TRAF4 Promotes the Proliferation of Glioblastoma by Stabilizing SETDB1 to Activate the AKT Pathway
Abstract
:1. Introduction
2. Results
2.1. TRAF4 Is Highly Expressed in Glioblastoma, and High Expression Indicates Poor Prognosis
2.2. Loss of TRAF4 Inhibits the Proliferation of Glioblastoma Cells
2.3. Knockdown of TRAF4 Inhibits Activation of the AKT Pathway in Glioblastoma, Whereas Restoration of TRAF4 Expression Counteracts the Inhibition
2.4. TRAF4 Interacts with the Tudor Domain of SETDB1
2.5. TRAF4 Mediates Atypical Ubiquitination of SETDB1
2.6. SETDB1 Overexpression Significantly Restores Cell Proliferation of TRAF4 Knockdown Glioblastoma Cells
2.7. TRAF4 Knockdown Suppresses Tumor Growth in Mice
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Antibodies and Reagents
4.3. Tumor Database Analysis
4.4. Transfection and Infection
4.5. Western Blot Analysis
4.6. Immunoprecipitation
4.7. Quantitative Real-Time PCR (qRT-PCR)
4.8. Ubiquitination Assay
4.9. Protein Turnover Assay
4.10. Immunohistochemistry (IHC)
4.11. MTT and EdU Assay
4.12. Wound-Healing Assay and Transwell Assay
4.13. Colony Formation and Soft Agar Assay
4.14. Gene Set Enrichment Analysis (GSEA)
4.15. Animal Experiments
4.16. Animal Ethics
4.17. Statistical Process
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Tan, A.C.; Ashley, D.M.; López, G.Y.; Malinzak, M.; Friedman, H.S.; Khasraw, M. Management of glioblastoma: State of the art and future directions. CA Cancer J. Clin. 2020, 70, 299–312. [Google Scholar] [CrossRef] [PubMed]
- Miller, K.D.; Ostrom, Q.T.; Kruchko, C.; Patil, N.; Tihan, T.; Cioffi, G.; Fuchs, H.E.; Waite, K.A.; Jemal, A.; Siegel, R.L.; et al. Brain and other central nervous system tumor statistics, 2021. CA Cancer J. Clin. 2021, 71, 381–406. [Google Scholar] [CrossRef]
- Ostrom, Q.T.; Patil, N.; Cioffi, G.; Waite, K.; Kruchko, C.; Barnholtz-Sloan, J.S. CBTRUS Statistical Report: Primary Brain and Other Central Nervous System Tumors Diagnosed in the United States in 2013–2017. Neuro Oncol. 2020, 22, iv1–iv96. [Google Scholar] [CrossRef] [PubMed]
- Ostrom, Q.T.; Cote, D.J.; Ascha, M.; Kruchko, C.; Barnholtz-Sloan, J.S. Adult Glioma Incidence and Survival by Race or Ethnicity in the United States From 2000 to 2014. JAMA Oncol. 2018, 4, 1254–1262. [Google Scholar] [CrossRef] [PubMed]
- Alexander, B.M.; Cloughesy, T.F. Adult Glioblastoma. J. Clin. Oncol. 2017, 35, 2402–2409. [Google Scholar] [CrossRef] [PubMed]
- Park, H.H. Structure of TRAF Family: Current Understanding of Receptor Recognition. Front. Immunol. 2018, 9, 1999. [Google Scholar] [CrossRef] [PubMed]
- Zhu, S.; Jin, J.; Gokhale, S.; Lu, A.M.; Shan, H.; Feng, J.; Xie, P. Genetic Alterations of TRAF Proteins in Human Cancers. Front. Immunol. 2018, 9, 2111. [Google Scholar] [CrossRef]
- Inoue, J.; Ishida, T.; Tsukamoto, N.; Kobayashi, N.; Naito, A.; Azuma, S.; Yamamoto, T. Tumor necrosis factor receptor-associated factor (TRAF) family: Adapter proteins that mediate cytokine signaling. Exp. Cell Res. 2000, 254, 14–24. [Google Scholar] [CrossRef]
- Das, A.; Middleton, A.J.; Padala, P.; Ledgerwood, E.C.; Mace, P.D.; Day, C.L. The Structure and Ubiquitin Binding Properties of TRAF RING Heterodimers. J. Mol. Biol. 2021, 433, 166844. [Google Scholar] [CrossRef]
- Régnier, C.H.; Tomasetto, C.; Moog-Lutz, C.; Chenard, M.P.; Wendling, C.; Basset, P.; Rio, M.C. Presence of a new conserved domain in CART1, a novel member of the tumor necrosis factor receptor-associated protein family, which is expressed in breast carcinoma. J. Biol. Chem. 1995, 270, 25715–25721. [Google Scholar] [CrossRef] [Green Version]
- Krajewska, M.; Krajewski, S.; Zapata, J.M.; Van Arsdale, T.; Gascoyne, R.D.; Berern, K.; McFadden, D.; Shabaik, A.; Hugh, J.; Reynolds, A.; et al. TRAF-4 expression in epithelial progenitor cells. Analysis in normal adult, fetal, and tumor tissues. Am. J. Pathol. 1998, 152, 1549–1561. [Google Scholar] [PubMed]
- Sharma, S.; Pavlasova, G.M.; Seda, V.; Cerna, K.A.; Vojackova, E.; Filip, D.; Ondrisova, L.; Sandova, V.; Kostalova, L.; Zeni, P.F.; et al. miR-29 modulates CD40 signaling in chronic lymphocytic leukemia by targeting TRAF4: An axis affected by BCR inhibitors. Blood 2021, 137, 2481–2494. [Google Scholar] [CrossRef] [PubMed]
- Rousseau, A.; McEwen, A.G.; Poussin-Courmontagne, P.; Rognan, D.; Nominé, Y.; Rio, M.C.; Tomasetto, C.; Alpy, F. TRAF4 is a novel phosphoinositide-binding protein modulating tight junctions and favoring cell migration. PLoS Biol. 2013, 11, e1001726. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Wang, P.; Xie, Z.; Wang, S.; Cen, S.; Li, M.; Liu, W.; Tang, S.; Ye, G.; Zheng, G.; et al. TRAF4 positively regulates the osteogenic differentiation of mesenchymal stem cells by acting as an E3 ubiquitin ligase to degrade Smurf2. Cell Death Differ. 2019, 26, 2652–2666. [Google Scholar] [CrossRef]
- Yu, X.; Li, W.; Liu, H.; Deng, Q.; Wang, X.; Hu, H.; Xu-Monette, Z.Y.; Xiong, W.; Lu, Z.; Young, K.H.; et al. Ubiquitination of the DNA-damage checkpoint kinase CHK1 by TRAF4 is required for CHK1 activation. J. Hematol. Oncol. 2020, 13, 40. [Google Scholar] [CrossRef]
- Zhang, L.; Zhou, F.; García de Vinuesa, A.; de Kruijf, E.M.; Mesker, W.E.; Hui, L.; Drabsch, Y.; Li, Y.; Bauer, A.; Rousseau, A.; et al. TRAF4 promotes TGF-β receptor signaling and drives breast cancer metastasis. Mol. Cell 2013, 51, 559–572. [Google Scholar] [CrossRef]
- Yau, R.; Rape, M. The increasing complexity of the ubiquitin code. Nat. Cell Biol. 2016, 18, 579–586. [Google Scholar] [CrossRef]
- Zhu, S.; Gu, H.; Peng, C.; Xia, F.; Cao, H.; Cui, H. Regulation of Glucose, Fatty Acid and Amino Acid Metabolism by Ubiquitination and SUMOylation for Cancer Progression. Front. Cell Dev. Biol. 2022, 10, 849625. [Google Scholar] [CrossRef]
- Singh, R.; Karri, D.; Shen, H.; Shao, J.; Dasgupta, S.; Huang, S.; Edwards, D.P.; Ittmann, M.M.; O’Malley, B.W.; Yi, P. TRAF4-mediated ubiquitination of NGF receptor TrkA regulates prostate cancer metastasis. J. Clin. Investig. 2018, 128, 3129–3143. [Google Scholar] [CrossRef]
- Camilleri-Broët, S.; Cremer, I.; Marmey, B.; Comperat, E.; Viguié, F.; Audouin, J.; Rio, M.C.; Fridman, W.H.; Sautès-Fridman, C.; Régnier, C.H. TRAF4 overexpression is a common characteristic of human carcinomas. Oncogene 2007, 26, 142–147. [Google Scholar] [CrossRef] [Green Version]
- Liu, X.; Zheng, J.; Xue, Y.; Yu, H.; Gong, W.; Wang, P.; Li, Z.; Liu, Y. PIWIL3/OIP5-AS1/miR-367-3p/CEBPA feedback loop regulates the biological behavior of glioma cells. Theranostics 2018, 8, 1084–1105. [Google Scholar] [CrossRef]
- Shi, C.; Rao, C.; Sun, C.; Yu, L.; Zhou, X.; Hua, D.; Wang, R.; Luo, W.; Jiang, Z.; Zhou, J.; et al. miR-29s function as tumor suppressors in gliomas by targeting TRAF4 and predict patient prognosis. Cell Death Dis. 2018, 9, 1078. [Google Scholar] [CrossRef]
- Hou, J.; Xu, M.; Gu, H.; Pei, D.; Liu, Y.; Huang, P.; Chang, H.; Cui, H. ZC3H15 promotes glioblastoma progression through regulating EGFR stability. Cell Death Dis. 2022, 13, 55. [Google Scholar] [CrossRef]
- Rozan, L.M.; El-Deiry, W.S. Identification and characterization of proteins interacting with Traf4, an enigmatic p53 target. Cancer Biol. Ther. 2006, 5, 1228–1235. [Google Scholar] [CrossRef]
- Ren, H.; Mi, X.; Zhao, P.; Zhao, X.; Wei, N.; Huang, H.; Meng, Z.; Kou, J.; Sun, M.; Liu, Y.; et al. TRAF4, a new substrate of SIAH1, participates in chemotherapy resistance of breast cancer cell by counteracting SIAH1-mediated downregulation of β-catenin. Breast Cancer Res. Treat. 2020, 183, 275–289. [Google Scholar] [CrossRef]
- Yao, Y.; Zhao, K.; Yu, Z.; Ren, H.; Zhao, L.; Li, Z.; Guo, Q.; Lu, N. Wogonoside inhibits invasion and migration through suppressing TRAF2/4 expression in breast cancer. J. Exp. Clin. Cancer Res. 2017, 36, 103. [Google Scholar] [CrossRef]
- Apte, R.S.; Chen, D.S.; Ferrara, N. VEGF in Signaling and Disease: Beyond Discovery and Development. Cell 2019, 176, 1248–1264. [Google Scholar] [CrossRef]
- Li, W.; Peng, C.; Lee, M.H.; Lim, D.; Zhu, F.; Fu, Y.; Yang, G.; Sheng, Y.; Xiao, L.; Dong, X.; et al. TRAF4 is a critical molecule for Akt activation in lung cancer. Cancer Res. 2013, 73, 6938–6950. [Google Scholar] [CrossRef]
- Chen, H.; Qian, Z.; Zhang, S.; Tang, J.; Fang, L.; Jiang, F.; Ge, D.; Chang, J.; Cao, J.; Yang, L.; et al. Silencing COX-2 blocks PDK1/TRAF4-induced AKT activation to inhibit fibrogenesis during skeletal muscle atrophy. Redox Biol. 2021, 38, 101774. [Google Scholar] [CrossRef]
- Wang, G.; Long, J.; Gao, Y.; Zhang, W.; Han, F.; Xu, C.; Sun, L.; Yang, S.C.; Lan, J.; Hou, Z.; et al. SETDB1-mediated methylation of Akt promotes its K63-linked ubiquitination and activation leading to tumorigenesis. Nat. Cell Biol. 2019, 21, 214–225. [Google Scholar] [CrossRef]
- Guo, J.; Dai, X.; Laurent, B.; Zheng, N.; Gan, W.; Zhang, J.; Guo, A.; Yuan, M.; Liu, P.; Asara, J.M.; et al. AKT methylation by SETDB1 promotes AKT kinase activity and oncogenic functions. Nat. Cell Biol. 2019, 21, 226–237. [Google Scholar] [CrossRef]
- Lazaro-Camp, V.J.; Salari, K.; Meng, X.; Yang, S. SETDB1 in cancer: Overexpression and its therapeutic implications. Am. J. Cancer Res. 2021, 11, 1803–1827. [Google Scholar]
- Lu, R.; Wang, G.G. Tudor: A versatile family of histone methylation ‘readers’. Trends Biochem. Sci. 2013, 38, 546–555. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Mei, Q.; Zielinska-Kwiatkowska, A.; Matsui, Y.; Blackburn, M.L.; Benedetti, D.; Krumm, A.A.; Taborsky, G.J., Jr.; Chansky, H.A. An ERG (ets-related gene)-associated histone methyltransferase interacts with histone deacetylases 1/2 and transcription co-repressors mSin3A/B. Biochem. J. 2003, 369, 651–657. [Google Scholar] [CrossRef] [PubMed]
- Jurkowska, R.Z.; Qin, S.; Kungulovski, G.; Tempel, W.; Liu, Y.; Bashtrykov, P.; Stiefelmaier, J.; Jurkowski, T.P.; Kudithipudi, S.; Weirich, S.; et al. H3K14ac is linked to methylation of H3K9 by the triple Tudor domain of SETDB1. Nat. Commun. 2017, 8, 2057. [Google Scholar] [CrossRef] [PubMed]
- Zhang, G.; Zhu, Q.; Yan, X.; Ci, M.; Zhao, E.; Hou, J.; Wan, S.; Lü, M.; Cui, H. HECTD3 promotes gastric cancer progression by mediating the polyubiquitination of c-MYC. Cell Death Discov. 2022, 8, 185. [Google Scholar] [CrossRef] [PubMed]
- Yuan, W.C.; Lee, Y.R.; Lin, S.Y.; Chang, L.Y.; Tan, Y.P.; Hung, C.C.; Kuo, J.C.; Liu, C.H.; Lin, M.Y.; Xu, M.; et al. K33-Linked Polyubiquitination of Coronin 7 by Cul3-KLHL20 Ubiquitin E3 Ligase Regulates Protein Trafficking. Mol. Cell 2014, 54, 586–600. [Google Scholar] [CrossRef]
- Feng, X.; Jia, Y.; Zhang, Y.; Ma, F.; Zhu, Y.; Hong, X.; Zhou, Q.; He, R.; Zhang, H.; Jin, J.; et al. Ubiquitination of UVRAG by SMURF1 promotes autophagosome maturation and inhibits hepatocellular carcinoma growth. Autophagy 2019, 15, 1130–1149. [Google Scholar] [CrossRef]
- Liu, X.; Xu, B.; Yang, J.; He, L.; Zhang, Z.; Cheng, X.; Yu, H.; Liu, X.; Jin, T.; Peng, Y.; et al. UHRF2 commissions the completion of DNA demethylation through allosteric activation by 5hmC and K33-linked ubiquitination of XRCC1. Mol. Cell 2021, 81, 2960–2974.e7. [Google Scholar] [CrossRef]
- Li, C.; Deng, C.; Pan, G.; Wang, X.; Zhang, K.; Dong, Z.; Zhao, G.; Tan, M.; Hu, X.; Shi, S.; et al. Lycorine hydrochloride inhibits cell proliferation and induces apoptosis through promoting FBXW7-MCL1 axis in gastric cancer. J. Exp. Clin. Cancer Res. 2020, 39, 230. [Google Scholar] [CrossRef]
- Han, S.; Wang, R.; Zhang, Y.; Li, X.; Gan, Y.; Gao, F.; Rong, P.; Wang, W.; Li, W. The role of ubiquitination and deubiquitination in tumor invasion and metastasis. Int. J. Biol. Sci. 2022, 18, 2292–2303. [Google Scholar] [CrossRef]
- Li, Y.; Su, Y.; Zhao, Y.; Hu, X.; Zhao, G.; He, J.; Wan, S.; Lü, M.; Cui, H. Demethylzeylasteral inhibits proliferation, migration, and invasion through FBXW7/c-Myc axis in gastric cancer. MedComm 2021, 2, 467–480. [Google Scholar] [CrossRef]
- He, Y.; Sun, M.M.; Zhang, G.G.; Yang, J.; Chen, K.S.; Xu, W.W.; Li, B. Targeting PI3K/Akt signal transduction for cancer therapy. Signal Transduct. Target. Ther. 2021, 6, 425. [Google Scholar] [CrossRef]
- Yang, L.; Shi, P.; Zhao, G.; Xu, J.; Peng, W.; Zhang, J.; Zhang, G.; Wang, X.; Dong, Z.; Chen, F.; et al. Targeting cancer stem cell pathways for cancer therapy. Signal Transduct. Target. Ther. 2020, 5, 8. [Google Scholar] [CrossRef]
- Zhu, S.; Dong, Z.; Ke, X.; Hou, J.; Zhao, E.; Zhang, K.; Wang, F.; Yang, L.; Xiang, Z.; Cui, H. The roles of sirtuins family in cell metabolism during tumor development. Semin. Cancer Biol. 2019, 57, 59–71. [Google Scholar] [CrossRef]
- He, X.; Zhang, L.; Queme, L.F.; Liu, X.; Lu, A.; Waclaw, R.R.; Dong, X.; Zhou, W.; Kidd, G.; Yoon, S.O.; et al. A histone deacetylase 3-dependent pathway delimits peripheral myelin growth and functional regeneration. Nat. Med. 2018, 24, 338–351. [Google Scholar] [CrossRef]
- Liu, Q.; Aminu, B.; Roscow, O.; Zhang, W. Targeting the Ubiquitin Signaling Cascade in Tumor Microenvironment for Cancer Therapy. Int. J. Mol. Sci. 2021, 22, 791. [Google Scholar] [CrossRef]
- Strepkos, D.; Markouli, M.; Klonou, A.; Papavassiliou, A.G.; Piperi, C. Histone Methyltransferase SETDB1: A Common Denominator of Tumorigenesis with Therapeutic Potential. Cancer Res. 2021, 81, 525–534. [Google Scholar] [CrossRef]
- Griffin, G.K.; Wu, J.; Iracheta-Vellve, A.; Patti, J.C.; Hsu, J.; Davis, T.; Dele-Oni, D.; Du, P.P.; Halawi, A.G.; Ishizuka, J.J.; et al. Epigenetic silencing by SETDB1 suppresses tumour intrinsic immunogenicity. Nature 2021, 595, 309–314. [Google Scholar] [CrossRef]
- Harjes, U. SETDB1, a new target for immunotherapy. Nat. Rev. Cancer 2021, 21, 412. [Google Scholar] [CrossRef]








| Primer Pairs for Real-Time PCR | |
|---|---|
| β-actin-F | CATGTACGTTGCTATCCAGGC |
| β-actin-R | CTCCTTAATGTCACGCACGAT |
| TRAF4-F | TATTGGGCCTGCCTATCCG |
| TRAF4-R | CAAAACTCGCACTTGAGGCG |
| SETDB1-F | AGGAACTTCGGCATTTCATCG |
| SETDB1-R | TGTCCCGGTATTGTAGTCCCA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gu, H.; Zhu, S.; Peng, C.; Wei, Z.; Shen, Y.; Yuan, C.; Yang, H.; Cui, H.; Yang, L. TRAF4 Promotes the Proliferation of Glioblastoma by Stabilizing SETDB1 to Activate the AKT Pathway. Int. J. Mol. Sci. 2022, 23, 10161. https://doi.org/10.3390/ijms231710161
Gu H, Zhu S, Peng C, Wei Z, Shen Y, Yuan C, Yang H, Cui H, Yang L. TRAF4 Promotes the Proliferation of Glioblastoma by Stabilizing SETDB1 to Activate the AKT Pathway. International Journal of Molecular Sciences. 2022; 23(17):10161. https://doi.org/10.3390/ijms231710161
Chicago/Turabian StyleGu, Hongyu, Shunqin Zhu, Cheng Peng, Zekun Wei, Yang Shen, Chaoyu Yuan, He Yang, Hongjuan Cui, and Liqun Yang. 2022. "TRAF4 Promotes the Proliferation of Glioblastoma by Stabilizing SETDB1 to Activate the AKT Pathway" International Journal of Molecular Sciences 23, no. 17: 10161. https://doi.org/10.3390/ijms231710161
APA StyleGu, H., Zhu, S., Peng, C., Wei, Z., Shen, Y., Yuan, C., Yang, H., Cui, H., & Yang, L. (2022). TRAF4 Promotes the Proliferation of Glioblastoma by Stabilizing SETDB1 to Activate the AKT Pathway. International Journal of Molecular Sciences, 23(17), 10161. https://doi.org/10.3390/ijms231710161

