Repellency Mechanism of Natural Guar Gum-Based Film Incorporated with Citral against Brown Planthopper, Nilaparvata lugens (Stål) (Hemiptera: Delphacidae)
Abstract
:1. Introduction
2. Results
2.1. The Repellency Effect of GC Film to BPH
2.2. EPG Analysis
2.3. Transcriptome Analysis
2.3.1. Illumina Sequencing and Sequence Assembly
2.3.2. Differentially Expressed Genes Analysis
2.3.3. Functional Enrichment Analysis
2.3.4. Repellency-Related Genes Analysis and qRT-PCR Validation
3. Discussion
4. Materials and Methods
4.1. Plants and Insects
4.2. Repellent Activity Test
4.2.1. Feeding Choice Test
4.2.2. Olfactory Reaction Analysis
4.3. EPG Analysis
4.4. Transcriptome Resequencing, Gene Expression, and Real-Time PCR Analysis
4.4.1. RNA Extraction
4.4.2. Library Construction and Sequencing
4.4.3. Illumina Reads Processing and Assembly
4.4.4. Differential Expression Genes Analysis
4.4.5. Annotation of Unigenes
4.4.6. Repellency-Related Genes Analysis
4.4.7. Validation by Quantitative Real-Time PCR
4.5. Statistics Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Liao, X.; Peng, F.X.; Pei, P.G.; Hu, W.; Li, J.H. The current susceptibilities of brown planthopper Nilaparvata lugens to triflumezopyrim and other frequently used insecticides in China. Insect Sci. 2021, 28, 115–126. [Google Scholar] [CrossRef]
- Londingkene, J.A.; Trisyono, Y.A.; Witjaksono, G.; Martono, E. Resistance to imidacloprid and effect of three synergists on the resistance level of brown planthopper. AIP Conf. Proc. 2016, 1755, 140008. [Google Scholar]
- Jeong, I.H.; Jeon, S.W.; Lee, S.K.; Park, B.; Park, S.K.; Lee, S.B.; Choi, N.J.; Lee, S.W.; Lee, S.H.; Kwon, D.H. Insecticide cross-resistanceand developmental characteristics on the two rice varieties, ‘chinnong’ and ‘chuchung’, of the imidacloprid-resistant brown planthopper. Korean J. Pestic. Sci. 2017, 21, 381–388. [Google Scholar] [CrossRef]
- Matsumura, M.; Sanada-Morimura, S.; Otuka, A.; Sonoda, S.; Thanh, D.V.; Chien, H.V.; Tuong, P.V.; Loc, P.M.; Liu, Z.W.; Zhu, Z.R.; et al. Insecticide susceptibilities of the two rice planthoppers Nilaparvata lugens and Sogatella furcifera in East Asia, the Red River Delta, and the Mekong Delta. Pest Manag. Sci. 2018, 74, 456–464. [Google Scholar] [CrossRef]
- Fang, Y.; Xie, P.; Dong, C.H.; Han, Y.Q.; Tang, T.; Liu, Y.; Zhong, J.; Bai, L.Y.; Zhou, X.M. Cross-resistance and baseline susceptibility of brown planthopper Nilaparvata lugens (Hemiptera: Delphacidae) from China to Cycloxaprid. J. Econ. Entomol. 2018, 111, 2359–2363. [Google Scholar] [CrossRef]
- Pandian, S.; Ramesh, M. Development of pesticide resistance in pests: A key challenge to the crop protection and environmental safety. In Pesticides in Crop Production: Physiological and Biochemical Action; Srivastava, P.K., Singh, V.P., Singh, A., Singh, S., Prasad, S.M., Tripathi, D.K., Chauhan, D.K., Eds.; Wiley: New York, NY, USA, 2020; pp. 1–13. [Google Scholar]
- Upadhayay, J.; Rana, M.; Juyal, V.; Bisht, S.S.; Joshi, R. Impact of pesticide exposure and associated health effects. In Pesticides in Crop Production: Physiological and Biochemical Action; Srivastava, P.K., Singh, V.P., Singh, A., Singh, S., Prasad, S.M., Tripathi, D.K., Chauhan, D.K., Eds.; Wiley: New York, NY, USA, 2020; pp. 69–88. [Google Scholar]
- Isman, M.B.; Miresmailli, S. Plant essential oils as repellents and deterrents to agricultural pests. In Recent Developments in Invertebrate Repellents; Paluch, G., Coats, J.R., Eds.; ACS Symposium Series; American Chemical Society: Washington, DC, USA, 2011; pp. 67–77. [Google Scholar]
- Miresmailli, S.; Isman, M.B. Botanical insecticides inspired by plant-herbivore chemical interactions. Trends Plant Sci. 2014, 19, 29–35. [Google Scholar] [CrossRef] [PubMed]
- Si, W.; Ni, X.; Gong, J.; Yu, H.; Tsao, R.; Han, Y. Antimicrobial activity of essential oils and structurally related synthetic food additives towards Clostridium perfringens. J. Appl. Microbiol. 2009, 106, 213–220. [Google Scholar] [CrossRef]
- Amna, A.S.; Suzan, A.K. Chemical and antimicrobial studies of monoterpene: Citral. Pestic. Biochem. Physiol. 2010, 98, 89–93. [Google Scholar]
- Oyedele, A.O.; Gbolade, A.A.; Sosan, M.B.; Adewoyin, F.B.; Soyelu, O.L.; Orafidiya, O.O. Formulation of an effective mosquito-repellent topical product from lemongrass oil. Phytomedicine 2002, 9, 259–262. [Google Scholar] [CrossRef]
- Hao, H.; Wei, J.; Dai, J.; Du, J. Host-seeking and blood-feeding behavior of Aedes albopictus (Diptera: Culicidae) exposed to vapors of geraniol, citral, citronellal, eugenol, or anisaldehyde. J. Med. Entomol. 2008, 45, 533–539. [Google Scholar] [CrossRef] [PubMed]
- Tak, J.H.; Isman, M.B. Metabolism of citral, the major constituent of lemongrass oil, in the cabbage looper, trichoplusia ni, and effects of enzyme inhibitors on toxicity and metabolism. Pestic. Biochem. Physiol. 2016, 133, 20–25. [Google Scholar] [CrossRef]
- Gao, X.B.; Guo, C.; Li, M.; Li, R.Y.; Wu, X.M.; Hu, A.N.; Hu, X.F.; Mo, F.X.; Wu, S. Physicochemical properties and bioactivity of a new guar gum-based film incorporated with citral to brown planthopper, Nilaparvata lugens (Stål) (hemiptera: Delphacidae). Molecules 2020, 25, 2044. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.H.; Schneidmiller, G.R.; Hoover, D.R. Essential oils and their compositions as spatial repellents for pestiferous social wasps. Pest Manag. Sci. 2013, 69, 542–552. [Google Scholar] [CrossRef]
- Zhang, Z.; Guo, S.S.; Zhang, W.J.; Geng, Z.F.; Liang, J.Y.; Du, S.S.; Wang, C.F.; Deng, Z.W. Essential oil and polyacetylenes from Artemisia ordosica and their bioactivities against Tribolium castaneum Herbst (Coleoptera: Tenebrionidae). Ind. Crops Prod. 2017, 100, 132–137. [Google Scholar] [CrossRef]
- Benelli, G.; Pavela, R.; Rakotosaona, R.; Nzekouee, F.K.; Nicolettif, M.; Maggi, F. Insecticidal and mosquito repellent efficacy of the essential oils from stem bark and wood of Hazomalania voyronii. J. Ethnopharmacol. 2019, 248, 112333. [Google Scholar] [CrossRef]
- Yakhlef, G.; Hambaba, L.; Pinto, D.; Silva, A.M.S. Chemical composition and insecticidal, repellent and antifungal activities of essential oil of Mentha rotundifolia (L.) from Algeria. Ind. Crops Prod. 2020, 158, 11298. [Google Scholar] [CrossRef]
- Pang, X.; Feng, Y.-X.; Qi, X.-J.; Xi, C.; Shu, S.; Du, S.-S. Toxicity and repellent activity of essential oil from Mentha piperita Linn. leaves and its major monoterpenoids against three stored product insects. Environ. Sci. Pollut. Res. 2020, 27, 7618–7627. [Google Scholar] [CrossRef]
- Babarinde, S.A.; Olaniran, O.A.; Ottun, A.T.; Oderinde, A.E.; Adeleye, A.D.; Ajiboye, O.; Dawodu, E.O. Chemical composition and repellent potentials of two essential oils against larger grain borer, Prostephanus truncatus (Horn.) (Coleoptera: Bostrichidae). Biocatal. Agric. Biotechnol. 2021, 32, 101937. [Google Scholar] [CrossRef]
- Fouad, H.A.; Tavares, W.; Zanuncio, J.C. Toxicity and repellent activity of monoterpene enantiomers to the rice weevils (Sitophilus oryzae). Pest Manag. Sci. 2021, 77, 3500–3507. [Google Scholar] [CrossRef]
- Pratiwi, M.A.M.; Purwat. The Repellent Activity Test of Rosemary Leaf (Rosmarinus officinalis L.) Essential Oil Gel Preparations Influence on Aedes aegypti Mosquito. J. Phys. Conf. Ser. 2021, 1788, 012016. [Google Scholar] [CrossRef]
- Seo, B.Y.; Kwon, Y.H.; Jung, J.K.; Kim, G.H. Electrical penetration graphic waveforms in relation to the actual positions of the stylet tips of Nilaparvata lugens in rice tissue. J. Asia-Pac. Entomol. 2009, 12, 89–95. [Google Scholar] [CrossRef]
- He, Y.-P.; Chen, L.; Chen, J.-M.; Zhang, J.-F.; Chen, L.-Z.; Shen, J.-L.; Zhu, Y.-C. Electrical penetration graph evidence that pymetrozine toxicity to the rice brown planthopper is by inhibition of phloem feeding. Pest Manag. Sci. 2011, 67, 483–491. [Google Scholar] [CrossRef] [PubMed]
- Tripathi, A.; Upadhyay, S.; Bhuiyan, M.; Bhattacharya, P. A review on prospects of essential oils as biopesticide in insect-pest management. J. Pharmacogn. Phytother. 2009, 1, 52–63. [Google Scholar]
- Garboui, S.S.; Jaenson, T.G.; Borg-Karlson, A.K.; Pålsson, K. Repellency of methyl jasmonate to Ixodes ricinus nymphs (Acari: Ixodidae). Exp. Appl. Acarol. 2007, 42, 209–215. [Google Scholar] [CrossRef] [PubMed]
- Soares, S.F.; Borges, L.M.; Braga, R.D.S.; Ferreira, L.L.; Louly, C.C.; Tresvenzol, L.M.; Paula, J.R.D.; Ferri, P.H. Repellent activity of plant-derived compounds against Amblyomma cajennense (Acari: Ixodidae) nymphs. Vet. Parasitol. 2010, 167, 67–73. [Google Scholar] [CrossRef] [PubMed]
- Yang, K.; Wang, C.-F.; You, C.-X.; Geng, Z.-F.; Sun, R.-Q.; Guo, S.-S.; Du, S.-S.; Liu, Z.-L.; Deng, Z.-W. Bioactivity of essential oil of Litsea cubeba from China and its main compounds against two stored product insects. J. Asia-Pac. Entomol. 2014, 17, 459–466. [Google Scholar] [CrossRef] [Green Version]
- Wu, H.; Fu, C.-C.; Yu, D.-D.; Feng, J.-T.; Zhang, X.; Ma, Z.-Q. Repellent activity screening of 11 kinds of essential oils against Aedes albopictus Skuse: Microcapsule preparation of Herba Schizonepetae oil and repellent bioassay on hand skin. Trans. R. Soc. Trop. Med. Hyg. 2013, 107, 471–479. [Google Scholar] [CrossRef]
- Pascual-Villalobos, M.J.; Canto-Tejero, M.; Vallejo, R.; Guirao, P.; Rodriguez-Rojo, S.; Cocero, M.J. Use of nanoemulsions of plant essential oils as aphid repellents. Ind. Crops Prod. 2017, 110, 45–57. [Google Scholar] [CrossRef]
- Diabate, S.; Martin, T.; Murungi, L.K.; Fiaboe, K.K.M.; Subramanian, S.; Wesonga, J.; Deletre, E. Repellent activity of Cymbopogon citratus and Tagetes minuta and their specific volatiles against Megalurothrips sjostedti. J. Appl. Entomol. 2019, 143, 855–866. [Google Scholar] [CrossRef]
- Zheng, F.; Li, T.-T.; Xu, H.-H.; Hu, P.-T.; Wang, R.-F.; Zhang, Z.-X.; Jia, J.-L. Long-lasting repellent activities of eco-friendly polyurethane system for controlled citral against melon fly. Crop Prot. 2021, 148, 105745. [Google Scholar] [CrossRef]
- Nerio, L.S.; Olivero-Verbel, J.; Stashenko, E. Repellent activity of essential oils: A review. Bioresour. Technol. 2009, 101, 372–378. [Google Scholar] [CrossRef] [PubMed]
- Moore, S.J.; Lenglet, A.; Hill, N. Plant-Based Insect Repellents, in Insect Repellents: Principles, Methods and Uses; Debboun, M., Frances, S.P., Strickman, D., Eds.; CRC Press: New York, NY, USA, 2007; pp. 275–303. [Google Scholar]
- Manh, H.D.; Tuyet, O.T. Larvicidal and repellent activity of Mentha arvensis L. essential oil against Aedes aegypti. Insects 2020, 11, 198. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rob WHM van Tol Swarts, H.J.; van der Linden, A.; Visser, J.H. Repellence of the red bud borer Resseliella oculiperda from grafted apple trees by impregnation of rubber budding strips with essential oils. Pest Manag. Sci. 2007, 63, 483–490. [Google Scholar]
- Youssef, N.N.; Oliver, J.B.; Ranger, C.M.; Reding, M.E.; Moyseenko, J.J.; Klein, M.G.; Pappas, R.S. Field evaluation of essential oils for reducing attraction by the Japanese beetle (Coleoptera: Scarabaeidae). J. Econ. Entomol. 2009, 102, 1551–1558. [Google Scholar] [CrossRef]
- Deletre, E.; Fabrice Chancre, F.; Barkman, B.; Menut, C.; Martin, T. Naturally occurring bioactive compounds from four repellent essential oils against Bemisia tabaci white flies. Pest Manag. Sci. 2016, 72, 179–189. [Google Scholar] [CrossRef]
- Lazarević, J.; Kostić, I.; Milanović, S.; Šešlija Jovanović, D.; Krnjajić, S.; Ćalić, D.; Stanković, S.; Kostić, M. Repellent activity of Tanacetum parthenium (L.) and Tanacetum vulgare (L.) essential oils against Leptinotarsa decemlineata (Say). Bull. Entomol. Res. 2020, 111, 190–199. [Google Scholar] [CrossRef]
- Seo, B.Y.; Jung, J.K.; Choi, B.R.; Park, H.M.; Lee, S.W.; Lee, B.H. Survival rate and stylet penetration behavior of current Korean populations of the brown planthopper, Nilaparvata lugens, onresistant rice varieties. J. Asia-Pac. Entomol. 2010, 13, 1–7. [Google Scholar] [CrossRef]
- He, Y.-P.; Zhang, F.-F.; Chen, J.-M.; Wu, Q.-C.; Chen, L.; Chen, L.-Z.; Xiao, P.-F.; Zhu, Y.-C. Influence of pymetrozine on feeding behaviors of three rice planthoppers and a rice leafhopper using electrical penetration graphs. J. Econ. Entomol. 2011, 104, 1877–1884. [Google Scholar] [CrossRef] [PubMed]
- He, P.; Zhang, J.; Liu, N.-Y.; Zhang, Y.-N.; Yang, K.; Dong, S.-L. Distinct expression profiles and different functions of odorant binding proteins in Nilaparvata lugens Stål. PLoS ONE 2011, 6, e28921. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Z.; Cui, B.; Yang, Z. Electrical penetration graphs indicate that tricin is a key secondary metabolite of rice, inhibiting phloem feeding of brown planthopper, Nilaparvata lugens. Entomol. Exp. Appl. 2015, 156, 14–27. [Google Scholar] [CrossRef]
- Liu, J.-L.; Du, H.-T.; Ding, X.; Zhou, Y.-D.; Xie, P.-F.; Wu, J.-C. Mechanisms of callose deposition in rice regulated by exogenous abscisic acid and its involvement in rice resistance to Nilaparvata lugens Stål (Hemiptera: Delphacidae). Pest Manag. Sci. 2017, 73, 2559–2568. [Google Scholar] [CrossRef] [PubMed]
- Zhu, J.-H.; Liu, X.-Q.; Zhu, K.-M.; Zhou, H.-Y.; Li, L.; Li, Z.-X.; Qin, W.-W.; He, Y.-P. Knockdown of TRPV Genes Affects the Locomotion and Feeding Behavior of Nilaparvata lugens (Hemiptera: Delphacidae). J. Insect Sci. 2020, 20, 9. [Google Scholar] [CrossRef]
- Zhu, J.; SUN, W.-Q.; Yao, L.; GE, L.Q.; Yang, G.-Q.; XU, J.-X.; Fang, L. Effects of a novel mesoionic insecticide, triflumezopyrim, on the feeding behavior of rice planthoppers, Nilaparvata lugens and Sogatella furcifera (Hemiptera: Delphacidae). J. Integr. Agric. 2020, 19, 2488–2499. [Google Scholar] [CrossRef]
- Xu, C.-L.; Lu, C.-Y.; Piao, J.; Wang, Y.-X.; Zhou, T.; Zhou, Y.-J.; Li, S. Rice virus release from the planthopper salivary gland is independent of plant tissue recognition by the stylet. Pest Manag. Sci. 2020, 76, 3208–3216. [Google Scholar] [CrossRef] [PubMed]
- Wu, Q.; Zhang, G.; Chen, Y.; Yu, J.-L.; Zhou, Y.-K.; Shu, Z.-L.; Ge, L. Seed dressing with triflumezopyrim controls brown planthopper populations by inhibiting feeding behavior, fecundity and enhancing rice plant resistance. Pest Manag. Sci. 2021, 77, 2870–2886. [Google Scholar] [CrossRef] [PubMed]
- He, P.; Engsontia, P.; Chen, G.-L.; Yin, Q.; Wang, J.; Lu, X.; Zhang, Y.-N.; Li, Z.-Q.; He, M. Molecular characterization and evolution of a chemosensory receptor gene family in three notorious rice planthoppers, Nilaparvata lugens, Sogatella furcifera and Laodelphax striatellus, based on genome and transcriptome analyses. Pest Manag. Sci. 2018, 74, 2156–2167. [Google Scholar] [CrossRef] [PubMed]
- Smadja, C.; Shi, P.; Butlin, R.K.; Robertson, H.M. Large gene family expansions and adaptive evolution for odorant and gustatory receptors in the pea aphid, Acyrthosiphon pisum. Mol. Biol. Evol. 2009, 26, 2073–2086. [Google Scholar] [CrossRef] [Green Version]
- Abdel-Latif, M. A family of chemorecetors in Tribolium castaneum (Tenibrionidae: Coleoptera). PLoS ONE 2007, 2, e1319. [Google Scholar]
- Hill, C.A.; Fox, A.N.; Pitts, R.J.; Kent, L.B.; Tan, P.L.; Chrystal, M.A.; Cravchik, A.; Collins, F.H.; Robertson, H.M.; Zwiebel, L.J. G protein-coupled receptors in Anopheles gambiae. Science 2002, 298, 176–178. [Google Scholar] [CrossRef]
- Pelosi, P.; Iovinella, I.; Zhu, J.; Wang, G.R.; Dani, F.R. Beyond chemoreception: Diverse tasks of soluble olfactory proteins in insects. Biol. Rev. Camb. Philos. Soc. 2018, 93, 184–200. [Google Scholar] [CrossRef] [Green Version]
- Pelosi, P.; Maida, R. Odorant-binding proteins in insects. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 1995, 111, 503–514. [Google Scholar] [CrossRef]
- He, M.; He, P. Molecular characterization, expression profiling, and binding properties of odorant binding protein genes in the white-backed planthopper. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2014, 174, 1–8. [Google Scholar] [CrossRef]
- Xu, Y.-L.; He, P.; Zhang, L.; Fang, S.-Q.; Dong, S.-L.; Zhang, Y.-J.; Li, F. Large-scale identification of odorant-binding proteins and chemosensory proteins from expressed sequence tags in insects. BMC Genom. 2009, 10, 632. [Google Scholar] [CrossRef] [Green Version]
- Zhou, S.-S.; Sun, Z.; Ma, W.-H.; Chen, W.; Wang, M.-Q. De novo analysis of the Nilaparvata lugens (Stål) antenna transcriptome and expression patterns of olfactory genes. Comp. Biochem. Physiol. Part D Genom. Proteom. 2014, 9, 31–39. [Google Scholar] [CrossRef]
- Benton, R. Multigene family evolution: Perspectives from insect chemoreceptors. Trends Ecol. Evol. 2015, 30, 590–600. [Google Scholar] [CrossRef] [PubMed]
- Chao, H.; Dinh, H.; Han, Y.; Doddapaneni, H.; Worley, K.C.; Muzny, D.M.; Park, E.O.; Silva, J.C.; Gibbs, R.A.; Richards, S.; et al. Evolutionary history of chemosensory-related gene families across the Arthropoda. Mol. Biol. Evol. 2017, 34, 1838–1862. [Google Scholar]
- French, A.S.; Agha, M.A.; Mitra, A.; Yanagawa, A.; Sellier, M.J.; Marion-Poll, F. Drosophila bitter taste(s). Front. Integr. Neurosci. 2015, 9, 58. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xu, W.; Papanicolaou, A.; Zhang, H.-J.; Anderson, A. Expansion of a bitter taste receptor family in a polyphagous insect herbivore. Sci. Rep. 2016, 6, 23666. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Z.-J.; Zhang, S.-S.; Niu, B.-L.; Ji, D.-F.; Liu, X.-J.; Li, M.-W.; Bai, H.; Palli, S.R.; Wang, C.-Z.; Tan, A.-J. A determining factor for insect feeding preference in the silkworm, Bombyx mori. PLoS Biol. 2019, 17, e3000162. [Google Scholar] [CrossRef] [Green Version]
- Ni, L.; Bronk, P.; Chang, E.-C.; Lowell, A.M.; Flam, J.O.; Panzano, V.C.; Theobald, D.L.; Griffith, L.C.; Garrity, P.A. A gustatory receptor paralogue controls rapid warmth avoidance in Drosophila. Nature 2013, 500, 580–584. [Google Scholar] [CrossRef] [Green Version]
- He, P.; Wang, M.-M.; Wang, H.; Ma, Y.-F.; Yang, S.; Li, S.-B.; Li, X.-G.; Li, S.; Zhang, F.; Wang, Q.; et al. Genome-wide identification of chemosensory receptor genes in the small brown planthopper. Laodelphax Striatellus Genom. 2020, 112, 2034–2040. [Google Scholar]
- Benton, R.; Sachse, S.; Michnick, S.W.; Vosshall, L.B. Atypical membrane topology and heteromeric function of Drosophila odorant receptors in vivo. PLoS Biol. 2006, 4, e20. [Google Scholar] [CrossRef] [Green Version]
- Kim, S.I.; Yoon, J.S.; Baeck, S.J.; Lee, S.H.; Ahn, Y.J.; Kwon, H.W. Toxicity and synergic repellency of plant essential oil mixtures with vanillin against Aedes aegypti (Diptera: Culicidae). J. Med. Entomol. 2012, 49, 876–885. [Google Scholar] [CrossRef] [PubMed]
- Sai, D.I.; Torre, R.A.D.L.; Morin, J.P.; Rochat, D. Adaptation of a four-arm olfactometer for behavioural bioassays of large beetles. Chemoecology 2006, 16, 9–16. [Google Scholar]
- Mao, G.F.; Jiang, N.N.; Mo, J.C. The behavioral responses of brown planthopper Nilaparvata lugens and the parasitoid Anagrus nilaparvatae to plant essential oils. J. Plant Prot. 2018, 45, 1005–1011. (In Chinese) [Google Scholar]
- Zhao, R.-N.; He, Y.-Q.; Lu, Z.-Y.; Chen, W.-L.; Zhou, C.-Y.; Wang, X.-F.; Li, T.-S. An analysis of the feeding behavior of three stages of Toxoptera citricida by DC electrical penetration graph waveforms. Entomol. Exp. Appl. 2019, 167, 370–376. [Google Scholar] [CrossRef] [Green Version]
- Trapnell, C.; Williams, B.A.; Pertea, G.; Mortazavi, A.; Kwan, G.; van Baren, M.J.; Salzberg, S.L.; Wold, B.J.; Pachter, L. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 2010, 28, 511–515. [Google Scholar] [CrossRef] [Green Version]
- Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef] [Green Version]
- Yu, G.; Wang, L.-G.; Han, Y.; He, Q.-Y. ClusterProfiler: An R package for comparing biological themes among gene clusters. Omics 2012, 16, 284–287. [Google Scholar] [CrossRef]
- Cao, F.; Guo, Y.; Zhang, Q.; Fang, Y.-C.; Liu, Q.; Song, J.-C.; Zhong, H.; Cao, F.; Yao, S.-T. Integration of transcriptome resequencing and quantitative proteomics analyses of collagenase vii-induced intracerebral hemorrhage in mice. Front. Genet. 2020, 11, 551065. [Google Scholar] [CrossRef]










| Samples | No. of Clean Sequence | No. of Clean Base (bp) | GC Percent (%) | ≥Q30 Percent (%) |
|---|---|---|---|---|
| A1 | 26,374,790 | 7,884,476,620 | 47.16% | 93.63% |
| A2 | 24,581,687 | 7,348,758,594 | 47.12% | 94.02% |
| A3 | 23,720,236 | 7,091,346,904 | 47.38% | 93.55% |
| E1 | 28,026,245 | 8,380,871,624 | 46.88% | 94.16% |
| E2 | 21,571,083 | 6,448,578,180 | 46.87% | 94.21% |
| E3 | 26,028,546 | 7,778,099,976 | 47.58% | 93.63% |
| Gene Categories | Gene Name | Gene Description | Differential Expression Multiple | Up- or Downregulated | Significance |
|---|---|---|---|---|---|
| OBPs | gene 797 | odorant binding | 0.66 | down | yes |
| GRs/ORs | gene 13110 | gustatory and odorant receptor | 2.55 | up | yes |
| Gene Categories | Gene Name | Forward Primer (5′-3′) | Reverse Primer (3′-5′) | Amplicon Length |
|---|---|---|---|---|
| OBPs | gene 797 | TTCATTGCCTGTGGATTCAACTC | CACGCTTGTCCTGTTCATCATAG | 109 bp |
| GRs/ORs | gene 13110 | CTTGCGTGCGAGAGTGGA | AACCTGCGACGAGTTGCT | 77 bp |
| Reference gene | U6 | CTCGCTTCGGCAGCACA | AACGCTTCACGAATTTGCGT | 107 bp |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gao, X.; Hu, X.; Mo, F.; Ding, Y.; Li, M.; Li, R. Repellency Mechanism of Natural Guar Gum-Based Film Incorporated with Citral against Brown Planthopper, Nilaparvata lugens (Stål) (Hemiptera: Delphacidae). Int. J. Mol. Sci. 2022, 23, 758. https://doi.org/10.3390/ijms23020758
Gao X, Hu X, Mo F, Ding Y, Li M, Li R. Repellency Mechanism of Natural Guar Gum-Based Film Incorporated with Citral against Brown Planthopper, Nilaparvata lugens (Stål) (Hemiptera: Delphacidae). International Journal of Molecular Sciences. 2022; 23(2):758. https://doi.org/10.3390/ijms23020758
Chicago/Turabian StyleGao, Xiubing, Xianfeng Hu, Feixu Mo, Yi Ding, Ming Li, and Rongyu Li. 2022. "Repellency Mechanism of Natural Guar Gum-Based Film Incorporated with Citral against Brown Planthopper, Nilaparvata lugens (Stål) (Hemiptera: Delphacidae)" International Journal of Molecular Sciences 23, no. 2: 758. https://doi.org/10.3390/ijms23020758
APA StyleGao, X., Hu, X., Mo, F., Ding, Y., Li, M., & Li, R. (2022). Repellency Mechanism of Natural Guar Gum-Based Film Incorporated with Citral against Brown Planthopper, Nilaparvata lugens (Stål) (Hemiptera: Delphacidae). International Journal of Molecular Sciences, 23(2), 758. https://doi.org/10.3390/ijms23020758

