Transcriptional Response in a Sepsis Mouse Model Reflects Transcriptional Response in Sepsis Patients
Abstract
1. Introduction
2. Results
2.1. Microarray Gene Expression Profiling
2.2. Functional Microarray Analysis
2.3. Comparison of Published Lists of Human Differentially Expressed Genes with Mouse Differentially Expressed Genes
2.4. LincRNA Study
3. Discussion
4. Conclusions
5. Materials and Methods
5.1. Mice and Experimental Procedure
5.2. RNA Isolation and cDNA Preparation for Real-Time RT-qPCR Validation
5.3. Gene Expression Microarray
5.4. Statistical Analyses
5.5. Functional Annotation and Enrichment of Functional Terms
5.6. Comparison of Published Lists of Human Differentially Expressed Genes with Mouse Differentially Expressed Genes
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Singer, M.; Deutschman, C.S.; Seymour, C.W.; Shankar-Hari, M.; Annane, D.; Bauer, M.; Bellomo, R.; Bernard, G.R.; Chiche, J.D.; Coopersmith, C.M.; et al. The Third International Consensus Definitions for Sepsis and Septic Shock (Sepsis-3). JAMA 2016, 315, 801–810. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nedeva, C.; Menassa, J.; Puthalakath, H. Sepsis: Inflammation Is a Necessary Evil. Front. Cell Dev. Biol. 2019, 7, 108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hotchkiss, R.S.; Monneret, G.; Payen, D. Sepsis-induced immunosuppression: From cellular dysfunctions to immunotherapy. Nat. Rev. Immunol. 2013, 13, 862–874. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rubio, I.; Osuchowski, M.F.; Shankar-Hari, M.; Skirecki, T.; Winkler, M.S.; Lachmann, G.; La Rosee, P.; Monneret, G.; Venet, F.; Bauer, M.; et al. Current gaps in sepsis immunology: New opportunities for translational research. Lancet Infect. Dis. 2019, 19, e422–e436. [Google Scholar] [CrossRef] [Scilit]
- Ono, S.; Tsujimoto, H.; Hiraki, S.; Aosasa, S. Mechanisms of sepsis-induced immunosuppression and immunological modification therapies for sepsis. Ann. Gastroenterol. Surg. 2018, 2, 351–358. [Google Scholar] [CrossRef] [Scilit]
- Hamers, L.; Kox, M.; Pickkers, P. Sepsis-induced immunoparalysis: Mechanisms, markers, and treatment options. Minerva Anestesiol 2015, 81, 426–439. [Google Scholar]
- Grondman, I.; Pirvu, A.; Riza, A.; Ioana, M.; Netea, M.G. Biomarkers of inflammation and the etiology of sepsis. Biochem. Soc. Trans. 2020, 48, 1–14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Davis, J.S.; He, V.; Anstey, N.M.; Condon, J.R. Long term outcomes following hospital admission for sepsis using relative survival analysis: A prospective cohort study of 1092 patients with 5 year follow up. PLoS ONE 2014, 9, e112224. [Google Scholar]
- Van der Poll, T.; van de Veerdonk, F.L.; Scicluna, B.P.; Netea, M.G. The immunopathology of sepsis and potential therapeutic targets. Nat. Rev. Immunol. 2017, 17, 407–420. [Google Scholar] [CrossRef] [Scilit]
- Stephen, A.H.; Montoya, R.L.; Aluisio, A.R. Sepsis and Septic Shock in Low- and Middle-Income Countries. Surg. Infect. 2020, 21, 571–578. [Google Scholar] [CrossRef] [Scilit]
- Salomao, R.; Ferreira, B.L.; Salomao, M.C.; Santos, S.S.; Azevedo, L.C.P.; Brunialti, M.K.C. Sepsis: Evolving concepts and challenges. Braz. J. Med. Biol. Res. 2019, 52, e8595. [Google Scholar] [CrossRef] [Scilit]
- Rudd, K.E.; Johnson, S.C.; Agesa, K.M.; Shackelford, K.A.; Tsoi, D.; Kievlan, D.R.; Colombara, D.V.; Ikuta, K.S.; Kissoon, N.; Finfer, S.; et al. Global, regional, and national sepsis incidence and mortality, 1990–2017: Analysis for the Global Burden of Disease Study. Lancet 2020, 395, 200–211. [Google Scholar] [CrossRef] [Scilit]
- Stortz, J.A.; Raymond, S.L.; Mira, J.C.; Moldawer, L.L.; Mohr, A.M.; Efron, P.A. Murine Models of Sepsis and Trauma: Can We Bridge the Gap? ILAR J. 2017, 58, 90–105. [Google Scholar] [CrossRef] [Scilit]
- Korneev, K.V. Mouse Models of Sepsis and Septic Shock. Mol. Biol. 2019, 53, 704–717. [Google Scholar] [CrossRef] [Scilit]
- Remick, D.G.; Newcomb, D.E.; Bolgos, G.L.; Call, D.R. Comparison of the mortality and inflammatory response of two models of sepsis: Lipopolysaccharide vs. cecal ligation and puncture. Shock 2000, 13, 110–116. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Remick, D.G.; Ward, P.A. Evaluation of endotoxin models for the study of sepsis. Shock 2005, 24 (Suppl. S1), 7–11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Deitch, E.A. Rodent models of intra-abdominal infection. Shock 2005, 24 (Suppl. S1), 19–23. [Google Scholar] [CrossRef] [Scilit]
- van der Poll, T. Preclinical sepsis models. Surg. Infect. 2012, 13, 287–292. [Google Scholar] [CrossRef] [Scilit]
- Nemzek, J.A.; Hugunin, K.M.; Opp, M.R. Modeling sepsis in the laboratory: Merging sound science with animal well-being. Comp. Med. 2008, 58, 120–128. [Google Scholar]
- Fink, M.P. Animal models of sepsis. Virulence 2014, 5, 143–153. [Google Scholar] [CrossRef] [Scilit]
- Lakshmikanth, C.L.; Jacob, S.P.; Chaithra, V.H.; de Castro-Faria-Neto, H.C.; Marathe, G.K. Sepsis: In search of cure. Inflamm. Res. 2016, 65, 587–602. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Buras, J.A.; Holzmann, B.; Sitkovsky, M. Animal models of sepsis: Setting the stage. Nat. Rev. Drug Discov. 2005, 4, 854–865. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Poli-de-Figueiredo, L.F.; Garrido, A.G.; Nakagawa, N.; Sannomiya, P. Experimental models of sepsis and their clinical relevance. Shock 2008, 30 (Suppl. S1), 53–59. [Google Scholar] [CrossRef] [Scilit]
- Hotchkiss, R.S.; Tinsley, K.W.; Swanson, P.E.; Grayson, M.H.; Osborne, D.F.; Wagner, T.H.; Cobb, J.P.; Coopersmith, C.; Karl, I.E. Depletion of dendritic cells, but not macrophages, in patients with sepsis. J. Immunol. 2002, 168, 2493–2500. [Google Scholar] [CrossRef] [Scilit]
- Yan, X.; Tu, H.; Liu, Y.; Chen, T.; Cao, J. Interleukin-17D Aggravates Sepsis by Inhibiting Macrophage Phagocytosis. Crit. Care Med. 2020, 48, e58–e65. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Davenport, E.E.; Burnham, K.L.; Radhakrishnan, J.; Humburg, P.; Hutton, P.; Mills, T.C.; Rautanen, A.; Gordon, A.C.; Garrard, C.; Hill, A.V.; et al. Genomic landscape of the individual host response and outcomes in sepsis: A prospective cohort study. Lancet Respir. Med. 2016, 4, 259–271. [Google Scholar] [CrossRef] [Scilit]
- Fairfax, B.P.; Humburg, P.; Makino, S.; Naranbhai, V.; Wong, D.; Lau, E.; Jostins, L.; Plant, K.; Andrews, R.; McGee, C.; et al. Innate immune activity conditions the effect of regulatory variants upon monocyte gene expression. Science 2014, 343, 1246949. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Godec, J.; Tan, Y.; Liberzon, A.; Tamayo, P.; Bhattacharya, S.; Butte, A.J.; Mesirov, J.P.; Haining, W.N. Compendium of Immune Signatures Identifies Conserved and Species-Specific Biology in Response to Inflammation. Immunity 2016, 44, 194–206. [Google Scholar] [CrossRef] [Scilit]
- Tang, B.M.; McLean, A.S.; Dawes, I.W.; Huang, S.J.; Lin, R.C. Gene-expression profiling of peripheral blood mononuclear cells in sepsis. Crit. Care Med. 2009, 37, 882–888. [Google Scholar] [CrossRef] [Scilit]
- Pena, O.M.; Hancock, D.G.; Lyle, N.H.; Linder, A.; Russell, J.A.; Xia, J.; Fjell, C.D.; Boyd, J.H.; Hancock, R.E. An Endotoxin Tolerance Signature Predicts Sepsis and Organ Dysfunction at Initial Clinical Presentation. EBioMedicine 2014, 1, 64–71. [Google Scholar] [CrossRef] [Scilit]
- Del Fresno, C.; Garcia-Rio, F.; Gomez-Pina, V.; Soares-Schanoski, A.; Fernandez-Ruiz, I.; Jurado, T.; Kajiji, T.; Shu, C.; Marin, E.; Gutierrez del Arroyo, A.; et al. Potent phagocytic activity with impaired antigen presentation identifying lipopolysaccharide-tolerant human monocytes: Demonstration in isolated monocytes from cystic fibrosis patients. J. Immunol. 2009, 182, 6494–6507. [Google Scholar] [CrossRef] [Scilit]
- Kim, H.K.; Missiakas, D.; Schneewind, O. Mouse models for infectious diseases caused by Staphylococcus aureus. J. Immunol. Methods 2014, 410, 88–99. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rittirsch, D.; Hoesel, L.M.; Ward, P.A. The disconnect between animal models of sepsis and human sepsis. J. Leukoc. Biol. 2007, 81, 137–143. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guillon, A.; Preau, S.; Aboab, J.; Azabou, E.; Jung, B.; Silva, S.; Textoris, J.; Uhel, F.; Vodovar, D.; Zafrani, L.; et al. Preclinical septic shock research: Why we need an animal ICU. Ann. Intensive Care 2019, 9, 66. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Seok, J.; Warren, H.S.; Cuenca, A.G.; Mindrinos, M.N.; Baker, H.V.; Xu, W.; Richards, D.R.; McDonald-Smith, G.P.; Gao, H.; Hennessy, L.; et al. Genomic responses in mouse models poorly mimic human inflammatory diseases. Proc. Natl. Acad. Sci. USA 2013, 110, 3507–3512. [Google Scholar] [CrossRef] [Scilit]
- Takao, K.; Miyakawa, T. Genomic responses in mouse models greatly mimic human inflammatory diseases. Proc. Natl. Acad. Sci. USA 2015, 112, 1167–1172. [Google Scholar] [CrossRef] [Scilit]
- Hotchkiss, R.S.; Swanson, P.E.; Freeman, B.D.; Tinsley, K.W.; Cobb, J.P.; Matuschak, G.M.; Buchman, T.G.; Karl, I.E. Apoptotic cell death in patients with sepsis, shock, and multiple organ dysfunction. Crit. Care Med. 1999, 27, 1230–1251. [Google Scholar] [CrossRef] [Scilit]
- Barish, G.D.; Yu, R.T.; Karunasiri, M.; Ocampo, C.B.; Dixon, J.; Benner, C.; Dent, A.L.; Tangirala, R.K.; Evans, R.M. Bcl-6 and NF-kappaB cistromes mediate opposing regulation of the innate immune response. Genes Dev. 2010, 24, 2760–2765. [Google Scholar] [CrossRef] [Scilit]
- Nazari-Jahantigh, M.; Wei, Y.; Noels, H.; Akhtar, S.; Zhou, Z.; Koenen, R.R.; Heyll, K.; Gremse, F.; Kiessling, F.; Grommes, J.; et al. MicroRNA-155 promotes atherosclerosis by repressing Bcl6 in macrophages. J. Clin. Investig. 2012, 122, 4190–4202. [Google Scholar] [CrossRef] [Scilit]
- Toney, L.M.; Cattoretti, G.; Graf, J.A.; Merghoub, T.; Pandolfi, P.P.; Dalla-Favera, R.; Ye, B.H.; Dent, A.L. BCL-6 regulates chemokine gene transcription in macrophages. Nat. Immunol. 2000, 1, 214–220. [Google Scholar] [CrossRef] [Scilit]
- Zhang, H.; Qi, X.; Wu, J.; Huang, X.; Zhang, A.; Chen, S.; Ding, X.; Chen, S.; Le, S.; Zou, Y.; et al. BCL6 inhibitor FX1 attenuates inflammatory responses in murine sepsis through strengthening BCL6 binding affinity to downstream target gene promoters. Int. Immunopharmacol. 2019, 75, 105789. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stortz, J.A.; Hollen, M.K.; Nacionales, D.C.; Horiguchi, H.; Ungaro, R.; Dirain, M.L.; Wang, Z.; Wu, Q.; Wu, K.K.; Kumar, A.; et al. Old Mice Demonstrate Organ Dysfunction as well as Prolonged Inflammation, Immunosuppression, and Weight Loss in a Modified Surgical Sepsis Model. Crit. Care Med. 2019, 47, e919–e929. [Google Scholar] [CrossRef] [Scilit]
- Bhatia, M.; He, M.; Zhang, H.; Moochhala, S. Sepsis as a model of SIRS. Front. Biosci. 2009, 14, 4703–4711. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Park, J.W.; Lee, S.J.; Kim, J.E.; Kang, M.J.; Bae, S.J.; Choi, Y.J.; Gong, J.E.; Kim, K.S.; Jung, Y.S.; Cho, J.Y.; et al. Comparison of response to LPS-induced sepsis in three DBA/2 stocks derived from different sources. Lab. Anim. Res. 2021, 37, 2. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schuurman, A.R.; Reijnders, T.D.Y.; Kullberg, R.F.J.; Butler, J.M.; van der Poll, T.; Wiersinga, W.J. Sepsis: Deriving biological meaning and clinical applications from high-dimensional data. Intensive Care Med. Exp. 2021, 9, 27. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McLean, C.Y.; Bristor, D.; Hiller, M.; Clarke, S.L.; Schaar, B.T.; Lowe, C.B.; Wenger, A.M.; Bejerano, G. GREAT improves functional interpretation of cis-regulatory regions. Nat. Biotechnol. 2010, 28, 495–501. [Google Scholar] [CrossRef] [Scilit]
- Subramanian, A.; Tamayo, P.; Mootha, V.K.; Mukherjee, S.; Ebert, B.L.; Gillette, M.A.; Paulovich, A.; Pomeroy, S.L.; Golub, T.R.; Lander, E.S.; et al. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. USA 2005, 102, 15545–15550. [Google Scholar]







| Gène | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
|---|---|---|
| β−Actin | TGGAATCCTGTGGCATCCATGAAACC | TAAAACGCAGCTCAGTAACAGTCCG |
| TNF | GGCAGGTCTACTTTGGAGTCATTGC | ACATTCGAGGCTCCAGTGAATTCGG |
| IL6 | TGGAGTACCATAGCTACCTGGAG | TCCTTAGCCACTCCTTCTGTGACT |
| IL1β | GTGGTTCGAGGCCTAATAGGCT | AGCTGCTTCAGACACCTTGCA |
| IL10 | GCCCTTTGCTATGGTGTCCTTT | TGAGCTGCTGCAGGAATGATC |
| Davenport-Discovery Cohort | Davenport-Validation Cohort | Fairfax- Naive vs. 2 h LPS Stimulated Monocytes | Fairfax- Naive vs. 24 h LPS Stimulated Monocytes | Fairfax- 2 h LPS vs. 24 h LPS Stimulated Monocytes | |
|---|---|---|---|---|---|
| Chip/Paper | Illumina Human-HT-12 version 4 Expression BeadChips with 47,231 probes | Illumina Human-HT-12 version 4 Expression BeadChips with 47,231 probes | Illumina HumanHT-12 v4 BeadChip gene expression array platform with 47,231 probes | Illumina HumanHT-12 v4 BeadChip gene expression array platform with 47,231 probes | Illumina HumanHT-12 v4 BeadChip gene expression array platform with 47,231 probes |
| Number of samples | 270 patients with sepsis due to pneumonia and organ dysfunction | 114 patients with sepsis due to pneumonia and organ dysfunction | 228 individuals/LPS (E. coli) for 2 h | 228 individuals/LPS (E. coli) for 24 h | 228 individuals/LPS (E. coli) for 2 h or 24 h |
| Statistic | linear regression using limma | linear regression using limma | linear regression using limma | linear regression using limma | linear regression using limma |
| Cut-off | false discovery rate of 0.05 and 1.5-fold change in expression between the two groups | false discovery rate of 0.05 and 1.5-fold change in expression between the two groups | Adjusted p value and cut-off fold change of +/−0.5 | Adjusted p value and cut-off fold change of +/−0.5 | Adjusted p value and cut-off fold change of +/−0.5 |
| Gene Differentially expressed | 3080 (331) | 2572 | 2489 | 2085 | 2913 |
| Upregulated genes | 821 (164) | 1117 | 1564 | 1116 | 1169 |
| Downregulated genes | 2260 (167) | 1463 | 925 | 969 | 1744 |
| Common Up/Down | 1 (0) | 8 | 0 | 0 | 0 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rosier, F.; Nuñez, N.F.; Torres, M.; Loriod, B.; Rihet, P.; Pradel, L.C. Transcriptional Response in a Sepsis Mouse Model Reflects Transcriptional Response in Sepsis Patients. Int. J. Mol. Sci. 2022, 23, 821. https://doi.org/10.3390/ijms23020821
Rosier F, Nuñez NF, Torres M, Loriod B, Rihet P, Pradel LC. Transcriptional Response in a Sepsis Mouse Model Reflects Transcriptional Response in Sepsis Patients. International Journal of Molecular Sciences. 2022; 23(2):821. https://doi.org/10.3390/ijms23020821
Chicago/Turabian StyleRosier, Florian, Nicolas Fernandez Nuñez, Magali Torres, Béatrice Loriod, Pascal Rihet, and Lydie C. Pradel. 2022. "Transcriptional Response in a Sepsis Mouse Model Reflects Transcriptional Response in Sepsis Patients" International Journal of Molecular Sciences 23, no. 2: 821. https://doi.org/10.3390/ijms23020821
APA StyleRosier, F., Nuñez, N. F., Torres, M., Loriod, B., Rihet, P., & Pradel, L. C. (2022). Transcriptional Response in a Sepsis Mouse Model Reflects Transcriptional Response in Sepsis Patients. International Journal of Molecular Sciences, 23(2), 821. https://doi.org/10.3390/ijms23020821

