Increased NMUR1 Expression in Mast Cells in the Synovial Membrane of Obese Osteoarthritis Patients
Abstract
1. Introduction
2. Results
2.1. Patient Features According to BMI
2.2. Synovial Membrane Levels of NMU/NMURs and CPA3 by BMI
2.3. Comparison of NMU/NMUR and CPA3 Expression between NW and OB Groups in a Propensity Score-Matched Cohort
2.4. Expression of Synovial NMU/NMURs and CPA3 in Non-MC and MC Fractions
3. Discussion
4. Materials and Methods
4.1. Patients and Methods
4.2. qPCR
4.3. Expression of NMU and NMURs in MCs
4.4. Statistical Analyses
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Grotle, M.; Hagen, K.B.; Natvig, B.; Dahl, F.A.; Kvien, T.K. Obesity and osteoarthritis in knee, hip and/or hand: An epidemiological study in the general population with 10 years follow-up. BMC Musculoskelet. Disord. 2008, 9, 132. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oliveria, S.A.; Felson, D.T.; Cirillo, P.A.; Reed, J.I.; Walker, A.M. Body weight, body mass index, and incident symptomatic osteoarthritis of the hand, hip, and knee. Epidemiology 1999, 10, 161–166. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shirakawa, Y.; Nakasa, T.; Kanemitsu, M.; Nekomoto, A.; Ishikawa, M.; Yimiti, D.; Miyaki, S.; Adachi, N. Therapeutic effect of targeting Substance P on the progression of osteoarthritis. Mod. Rheumatol. 2021, roab089. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Takano, S.; Uchida, K.; Inoue, G.; Matsumoto, T.; Aikawa, J.; Iwase, D.; Mukai, M.; Miyagi, M.; Takaso, M. Vascular endothelial growth factor expression and their action in the synovial membranes of patients with painful knee osteoarthritis. BMC Musculoskelet. Disord. 2018, 19, 204. [Google Scholar] [CrossRef] [Scilit]
- Takano, S.; Uchida, K.; Inoue, G.; Minatani, A.; Miyagi, M.; Aikawa, J.; Iwase, D.; Onuma, K.; Mukai, M.; Takaso, M. Increase and regulation of synovial calcitonin gene-related peptide expression in patients with painful knee osteoarthritis. J. Pain Res. 2017, 10, 1099–1104. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Uchida, K.; Takano, S.; Inoue, G.; Iwase, D.; Aikawa, J.; Takata, K.; Tazawa, R.; Kawakubo, A.; Sekiguchi, H.; Takaso, M. Increase in mast cell marker expression in the synovium of obese patients with osteoarthritis of the knee. Diabetes Metab. Syndr. Obes. 2019, 12, 377–382. [Google Scholar] [CrossRef] [Scilit]
- Uchida, K.; Takano, S.; Takata, K.; Mukai, M.; Koyama, T.; Ohashi, Y.; Saito, H.; Takaso, M.; Miyagi, M.; Inoue, G. Differential Synovial CGRP/RAMP1 Expression in Men and Women With Knee Osteoarthritis. Cureus 2021, 13, e15483. [Google Scholar] [CrossRef] [Scilit]
- Minamino, N.; Kangawa, K.; Matsuo, H. Neuromedin U-8 and U-25: Novel uterus stimulating and hypertensive peptides identified in porcine spinal cord. Biochem. Biophys. Res. Commun. 1985, 130, 1078–1085. [Google Scholar] [CrossRef] [Scilit]
- Cardoso, V.; Chesne, J.; Ribeiro, H.; Garcia-Cassani, B.; Carvalho, T.; Bouchery, T.; Shah, K.; Barbosa-Morais, N.L.; Harris, N.; Veiga-Fernandes, H. Neuronal regulation of type 2 innate lymphoid cells via neuromedin U. Nature 2017, 549, 277–281. [Google Scholar] [CrossRef] [Scilit]
- Hedrick, J.A.; Morse, K.; Shan, L.; Qiao, X.; Pang, L.; Wang, S.; Laz, T.; Gustafson, E.L.; Bayne, M.; Monsma, F.J., Jr. Identification of a human gastrointestinal tract and immune system receptor for the peptide neuromedin U. Mol. Pharmacol. 2000, 58, 870–875. [Google Scholar] [CrossRef] [Scilit]
- Martinez, V.G.; O’Driscoll, L. Neuromedin U: A multifunctional neuropeptide with pleiotropic roles. Clin. Chem. 2015, 61, 471–482. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moriyama, M.; Fukuyama, S.; Inoue, H.; Matsumoto, T.; Sato, T.; Tanaka, K.; Kinjyo, I.; Kano, T.; Yoshimura, A.; Kojima, M. The neuropeptide neuromedin U activates eosinophils and is involved in allergen-induced eosinophilia. Am. J. Physiol. Lung Cell. Mol. Physiol. 2006, 290, L971–L977. [Google Scholar] [CrossRef] [Scilit]
- Moriyama, M.; Matsukawa, A.; Kudoh, S.; Takahashi, T.; Sato, T.; Kano, T.; Yoshimura, A.; Kojima, M. The neuropeptide neuromedin U promotes IL-6 production from macrophages and endotoxin shock. Biochem. Biophys. Res. Commun. 2006, 341, 1149–1154. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hanada, R.; Teranishi, H.; Pearson, J.T.; Kurokawa, M.; Hosoda, H.; Fukushima, N.; Fukue, Y.; Serino, R.; Fujihara, H.; Ueta, Y.; et al. Neuromedin U has a novel anorexigenic effect independent of the leptin signaling pathway. Nat. Med. 2004, 10, 1067–1073. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kowalski, T.J.; Spar, B.D.; Markowitz, L.; Maguire, M.; Golovko, A.; Yang, S.; Farley, C.; Cook, J.A.; Tetzloff, G.; Hoos, L.; et al. Transgenic overexpression of neuromedin U promotes leanness and hypophagia in mice. J. Endocrinol. 2005, 185, 151–164. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rao, S.M.; Auger, J.L.; Gaillard, P.; Weissleder, R.; Wada, E.; Torres, R.; Kojima, M.; Benoist, C.; Mathis, D.; Binstadt, B.A. The neuropeptide neuromedin U promotes autoantibody-mediated arthritis. Arthritis Res. Ther. 2012, 14, R29. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.; Qin, Y.; Chen, Z. Neuromedin U Suppresses Collagen-Induced Arthritis through ILC2-Th2 Activation. J. Immunol. Res. 2021, 2021, 5599439. [Google Scholar] [CrossRef] [Scilit]
- Hsu, S.H.; Luo, C.W. Molecular dissection of G protein preference using Gsalpha chimeras reveals novel ligand signaling of GPCRs. Am. J. Physiol. Endocrinol. Metab. 2007, 293, E1021–E1029. [Google Scholar] [CrossRef] [Scilit]
- Ramirez, J.; Celis, R.; Usategui, A.; Ruiz-Esquide, V.; Fare, R.; Cuervo, A.; Sanmarti, R.; Pablos, J.L.; Canete, J.D. Immunopathologic characterization of ultrasound-defined synovitis in rheumatoid arthritis patients in clinical remission. Arthritis Res. Ther. 2016, 18, 74. [Google Scholar] [CrossRef] [Scilit]
- Rivellese, F.; Mauro, D.; Nerviani, A.; Pagani, S.; Fossati-Jimack, L.; Messemaker, T.; Kurreeman, F.A.S.; Toes, R.E.M.; Ramming, A.; Rauber, S.; et al. Mast cells in early rheumatoid arthritis associate with disease severity and support B cell autoantibody production. Ann. Rheum. Dis. 2018, 77, 1773–1781. [Google Scholar] [CrossRef] [Scilit]
- Rivellese, F.; Rossi, F.W.; Galdiero, M.R.; Pitzalis, C.; de Paulis, A. Mast Cells in Early Rheumatoid Arthritis. Int. J. Mol. Sci. 2019, 20, 2040. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Buckley, M.G.; Gallagher, P.J.; Walls, A.F. Mast cell subpopulations in the synovial tissue of patients with osteoarthritis: Selective increase in numbers of tryptase-positive, chymase-negative mast cells. J. Pathol. 1998, 186, 67–74. [Google Scholar] [CrossRef]
- De Lange-Brokaar, B.J.; Kloppenburg, M.; Andersen, S.N.; Dorjee, A.L.; Yusuf, E.; Herb-van Toorn, L.; Kroon, H.M.; Zuurmond, A.M.; Stojanovic-Susulic, V.; Bloem, J.L.; et al. Characterization of synovial mast cells in knee osteoarthritis: Association with clinical parameters. Osteoarthr. Cartil. 2016, 24, 664–671. [Google Scholar] [CrossRef] [Scilit]
- Dean, G.; Hoyland, J.A.; Denton, J.; Donn, R.P.; Freemont, A.J. Mast cells in the synovium and synovial fluid in osteoarthritis. Br. J. Rheumatol. 1993, 32, 671–675. [Google Scholar] [CrossRef] [Scilit]
- Farinelli, L.; Aquili, A.; Mattioli-Belmonte, M.; Manzotti, S.; D’Angelo, F.; Ciccullo, C.; Gigante, A. Synovial mast cells from knee and hip osteoarthritis: Histological study and clinical correlations. J. Exp. Orthop. 2022, 9, 13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kulkarni, P.; Harsulkar, A.; Martson, A.G.; Suutre, S.; Martson, A.; Koks, S. Mast Cells Differentiated in Synovial Fluid and Resident in Osteophytes Exalt the Inflammatory Pathology of Osteoarthritis. Int. J. Mol. Sci. 2022, 23, 541. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Takata, K.; Uchida, K.; Mukai, M.; Takano, S.; Aikawa, J.; Iwase, D.; Sekiguchi, H.; Miyagi, M.; Inoue, G.; Takaso, M. Increase in Tryptase and Its Role in the Synovial Membrane of Overweight and Obese Patients with Osteoarthritis of the Knee. Diabetes Metab. Syndr. Obes. 2020, 13, 1491–1497. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Takata, K.; Uchida, K.; Takano, S.; Mukai, M.; Inoue, G.; Sekiguchi, H.; Aikawa, J.; Miyagi, M.; Iwase, D.; Takaso, M. Possible Regulation of bFGF Expression by Mast Cells in Osteoarthritis Patients with Obesity: A Cross-Sectional Study. Diabetes Metab. Syndr. Obes. 2021, 14, 3291–3297. [Google Scholar] [CrossRef] [Scilit]
- Lubbers, R.; van Essen, M.F.; van Kooten, C.; Trouw, L.A. Production of complement components by cells of the immune system. Clin. Exp. Immunol. 2017, 188, 183–194. [Google Scholar] [CrossRef] [Scilit]
- Yanase, Y.; Matsuo, Y.; Takahagi, S.; Kawaguchi, T.; Uchida, K.; Ishii, K.; Tanaka, A.; Matsubara, D.; Ozawa, K.; Hide, M. Coagulation factors induce human skin mast cell and basophil degranulation via activation of complement 5 and the C5a receptor. J. Allergy Clin. Immunol. 2021, 147, 1101–1104.e7. [Google Scholar] [CrossRef] [Scilit]
- Kiener, H.P.; Baghestanian, M.; Dominkus, M.; Walchshofer, S.; Ghannadan, M.; Willheim, M.; Sillaber, C.; Graninger, W.B.; Smolen, J.S.; Valent, P. Expression of the C5a receptor (CD88) on synovial mast cells in patients with rheumatoid arthritis. Arthritis Rheum. 1998, 41, 233–245. [Google Scholar] [CrossRef]
- Hu, W.; Wang, M.; Yin, C.; Li, S.; Liu, Y.; Xiao, Y. Serum complement factor 5a levels are associated with nonalcoholic fatty liver disease in obese children. Acta Paediatr. 2018, 107, 322–327. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bowers, E.; Singer, K. Obesity-induced inflammation: The impact of the hematopoietic stem cell niche. JCI Insight 2021, 6, e145295. [Google Scholar] [CrossRef] [Scilit]
- Kanthawang, T.; Bodden, J.; Joseph, G.B.; Lane, N.E.; Nevitt, M.; McCulloch, C.E.; Link, T.M. Obese and overweight individuals have greater knee synovial inflammation and associated structural and cartilage compositional degeneration: Data from the osteoarthritis initiative. Skelet. Radiol. 2021, 50, 217–229. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abbondanzo, S.J.; Manfra, D.J.; Chen, S.C.; Pinzon-Ortiz, M.; Sun, Y.; Phillips, J.E.; Laverty, M.; Vassileva, G.; Hu, W.; Yang, S.; et al. Nmur1-/- mice are not protected from cutaneous inflammation. Biochem. Biophys. Res. Commun. 2009, 378, 777–782. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Johnson, E.N.; Appelbaum, E.R.; Carpenter, D.C.; Cox, R.F.; Disa, J.; Foley, J.J.; Ghosh, S.K.; Naselsky, D.P.; Pullen, M.A.; Sarau, H.M.; et al. Neuromedin U elicits cytokine release in murine Th2-type T cell clone D10.G4.1. J. Immunol. 2004, 173, 7230–7238. [Google Scholar] [CrossRef] [Scilit]
- Nedunchezhiyan, U.; Varughese, I.; Sun, A.R.; Wu, X.; Crawford, R.; Prasadam, I. Obesity, Inflammation, and Immune System in Osteoarthritis. Front. Immunol. 2022, 13, 907750. [Google Scholar] [CrossRef] [Scilit]
- Ghannadan, M.; Baghestanian, M.; Wimazal, F.; Eisenmenger, M.; Latal, D.; Kargul, G.; Walchshofer, S.; Sillaber, C.; Lechner, K.; Valent, P. Phenotypic characterization of human skin mast cells by combined staining with toluidine blue and CD antibodies. J. Investig. Dermatol. 1998, 111, 689–695. [Google Scholar] [CrossRef] [Scilit]
- Oskeritzian, C.A.; Zhao, W.; Min, H.K.; Xia, H.Z.; Pozez, A.; Kiev, J.; Schwartz, L.B. Surface CD88 functionally distinguishes the MCTC from the MCT type of human lung mast cell. J. Allergy Clin. Immunol. 2005, 115, 1162–1168. [Google Scholar] [CrossRef] [Scilit]
- Moriyama, M.; Sato, T.; Inoue, H.; Fukuyama, S.; Teranishi, H.; Kangawa, K.; Kano, T.; Yoshimura, A.; Kojima, M. The neuropeptide neuromedin U promotes inflammation by direct activation of mast cells. J. Exp. Med. 2005, 202, 217–224. [Google Scholar] [CrossRef] [Scilit]
- Fujii, R.; Hosoya, M.; Fukusumi, S.; Kawamata, Y.; Habata, Y.; Hinuma, S.; Onda, H.; Nishimura, O.; Fujino, M. Identification of neuromedin U as the cognate ligand of the orphan G protein-coupled receptor FM-3. J. Biol. Chem. 2000, 275, 21068–21074. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Graham, E.S.; Turnbull, Y.; Fotheringham, P.; Nilaweera, K.; Mercer, J.G.; Morgan, P.J.; Barrett, P. Neuromedin U and Neuromedin U receptor-2 expression in the mouse and rat hypothalamus: Effects of nutritional status. J. Neurochem. 2003, 87, 1165–1173. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hosoya, M.; Moriya, T.; Kawamata, Y.; Ohkubo, S.; Fujii, R.; Matsui, H.; Shintani, Y.; Fukusumi, S.; Habata, Y.; Hinuma, S.; et al. Identification and functional characterization of a novel subtype of neuromedin U receptor. J. Biol. Chem. 2000, 275, 29528–29532. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Howard, A.D.; Wang, R.; Pong, S.S.; Mellin, T.N.; Strack, A.; Guan, X.M.; Zeng, Z.; Williams, D.L., Jr.; Feighner, S.D.; Nunes, C.N.; et al. Identification of receptors for neuromedin U and its role in feeding. Nature 2000, 406, 70–74. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Raddatz, R.; Wilson, A.E.; Artymyshyn, R.; Bonini, J.A.; Borowsky, B.; Boteju, L.W.; Zhou, S.; Kouranova, E.V.; Nagorny, R.; Guevarra, M.S.; et al. Identification and characterization of two neuromedin U receptors differentially expressed in peripheral tissues and the central nervous system. J. Biol. Chem. 2000, 275, 32452–32459. [Google Scholar] [CrossRef] [Scilit]
- Szekeres, P.G.; Muir, A.I.; Spinage, L.D.; Miller, J.E.; Butler, S.I.; Smith, A.; Rennie, G.I.; Murdock, P.R.; Fitzgerald, L.R.; Wu, H.; et al. Neuromedin U is a potent agonist at the orphan G protein-coupled receptor FM3. J. Biol. Chem. 2000, 275, 20247–20250. [Google Scholar] [CrossRef] [Scilit]
- Westfall, T.D.; McCafferty, G.P.; Pullen, M.; Gruver, S.; Sulpizio, A.C.; Aiyar, V.N.; Disa, J.; Contino, L.C.; Mannan, I.J.; Hieble, J.P. Characterization of neuromedin U effects in canine smooth muscle. J. Pharmacol. Exp. Ther. 2002, 301, 987–992. [Google Scholar] [CrossRef] [Scilit]
- Yu, X.H.; Cao, C.Q.; Mennicken, F.; Puma, C.; Dray, A.; O’Donnell, D.; Ahmad, S.; Perkins, M. Pro-nociceptive effects of neuromedin U in rat. Neuroscience 2003, 120, 467–474. [Google Scholar] [CrossRef] [Scilit]
- Shan, L.; Qiao, X.; Crona, J.H.; Behan, J.; Wang, S.; Laz, T.; Bayne, M.; Gustafson, E.L.; Monsma, F.J., Jr.; Hedrick, J.A. Identification of a novel neuromedin U receptor subtype expressed in the central nervous system. J. Biol. Chem. 2000, 275, 39482–39486. [Google Scholar] [CrossRef] [Scilit]
- Noordenbos, T.; Yeremenko, N.; Gofita, I.; van de Sande, M.; Tak, P.P.; Canete, J.D.; Baeten, D. Interleukin-17-positive mast cells contribute to synovial inflammation in spondylarthritis. Arthritis Rheum. 2012, 64, 99–109. [Google Scholar] [CrossRef] [Scilit]



| Normal (n = 79) | Overweight (n = 87) | Obese (n = 40) | p | |
|---|---|---|---|---|
| Age (years) | 76.4 ± 6.5 | 72.8 ± 7.2 a | 72.1 ± 7.1 a | 0.004 |
| KL (2/3/4), n | 3/14/62 | 5/21/61 | 1/7/32 | 0.675 |
| BMI (kg/m2) | 22.3 ± 1.8 | 27.3 ± 1.5 a | 33.2 ± 2.6 a,b | <0.001 |
| Normal (n = 38) | Obese (n = 38) | p | |
|---|---|---|---|
| Age (years) | 74.4 ± 7.2 | 72.9 ± 6.2 | 0.429 |
| KL (2/3/4), n | 2/11/25 | 1/7/30 | 0.432 |
| BMI (kg/m2) | 32.9 ± 2.4 | 22.2 ± 2.1 | <0.001 |
| Primer | Sequence (5’–3’) | Product Size (bp) |
|---|---|---|
| CPA3-F | GGCACTGACCTCAACAGGAA | 71 |
| CPA3-R | TCTGCACATGGGTCATTGGT | |
| NMU-F | GAGATGCTGCGAACAGAGAG | 126 |
| NMU-R | TATTGGAGCACCTCGGCAG | |
| NUMR1-F | ATGCTGTTTGTCCTGGTCGT | 140 |
| NMUR1-R | AAGATGCCGGAGATGACGTG | |
| NMUR2-F | TGAAGACGCCCACCAACTAC | 165 |
| NMUR2-R | AGCACACGGTCTCAAAGAGG | |
| GAPDH-F | TGTTGCCATCAATGACCCCTT | 202 |
| GAPDH-R | CTCCACGACGTACTCAGCG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tsukada, A.; Takata, K.; Takano, S.; Ohashi, Y.; Mukai, M.; Aikawa, J.; Iwase, D.; Inoue, G.; Takaso, M.; Uchida, K. Increased NMUR1 Expression in Mast Cells in the Synovial Membrane of Obese Osteoarthritis Patients. Int. J. Mol. Sci. 2022, 23, 11237. https://doi.org/10.3390/ijms231911237
Tsukada A, Takata K, Takano S, Ohashi Y, Mukai M, Aikawa J, Iwase D, Inoue G, Takaso M, Uchida K. Increased NMUR1 Expression in Mast Cells in the Synovial Membrane of Obese Osteoarthritis Patients. International Journal of Molecular Sciences. 2022; 23(19):11237. https://doi.org/10.3390/ijms231911237
Chicago/Turabian StyleTsukada, Ayumi, Ken Takata, Shotaro Takano, Yoshihisa Ohashi, Manabu Mukai, Jun Aikawa, Dai Iwase, Gen Inoue, Masashi Takaso, and Kentaro Uchida. 2022. "Increased NMUR1 Expression in Mast Cells in the Synovial Membrane of Obese Osteoarthritis Patients" International Journal of Molecular Sciences 23, no. 19: 11237. https://doi.org/10.3390/ijms231911237
APA StyleTsukada, A., Takata, K., Takano, S., Ohashi, Y., Mukai, M., Aikawa, J., Iwase, D., Inoue, G., Takaso, M., & Uchida, K. (2022). Increased NMUR1 Expression in Mast Cells in the Synovial Membrane of Obese Osteoarthritis Patients. International Journal of Molecular Sciences, 23(19), 11237. https://doi.org/10.3390/ijms231911237

