Agomelatine Changed the Expression and Methylation Status of Inflammatory Genes in Blood and Brain Structures of Male Wistar Rats after Chronic Mild Stress Procedure
Abstract
:1. Introduction
2. Results
2.1. Sucrose Intakes and Body Weights of Animals Exposed to CMS and Agomelatine Administration
2.2. Gene Expression
2.2.1. Gene Expression in PBMCs after CMS Procedure and Agomelatine Administration
2.2.2. Gene Expression in the Brain after CMS Procedure and Agomelatine Administration
2.3. Methylation of Studied Genes Promoters
2.3.1. Methylation Status in PBMCs after CMS Procedure and Agomelatine Administration
2.3.2. Methylation Status in PBMCs after CMS Procedure and Agomelatine Administration
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Chronic Mild Stress Procedure
4.3. Drug Administration
4.4. Specimen Collection, RNA and DNA Isolation
4.5. Reverse Transcription and Gene mRNA Expression
4.6. Methylation-Sensitive High-Resolution Melting (MS-HRM) PCR
4.7. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Moussavi, S.; Chatterji, S.; Verdes, E.; Tandon, A.; Patel, V.; Ustun, B. Depression, chronic diseases, and decrements in health: Results from the World Health Surveys. Lancet 2007, 370, 851–858. [Google Scholar] [CrossRef]
- WHO. Depression. 2020. Available online: https://www.who.int/news-room/fact-sheets/detail/d (accessed on 12 November 2020).
- Al-Harbi, K.S. Treatment-resistant depression: Therapeutic trends, challenges, and future directions. Patient Prefer. Adherence 2012, 6, 369–388. [Google Scholar] [CrossRef]
- Ionescu, D.F.; Rosenbaum, J.F.; Alpert, J.E. Pharmacological approaches to the challenge of treatment-resistant depression. Dialogues Clin. Neurosci. 2015, 17, 111–126. [Google Scholar] [CrossRef] [PubMed]
- Capuron, L.; Miller, A.H. Immune system to brain signaling: Neuropsychopharmacological implications. Pharmacol. Ther. 2011, 130, 226–238. [Google Scholar] [CrossRef] [PubMed]
- Zorrilla, E.P.; Luborsky, L.; McKay, J.R.; Rosenthal, R.; Houldin, A.; Tax, A.; McCorkle, R.; Seligman, D.A.; Schmidt, K. The relationship of depression and stressors to immunological assays: A meta-analytic review. Brain Behav. Immun. 2001, 15, 199–226. [Google Scholar] [CrossRef] [PubMed]
- Howren, M.B.; Lamkin, D.M.; Suls, J. Associations of depression with c-reactive protein, IL-1, and IL-6: A meta-analysis. Psychosom. Med. 2009, 71, 171–186. [Google Scholar] [CrossRef] [PubMed]
- Miller, A.H.; Maletic, V.; Raison, C.L. Inflammation and Its Discontents: The Role of Cytokines in the Pathophysiology of Major Depression. Biol. Psychiatry 2009, 65, 732–741. [Google Scholar] [CrossRef] [PubMed]
- Dowlati, Y.; Herrmann, N.; Swardfager, W.; Liu, H.; Sham, L.; Reim, E.K.; Lanctôt, K.L. A Meta-Analysis of Cytokines in Major Depression. Biol. Psychiatry 2010, 67, 446–457. [Google Scholar] [CrossRef] [PubMed]
- Schiepers, O.J.G.; Wichers, M.C.; Maes, M. Cytokines and major depression. Prog. Neuropsychopharmacol Biol. Psychiatry 2005, 29, 201–217. [Google Scholar] [CrossRef]
- Steiner, J.; Bielau, H.; Brisch, R.; Danos, P.; Ullrich, O.; Mawrin, C.; Bernstein, H.-G.; Bogerts, B. Immunological aspects in the neurobiology of suicide: Elevated microglial density in schizophrenia and depression is associated with suicide. J. Psychiatr. Res. 2008, 42, 151–157. [Google Scholar] [CrossRef] [PubMed]
- Park, J.; Min, J.S.; Kim, B.; Chae, U.B.; Yun, J.W.; Choi, M.S.; Kong, I.-K.; Chang, K.T.; Lee, D.K. Mitochondrial ROS govern the LPS-induced pro-inflammatory response in microglia cells by regulating MAPK and NF-κB pathways. Neurosci. Lett. 2015, 584, 191–196. [Google Scholar] [CrossRef] [PubMed]
- Duman, R.S.; Li, N. A neurotrophic hypothesis of depression: Role of synaptogenesis in the actions of NMDA receptor antagonists. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2012, 367, 2475–2484. [Google Scholar] [CrossRef] [PubMed]
- Lindholm, J.S.O.; Castrén, E. Mice with altered BDNF signaling as models for mood disorders and antidepressant effects. Front. Behav. Neurosci. 2014, 8, 143. [Google Scholar] [CrossRef] [PubMed]
- Michelucci, A.; Heurtaux, T.; Grandbarbe, L.; Morga, E.; Heuschling, P. Characterization of the microglial phenotype under specific pro-inflammatory and anti-inflammatory conditions: Effects of oligomeric and fibrillar amyloid-β. J. Neuroimmunol. 2009, 210, 3–12. [Google Scholar] [CrossRef] [PubMed]
- Frank, M.G.; Hershman, S.A.; Weber, M.D.; Watkins, L.R.; Maier, S.F. Chronic exposure to exogenous glucocorticoids primes microglia to pro-inflammatory stimuli and induces NLRP3 mRNA in the hippocampus. Psychoneuroendocrinology 2014, 40, 191–200. [Google Scholar] [CrossRef]
- Han, A.; Yeo, H.; Park, M.J.; Kim, S.H.; Choi, H.J.; Hong, C.W.; Kwon, M.S. IL-4/10 prevents stress vulnerability following imipramine discontinuation. J. Neuroinflamm. 2015, 12, 197. [Google Scholar] [CrossRef] [PubMed]
- Vogelzangs, N.; Duivis, H.E.; Beekman, A.T.F.; Kluft, C.; Neuteboom, J.; Hoogendijk, W.; Smit, J.H.; de Jonge, p.; Penninx, B.W.J.H. Association of depressive disorders, depression characteristics and antidepressant medication with inflammation. Transl. Psychiatry 2012, 2, e79. [Google Scholar]
- Ma, K.; Zhang, H.; Baloch, Z. Pathogenetic and therapeutic applications of tumor necrosis factor-α (TNF-α) in major depressive disorder: A systematic review. Int. J. Mol. Sci. 2016, 17, 733. [Google Scholar] [CrossRef] [PubMed]
- Miller, A.H.; Raison, C.L. The role of inflammation in depression: From evolutionary imperative to modern treatment target. Nat. Rev. Immunol. 2016, 16, 22–34. [Google Scholar] [CrossRef]
- Strawbridge, R.; Arnone, D.; Danese, A.; Papadopoulos, A.; Herane Vives, A.; Cleare, A.J. Inflammation and clinical response to treatment in depression: A meta-analysis. Eur. Neuropsychopharmacol. 2015, 25, 1532–1543. [Google Scholar] [CrossRef] [PubMed]
- Myers, R.L. The 100 Most Important Chemical Compounds: A Reference Guide; Greenwood Press: Westfield, CT, USA, 2008. [Google Scholar]
- Westenberg, H.G.M.; Sandner, C. Tolerability and safety of fluvoxamine and other antidepressants. Int. J. Clin. Pract. 2006, 4, 482–491. [Google Scholar] [CrossRef] [PubMed]
- Whiskey, E.; Taylor, D. A review of the adverse effects and safety of noradrenergic antidepressants. J. Psychopharmacol. 2013, 27, 732–739. [Google Scholar] [CrossRef] [PubMed]
- Moret, C.; Isaac, M.; Briley, M. Review: Problems associated with long-term treatment with selective serotonin reuptake inhibitors. J. Psychopharmacol. 2009, 23, 967–974. [Google Scholar] [CrossRef] [PubMed]
- De Berardis, D.; Fornaro, M.; Serroni, N.; Campanella, D.; Rapini, G.; Olivieri, L.; Srinivasan, V.; Iasevoli, F.; Tomasetti, C.; De Bartolomeis, A.; et al. Agomelatine beyond borders: Current evidences of its efficacy in disorders other than major depression. Internat. J. Mol. Sci. 2015, 16, 1111–1130. [Google Scholar] [CrossRef]
- De Bodinat, C.; Guardiola-Lemaitre, B.; Mocaër, E.; Renard, P.; Muñoz, C.; Millan, M.J. Agomelatine, the first melatonergic antidepressant: Discovery, characterization and development. Nat. Rev. Drug Discov. 2010, 9, 628–642. [Google Scholar] [CrossRef]
- Banasr, M.; Soumier, A.; Hery, M.; Mocaër, E.; Daszuta, A. Agomelatine, a New Antidepressant, Induces Regional Changes in Hippocampal Neurogenesis. Biol. Psychiatry 2006, 59, 1087–1096. [Google Scholar] [CrossRef] [PubMed]
- Molteni, R.; Macchi, F.; Zecchillo, C.; Dell’Agli, M.; Colombo, E.; Calabrese, F.; Guidotti, G.; Racagni, G.; Riva, M.A. Modulation of the inflammatory response in rats chronically treated with the antidepressant agomelatine. Eur. Neuropsychopharmacol. 2013, 23, 1645–1655. [Google Scholar] [CrossRef] [PubMed]
- Kissin, E.Y.; Lemaire, R.; Korn, J.H.; Lafyatis, R. Transforming growth factor β induces fibroblast fibrillin-1 matrix formation. Arthritis Rheum. 2002, 46, 3000–3009. [Google Scholar] [CrossRef]
- Yamagiwa, S.; Gray, J.D.; Hashimoto, S.; Horwitz, D.A. A Role for TGF-β in the Generation and Expansion of CD4 + CD25 + Regulatory T Cells from Human Peripheral Blood. J. Immunol. 2001, 166, 7282–7289. [Google Scholar] [CrossRef]
- Vivien, D.; Ali, C. Transforming growth factor-β signalling in brain disorders. Cytokine Growth Factor Rev. 2006, 17, 121–128. [Google Scholar] [CrossRef]
- Aktan, F. iNOS-mediated nitric oxide production and its regulation. Life Sci. 2004, 75, 639–653. [Google Scholar] [CrossRef]
- Hansson, M.; Olsson, I.; Nauseef, W.M. Biosynthesis, processing, and sorting of human myeloperoxidase. Arch. Biochem. Biophys. 2006, 445, 214–224. [Google Scholar] [CrossRef] [PubMed]
- Kröger, A.; Köster, M.; Schroeder, K.; Hauser, H.; Mueller, P.P. Review: Activities of IRF-1. J. Interf. Cytokine Res. 2002, 22, 5–14. [Google Scholar] [CrossRef] [PubMed]
- Gerondakis, S.; Fulford, T.S.; Messina, N.L.; Grumont, R.J. NF-κB control of T cell development. Nat. Immunol. 2014, 15, 15–25. [Google Scholar] [CrossRef] [PubMed]
- van Delft, M.A.M.; Huitema, L.F.A.; Tas, S.W. The contribution of NF-κB signalling to immune regulation and tolerance. Eur. J. Clin. Investig. 2015, 45, 529–539. [Google Scholar] [CrossRef] [PubMed]
- Napetschnig, J.; Wu, H. Molecular Basis of NF-κB Signaling. Annu. Rev. Biophys. 2013, 42, 443–468. [Google Scholar] [CrossRef]
- Karin, M.; Ben-Neriah, Y. Phosphorylation Meets Ubiquitination: The Control of NF-κB Activity. Annu. Rev. Immunol. 2000, 18, 621–663. [Google Scholar] [CrossRef] [PubMed]
- Cardinez, C.; Miraghazadeh, B.; Tanita, K.; Da Silva, E.; Hoshino, A.; Okada, S.; Chand, R.; Asano, T.; Tsumura, M.; Yoshida, K.; et al. Gain-of-function IKBKB mutation causes human combined immune deficiency. J. Exp. Med. 2018, 215, 2715–2724. [Google Scholar] [CrossRef] [PubMed]
- Bierhaus, A.; Wolf, J.; Andrassy, M.; Rohleder, N.; Humpert, P.M.; Petrov, D.; Ferstl, R.; von Eynatten, M.; Wendt, T.; Rudofsky, G.; et al. A mechanism converting psychosocial stress into mononuclear cell activation. Proc. Natl. Acad. Sci. USA 2003, 100, 1920–1925. [Google Scholar] [CrossRef]
- Pace, T.W.W.; Mletzko, T.C.; Alagbe, O.; Musselman, D.L.; Nemeroff, C.B.; Miller, A.H.; Heim, C. Increased stress-induced inflammatory responses in male patients with major depression and increased early life stress. Am. J. Psychiatry 2006, 163, 1630–1633. [Google Scholar] [CrossRef] [PubMed]
- Dong, S.-Q.; Zhang, Q.-P.; Zhu, J.-X.; Chen, M.; Li, C.-F.; Liu, Q.; Geng, D.; Yi, L.-T. Gypenosides reverses depressive behavior via inhibiting hippocampal neuroinflammation. Biomed. Pharmacother 2018, 106, 1153–1160. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.-M.; Niu, L.; Wang, L.-L.; Bai, L.; Fang, X.-Y.; Li, Y.-C.; Yi, L.-T. Berberine attenuates depressive-like behaviors by suppressing neuro-inflammation in stressed mice. Brain Res Bull. 2017, 134, 220–227. [Google Scholar] [CrossRef]
- Kunzmann, S.; Mantel, P.-Y.; Wohlfahrt, J.G.; Akdis, M.; Blaser, K.; Schmidt-Weber, C.B. Histamine enhances TGF-β1-mediated suppression of Th2 responses. FASEB J. 2003, 17, 1089–1095. [Google Scholar] [CrossRef]
- Hong, M.; Zheng, J.; Ding, Z.-Y.; Chen, J.-H.; Yu, L.; Niu, Y.; Hua, Y.-Q.; Wang, L.-L. Imbalance between Th17 and treg cells may play an important role in the development of chronic unpredictable mild stress-induced depression in mice. Neuroimmunomodulation 2012, 20, 39–50. [Google Scholar] [CrossRef] [PubMed]
- Musil, R.; Schwarz, M.; Riedel, M.; Dehning, S.; Cerovecki, A.; Spellmann, I.; Arolt, V.; Müller, N. Elevated macrophage migration inhibitory factor and decreased transforming growth factor-beta levels in major depression-No influence of celecoxib treatment. J. Affect. Disord. 2011, 134, 217–225. [Google Scholar] [CrossRef] [PubMed]
- Sutcigil, L.; Oktenli, C.; Musabak, U.H.; Bozkurt, A.; Cansever, A.; Uzun, O.; Sanisoglu, S.Y.; Yesilova, Z.; Ozmenler, N.; Ozsahin, A.; et al. Pro- and anti-inflammatory cytokine balance in major depression: Effect of sertraline therapy. Clin. Dev. Immunol. 2007, 2007, 76396. [Google Scholar] [CrossRef] [PubMed]
- Myint, A.-M.; Leonard, B.E.; Steinbusch, H.W.; Kim, Y.-K. Th1, Th2, and Th3 cytokine alterations in major depression. J. Affect. Disord. 2005, 88, 167–173. [Google Scholar] [CrossRef]
- Lee, K.M.; Kim, Y.K. The role of IL-12 and TGF-β1 in the pathophysiology of major depressive disorder. Int. Immunopharmacol. 2006, 6, 1298–1304. [Google Scholar] [CrossRef] [PubMed]
- Cassano, P.; Hidalgo, A.; Burgos, V.; Adris, S.; Argibay, P. Hippocampal upregulation of the cyclooxygenase-2 gene following neonatal clomipramine treatment (a model of depression). Pharmacogenom. J. 2006, 6, 381–387. [Google Scholar] [CrossRef]
- Chen, Q.; Luo, Y.; Kuang, S.; Yang, Y.; Tian, X.; Ma, J.; Mai, S.; Xue, L.; Yang, J. Cyclooxygenase-2 Signalling Pathway in the Cortex is Involved in the Pathophysiological Mechanisms in the Rat Model of Depression. Sci. Rep. 2017, 7, 488. [Google Scholar] [CrossRef]
- Tchekalarova, J.; Atanasova, D.; Kortenska, L.; Atanasova, M.; Lazarov, N. Chronic agomelatine treatment prevents comorbid depression in the post-status epilepticus model of acquired epilepsy through suppression of inflammatory signaling. Neurobiol Dis. 2018, 115, 127–144. [Google Scholar] [CrossRef]
- Chung, S.Y.; Han, S.H. Melatonin attenuates kainic acid-induced hippocampal neurodegeneration and oxidative stress through microglial inhibition. J. Pineal Res. 2003, 34, 95–102. [Google Scholar] [CrossRef]
- Tchekalarova, J.; Atanasova, D.; Nenchovska, Z.; Atanasova, M.; Kortenska, L.; Gesheva, R.; Lazarov, N. Agomelatine protects against neuronal damage without preventing epileptogenesis in the kainate model of temporal lobe epilepsy. Neurobiol. Dis. 2017, 104, 1–14. [Google Scholar] [CrossRef]
- Gupta, K.; Gupta, R.; Bhatia, M.S.; Tripathi, A.K.; Gupta, L.K. Effect of Agomelatine and Fluoxetine on HAM-D Score, Serum Brain-Derived Neurotrophic Factor, and Tumor Necrosis Factor-α Level in Patients with Major Depressive Disorder With Severe Depression. J. Clin. Pharmacol. 2017, 97, 184–188. [Google Scholar]
- Papp, M. Models of affective illness: Chronic mild stress in the rat. Curr. Protoc. Pharmacol. 2012, 5, 5.9.1–5.9.11. [Google Scholar] [CrossRef] [PubMed]
- Wigner, P.; Synowiec, E.; Jóźwiak, P.; Czarny, P.; Białek, K.; Bijak, M.; Szemraj, J.; Gruca, P.; Papp, M.; Sliwinski, T. The Impact of Chronic Mild Stress and Agomelatine Treatment on the Expression Level and Methylation Status of Genes Involved in Tryptophan Catabolic Pathway in PBMCs and Brain Structures. Genes 2020, 11, 1093. [Google Scholar] [CrossRef]
- Wojdacz, T.K.; Dobrovic, A.; Hansen, L.L. Methylation-sensitive high-resolution melting. Nat. Protoc. 2008, 3, 1903–1908. [Google Scholar] [CrossRef] [PubMed]
- Wojdacz, T.K.; Dobrovic, A. Methylation-sensitive high resolution melting (MS-HRM): A new approach for sensitive and high-throughput assessment of methylation. Nucleic Acids Res. 2007, 35, e41. [Google Scholar] [CrossRef]






| Control | Control/ Agomelatine | Stressed | Stressed/ Saline | Stressed/ Agomelatine | |
|---|---|---|---|---|---|
| Week 0 | 9.85 ± 0.74 | 12.90 ± 1.83 | 11.59 ± 1.04 | 11.30 ±0.89 | 11.76 ± 0.64 |
| Week 2 | 11.63 ± 1.13 | 13.27 ± 1.43 | 5.73 ± 0.98 *** | 6.04 ± 1.44 ### | 6.50 ± 0.72 &&& |
| Week 7 | 12.46 ± 2.10 | 5.75 ± 0.44 | 12.32 ± 1.13 @@@ |
| Gene | Starter Sequence (5′−>3′) | Tm [C°] | Product Size [bp] | Product %CGs |
|---|---|---|---|---|
| IKBKB | F:AGGGTGGTTTTTTATTTTTATTTT R:AACCCCCACTAAAACTAACTTAA | 55 | 117 | 36.75 |
| IRF1 | F:TTGGAGATTTAGGGAGTTAGGT R:CCCCTTACCTATCTTAAAAAACC | 55 | 123 | 43.90 |
| PTGS2 | F:GTAATAGTAGGGAGGAAAAATTTTAA R:ATCCTAACAAACCCCAAA | 55 | 111 | 37.84 |
| TGFA | F:GTTTTTTTAGGTGGTTGGTTAAG R:CTTCAAACACCTCCCTACAATA | 55 | 188 | 42.55 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bialek, K.; Czarny, P.; Wigner, P.; Synowiec, E.; Kolodziej, L.; Bijak, M.; Szemraj, J.; Papp, M.; Sliwinski, T. Agomelatine Changed the Expression and Methylation Status of Inflammatory Genes in Blood and Brain Structures of Male Wistar Rats after Chronic Mild Stress Procedure. Int. J. Mol. Sci. 2022, 23, 8983. https://doi.org/10.3390/ijms23168983
Bialek K, Czarny P, Wigner P, Synowiec E, Kolodziej L, Bijak M, Szemraj J, Papp M, Sliwinski T. Agomelatine Changed the Expression and Methylation Status of Inflammatory Genes in Blood and Brain Structures of Male Wistar Rats after Chronic Mild Stress Procedure. International Journal of Molecular Sciences. 2022; 23(16):8983. https://doi.org/10.3390/ijms23168983
Chicago/Turabian StyleBialek, Katarzyna, Piotr Czarny, Paulina Wigner, Ewelina Synowiec, Lukasz Kolodziej, Michal Bijak, Janusz Szemraj, Mariusz Papp, and Tomasz Sliwinski. 2022. "Agomelatine Changed the Expression and Methylation Status of Inflammatory Genes in Blood and Brain Structures of Male Wistar Rats after Chronic Mild Stress Procedure" International Journal of Molecular Sciences 23, no. 16: 8983. https://doi.org/10.3390/ijms23168983
APA StyleBialek, K., Czarny, P., Wigner, P., Synowiec, E., Kolodziej, L., Bijak, M., Szemraj, J., Papp, M., & Sliwinski, T. (2022). Agomelatine Changed the Expression and Methylation Status of Inflammatory Genes in Blood and Brain Structures of Male Wistar Rats after Chronic Mild Stress Procedure. International Journal of Molecular Sciences, 23(16), 8983. https://doi.org/10.3390/ijms23168983

