SD (n = 3). KO, Mstn-KO mice; WT, WT mice.
Table 3. Primers used for real-time PCR and genotyping PCR.
Table 3. Primers used for real-time PCR and genotyping PCR.
Gene NameSense (5′ to 3′)Anti-Sense (5′ to 3′)
TfamTGAAGCTTGTAAATGAGGCTTGGACGGATCGTTTCACACTTCGAC
NrfTTTGGCGCAGCACCTTTGGAGGCGGCAGCTCTGAATTAAC
CIppCACACCAAGCAGAGCCTACATCCAAGATGCCAAACTCTTG
GAPDHAAATGGTGAAGGTCGGTGTGAACCAACAATCTCCACTTTGCCACTG
Mstn-2exCAACAAAGTAGTAAAAGCCCAAACTTTGTCTGGCTTATGAGCAT
Mstn-3exAGTCAAGGTGACAGACACACCCGTGCTTGAATTCACAGTTTCGA
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Gu, M.; Wei, Z.; Wang, X.; Gao, Y.; Wang, D.; Liu, X.; Bai, C.; Su, G.; Yang, L.; Li, G. Myostatin Knockout Affects Mitochondrial Function by Inhibiting the AMPK/SIRT1/PGC1α Pathway in Skeletal Muscle. Int. J. Mol. Sci. 2022, 23, 13703. https://doi.org/10.3390/ijms232213703

AMA Style

Gu M, Wei Z, Wang X, Gao Y, Wang D, Liu X, Bai C, Su G, Yang L, Li G. Myostatin Knockout Affects Mitochondrial Function by Inhibiting the AMPK/SIRT1/PGC1α Pathway in Skeletal Muscle. International Journal of Molecular Sciences. 2022; 23(22):13703. https://doi.org/10.3390/ijms232213703

Chicago/Turabian Style

Gu, Mingjuan, Zhuying Wei, Xueqiao Wang, Yang Gao, Dong Wang, Xuefei Liu, Chunling Bai, Guanghua Su, Lei Yang, and Guangpeng Li. 2022. "Myostatin Knockout Affects Mitochondrial Function by Inhibiting the AMPK/SIRT1/PGC1α Pathway in Skeletal Muscle" International Journal of Molecular Sciences 23, no. 22: 13703. https://doi.org/10.3390/ijms232213703

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop