The Newly Sequenced Genome of Pisum sativum Is Replete with Potential G-Quadruplex-Forming Sequences—Implications for Evolution and Biological Regulation
Abstract
:1. Introduction
2. Results
2.1. Comparison of PQS Sequences in P. sativum Genome
2.2. Experimental Demonstration of G4 Formation for Pisum mtDNA and cpDNA Sequences
2.3. Localization of PQSs in P. sativum Genome
2.4. PQSs in Transposable Elements
3. Discussion
4. Materials and Methods
4.1. Process of Analysis
4.2. Analysis of Repetitive DNA from Unassembled Reads Using RepeatExplorer2 and TAREAN
4.3. Sequence Matching and Transposon Annotation (BLAST)
4.4. Analysis of PQSs around Annotated NCBI Features and Repeats from Our RepeatExplorer2 Analysis
4.5. Statistical Analysis
4.6. Experimental Demonstration of G4 Formation
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Trněný, O.; Brus, J.; Hradilová, I.; Rathore, A.; Das, R.R.; Kopecký, P.; Coyne, C.J.; Reeves, P.; Richards, C.; Smýkal, P. Molecular Evidence for Two Domestication Events in the Pea Crop. Genes 2018, 9, 535. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Powers, S.E.; Thavarajah, D. Checking Agriculture’s Pulse: Field Pea (Pisum Sativum L.), Sustainability, and Phosphorus Use Efficiency. Front. Plant Sci. 2019, 10, 1489. [Google Scholar] [CrossRef] [PubMed]
- Gu, B.; Chen, Y.; Xie, F.; Murray, J.D.; Miller, A.J. Inorganic Nitrogen Transport and Assimilation in Pea (Pisum Sativum). Genes 2022, 13, 158. [Google Scholar] [CrossRef] [PubMed]
- Labeeb, M.; Badr, A.; Haroun, S.A.; Mattar, M.Z.; El-Kholy, A.S. Ultrastructural and Molecular Implications of Ecofriendly Made Silver Nanoparticles Treatments in Pea (Pisum Sativum L.). J. Genet. Eng. Biotechnol. 2022, 20, 5. [Google Scholar] [CrossRef]
- Mendel, G.J. Versuche Über Plflanzenhybriden. Verh. Nat. Ver. Brünn Abh. 1865, 4, 3–47. [Google Scholar]
- Bateson, W. Mendel’s Principles of Heredity; Cambridge University Press: Cambridge, UK, 1902; ISBN 978-0-511-69446-2. [Google Scholar]
- Bartas, M.; Brázda, V.; Karlický, V.; Červeň, J.; Pečinka, P. Bioinformatics Analyses and in Vitro Evidence for Five and Six Stacked G-Quadruplex Forming Sequences. Biochimie 2018, 150, 70–75. [Google Scholar] [CrossRef]
- Cho, H.; Cho, H.S.; Nam, H.; Jo, H.; Yoon, J.; Park, C.; Dang, T.V.T.; Kim, E.; Jeong, J.; Park, S.; et al. Translational Control of Phloem Development by RNA G-Quadruplex–JULGI Determines Plant Sink Strength. Nat. Plants 2018, 4, 376–390. [Google Scholar] [CrossRef]
- Kim, N. The Interplay between G-Quadruplex and Transcription. Curr. Med. Chem. 2019, 26, 2898–2917. [Google Scholar] [CrossRef]
- Robinson, J.; Raguseo, F.; Nuccio, S.P.; Liano, D.; Di Antonio, M. DNA G-Quadruplex Structures: More than Simple Roadblocks to Transcription? Nucleic Acids Res. 2021, 49, 8419–8431. [Google Scholar] [CrossRef]
- Feng, Y.; Tao, S.; Zhang, P.; Sperti, F.R.; Liu, G.; Cheng, X.; Zhang, T.; Yu, H.; Wang, X.-E.; Chen, C.; et al. Epigenomic Features of DNA G-Quadruplexes and Their Roles in Regulating Rice Gene Transcription. Plant Physiol. 2022, 188, 1632–1648. [Google Scholar] [CrossRef]
- Bohálová, N.; Cantara, A.; Bartas, M.; Kaura, P.; Šťastný, J.; Pečinka, P.; Fojta, M.; Mergny, J.-L.; Brázda, V. Analyses of Viral Genomes for G-Quadruplex Forming Sequences Reveal Their Correlation with the Type of Infection. Biochimie 2021, 186, 13–27. [Google Scholar] [CrossRef]
- Lavezzo, E.; Berselli, M.; Frasson, I.; Perrone, R.; Palù, G.; Brazzale, A.R.; Richter, S.N.; Toppo, S. G-Quadruplex Forming Sequences in the Genome of All Known Human Viruses: A Comprehensive Guide. PLoS Comput. Biol. 2018, 14, e1006675. [Google Scholar] [CrossRef] [Green Version]
- Bartas, M.; Čutová, M.; Brázda, V.; Kaura, P.; Šťastný, J.; Kolomazník, J.; Coufal, J.; Goswami, P.; Červeň, J.; Pečinka, P. The Presence and Localization of G-Quadruplex Forming Sequences in the Domain of Bacteria. Molecules 2019, 24, 1711. [Google Scholar] [CrossRef] [Green Version]
- Brázda, V.; Luo, Y.; Bartas, M.; Kaura, P.; Porubiaková, O.; Št’astnỳ, J.; Pečinka, P.; Verga, D.; Da Cunha, V.; Takahashi, T.S. G-Quadruplexes in the Archaea Domain. Biomolecules 2020, 10, 1349. [Google Scholar] [CrossRef]
- Čutová, M.; Manta, J.; Porubiaková, O.; Kaura, P.; Šťastný, J.; Jagelská, E.B.; Goswami, P.; Bartas, M.; Brázda, V. Divergent Distributions of Inverted Repeats and G-Quadruplex Forming Sequences in Saccharomyces Cerevisiae. Genomics 2020, 112, 1897–1901. [Google Scholar] [CrossRef]
- Warner, E.F.; Bohálová, N.; Brázda, V.; Waller, Z.A.E.; Bidula, S. Analysis of Putative Quadruplex-Forming Sequences in Fungal Genomes: Novel Antifungal Targets? Microb. Genom. 2021, 7, 000570. [Google Scholar] [CrossRef]
- Hänsel-Hertsch, R.; Di Antonio, M.; Balasubramanian, S. DNA G-Quadruplexes in the Human Genome: Detection, Functions and Therapeutic Potential. Nat. Rev. Mol. Cell Biol. 2017, 18, 279–284. [Google Scholar] [CrossRef]
- Garg, R.; Aggarwal, J.; Thakkar, B. Genome-Wide Discovery of G-Quadruplex Forming Sequences and Their Functional Relevance in Plants. Sci. Rep. 2016, 6, 28211. [Google Scholar] [CrossRef] [Green Version]
- Yang, X.; Cheema, J.; Zhang, Y.; Deng, H.; Duncan, S.; Umar, M.I.; Zhao, J.; Liu, Q.; Cao, X.; Kwok, C.K. RNA G-Quadruplex Structures Exist and Function in Vivo in Plants. Genome Biol. 2020, 21, 226. [Google Scholar] [CrossRef]
- Griffin, B.D.; Bass, H.W. Plant G-Quadruplex (G4) Motifs in DNA and RNA. Abundant, Intriguing Sequences of Unknown Function. Plant Sci. 2018, 269, 143–147. [Google Scholar] [CrossRef]
- Volná, A.; Bartas, M.; Karlický, V.; Nezval, J.; Kundrátová, K.; Pečinka, P.; Špunda, V.; Červeň, J. G-Quadruplex in Gene Encoding Large Subunit of Plant RNA Polymerase II: A Billion-Year-Old Story. Int. J. Mol. Sci. 2021, 22, 7381. [Google Scholar] [CrossRef] [PubMed]
- Kreplak, J.; Madoui, M.-A.; Cápal, P.; Novák, P.; Labadie, K.; Aubert, G.; Bayer, P.E.; Gali, K.K.; Syme, R.A.; Main, D.; et al. A Reference Genome for Pea Provides Insight into Legume Genome Evolution. Nat. Genet. 2019, 51, 1411–1422. [Google Scholar] [CrossRef] [PubMed]
- Ellis, T.H.N.; Poyser, S.J. An Integrated and Comparative View of Pea Genetic and Cytogenetic Maps. New Phytol. 2002, 153, 17–25. [Google Scholar] [CrossRef]
- Macas, J.; Novák, P.; Pellicer, J.; Čížková, J.; Koblížková, A.; Neumann, P.; Fuková, I.; Doležel, J.; Kelly, L.J.; Leitch, I.J. In Depth Characterization of Repetitive DNA in 23 Plant Genomes Reveals Sources of Genome Size Variation in the Legume Tribe Fabeae. PLoS ONE 2015, 10, e0143424. [Google Scholar] [CrossRef]
- Li, S.-F.; Su, T.; Cheng, G.-Q.; Wang, B.-X.; Li, X.; Deng, C.-L.; Gao, W.-J. Chromosome Evolution in Connection with Repetitive Sequences and Epigenetics in Plants. Genes 2017, 8, 290. [Google Scholar] [CrossRef] [Green Version]
- Chen, J.; Cheng, M.; Salgado, G.F.; Stadlbauer, P.; Zhang, X.; Amrane, S.; Guédin, A.; He, F.; Šponer, J.; Ju, H.; et al. The Beginning and the End: Flanking Nucleotides Induce a Parallel G-Quadruplex Topology. Nucleic Acids Res. 2021, 49, 9548–9559. [Google Scholar] [CrossRef]
- Luo, Y.; Granzhan, A.; Verga, D.; Mergny, J.-L. FRET-MC: A Fluorescence Melting Competition Assay for Studying G4 Structures in Vitro. Biopolymers 2021, 112, e23415. [Google Scholar] [CrossRef]
- Cesare, A.J.; Quinney, N.; Willcox, S.; Subramanian, D.; Griffith, J.D. Telomere Looping in P. sativum (Common Garden Pea). Plant J. 2003, 36, 271–279. [Google Scholar] [CrossRef]
- Tran, P.L.T.; Mergny, J.-L.; Alberti, P. Stability of Telomeric G-Quadruplexes. Nucleic Acids Res. 2011, 39, 3282–3294. [Google Scholar] [CrossRef] [Green Version]
- De Cian, A.; Grellier, P.; Mouray, E.; Depoix, D.; Bertrand, H.; Monchaud, D.; Teulade-Fichou, M.-P.; Mergny, J.-L.; Alberti, P. Plasmodium Telomeric Sequences: Structure, Stability and Quadruplex Targeting by Small Compounds. ChemBioChem 2008, 9, 2730–2739. [Google Scholar] [CrossRef]
- Burstin, J.; Kreplak, J.; Macas, J.; Lichtenzveig, J. Pisum Sativum (Pea). Trends Genet. 2020, 36, 312–313. [Google Scholar] [CrossRef]
- Jakowitsch, J.; Mette, M.F.; van der Winden, J.; Matzke, M.A.; Matzke, A.J.M. Integrated Pararetroviral Sequences Define a Unique Class of Dispersed Repetitive DNA in Plants. Proc. Natl. Acad. Sci. USA 1999, 96, 13241–13246. [Google Scholar] [CrossRef] [Green Version]
- Bennetzen, J.L.; Wang, H. The Contributions of Transposable Elements to the Structure, Function, and Evolution of Plant Genomes. Annu. Rev. Plant Biol. 2014, 65, 505–530. [Google Scholar] [CrossRef]
- Takahashi, H.; Nakagawa, A.; Kojima, S.; Takahashi, A.; Cha, B.-Y.; Woo, J.-T.; Nagai, K.; Machida, Y.; Machida, C. Discovery of Novel Rules for G-Quadruplex-Forming Sequences in Plants by Using Bioinformatics Methods. J. Biosci. Bioeng. 2012, 114, 570–575. [Google Scholar] [CrossRef]
- Yadav, V.; Kim, N.; Tuteja, N.; Yadav, P. G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance. Front. Plant Sci. 2017, 8, 1163. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Zhao, M.; Zhang, Q.; Zhu, G.-F.; Li, F.-F.; Du, L.-F. Genomic Distribution and Possible Functional Roles of Putative G-Quadruplex Motifs in Two Subspecies of Oryza Sativa. Comput. Biol. Chem. 2015, 56, 122–130. [Google Scholar] [CrossRef]
- Bohálová, N.; Dobrovolná, M.; Brázda, V.; Bidula, S. Conservation and Over-Representation of G-Quadruplex Sequences in Regulatory Regions of Mitochondrial DNA across Distinct Taxonomic Sub-Groups. Biochimie 2022, 194, 28–34. [Google Scholar] [CrossRef]
- Falabella, M.; Kolesar, J.E.; Wallace, C.; de Jesus, D.; Sun, L.; Taguchi, Y.V.; Wang, C.; Wang, T.; Xiang, I.M.; Alder, J.K.; et al. G-Quadruplex Dynamics Contribute to Regulation of Mitochondrial Gene Expression. Sci. Rep. 2019, 9, 5605. [Google Scholar] [CrossRef]
- Castillo Bosch, P.; Segura-Bayona, S.; Koole, W.; van Heteren, J.T.; Dewar, J.M.; Tijsterman, M.; Knipscheer, P. FANCJ Promotes DNA Synthesis through G-Quadruplex Structures. EMBO J. 2014, 33, 2521–2533. [Google Scholar] [CrossRef] [Green Version]
- Cantara, A.; Luo, Y.; Dobrovolná, M.; Bohalova, N.; Fojta, M.; Verga, D.; Guittat, L.; Cucchiarini, A.; Savrimoutou, S.; Häberli, C.; et al. G-Quadruplexes in Helminth Parasites. Nucleic Acids Res. 2022, 50, 2719–2735. [Google Scholar] [CrossRef]
- Lee, D.S.M.; Ghanem, L.R.; Barash, Y. Integrative Analysis Reveals RNA G-Quadruplexes in UTRs Are Selectively Constrained and Enriched for Functional Associations. Nat. Commun. 2020, 11, 527. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brázda, V.; Hároníková, L.; Liao, J.C.; Fojta, M. DNA and RNA Quadruplex-Binding Proteins. Int. J. Mol. Sci. 2014, 15, 17493–17517. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sjakste, T.; Leonova, E.; Petrovs, R.; Trapina, I.; Röder, M.S.; Sjakste, N. Tight DNA-Protein Complexes Isolated from Barley Seedlings Are Rich in Potential Guanine Quadruplex Sequences. PeerJ 2020, 8, e8569. [Google Scholar] [CrossRef] [PubMed]
- Volná, A.; Bartas, M.; Nezval, J.; Špunda, V.; Pečinka, P.; Červeň, J. Searching for G-Quadruplex-Binding Proteins in Plants: New Insight into Possible G-Quadruplex Regulation. BioTech 2021, 10, 20. [Google Scholar] [CrossRef] [PubMed]
- Kejnovsky, E.; Tokan, V.; Lexa, M. Transposable Elements and G-Quadruplexes. Chromosome Res. 2015, 23, 615–623. [Google Scholar] [CrossRef] [PubMed]
- Sayers, E.W.; Agarwala, R.; Bolton, E.E.; Brister, J.R.; Canese, K.; Clark, K.; Connor, R.; Fiorini, N.; Funk, K.; Hefferon, T. Database Resources of the National Center for Biotechnology Information. Nucleic Acids Res. 2019, 47, D23. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brázda, V.; Kolomazník, J.; Lýsek, J.; Hároníková, L.; Coufal, J.; Št’astný, J. Palindrome Analyser—A New Web-Based Server for Predicting and Evaluating Inverted Repeats in Nucleotide Sequences. Biochem. Biophys. Res. Commun. 2016, 478, 1739–1745. [Google Scholar] [CrossRef] [PubMed]
- Brázda, V.; Kolomazník, J.; Lỳsek, J.; Bartas, M.; Fojta, M.; Št’astnỳ, J.; Mergny, J.-L. G4Hunter Web Application: A Web Server for G-Quadruplex Prediction. Bioinformatics 2019, 35, 3493–3495. [Google Scholar] [CrossRef] [Green Version]
- Bedrat, A.; Lacroix, L.; Mergny, J.-L. Re-Evaluation of G-Quadruplex Propensity with G4Hunter. Nucleic Acids Res. 2016, 44, 1746–1759. [Google Scholar] [CrossRef]
- Neumann, P.; Navrátilová, A.; Schroeder-Reiter, E.; Koblížková, A.; Steinbauerová, V.; Chocholová, E.; Novák, P.; Wanner, G.; Macas, J. Stretching the Rules: Monocentric Chromosomes with Multiple Centromere Domains. PLoS Genet. 2012, 8, e1002777. [Google Scholar] [CrossRef] [Green Version]
- Novák, P.; Neumann, P.; Macas, J. Global Analysis of Repetitive DNA from Unassembled Sequence Reads Using RepeatExplorer2. Nat. Protoc. 2020, 15, 3745–3776. [Google Scholar] [CrossRef]
- The DDBJ/ENA/GenBank Feature Table Definition | INSDC. Available online: https://www.insdc.org/documents/feature-table#2 (accessed on 21 March 2022).
- Komsta, L. Processing Data for Outliers. R News 2006, 6, 10–13. [Google Scholar]
G4Hunter Threshold | Number of PQSs | PQS Frequency (PQS/kbp) |
---|---|---|
Genomic DNA | ||
1.2–1.4 | 960,462 | 0.30 |
1.4–1.6 | 260,428 | 0.081 |
1.6–1.8 | 76,552 | 0.024 |
1.8–2.0 | 28,513 | 0.0088 |
2.0–more | 28,801 | 0.0089 |
mtDNA | ||
1.2–1.4 | 377 | 1.04 |
1.4–1.6 | 117 | 0.32 |
1.6–1.8 | 47 | 0.13 |
1.8–2.0 | 16 | 0.044 |
2.0–more | 16 | 0.044 |
cpDNA | ||
1.2–1.4 | 40 | 0.33 |
1.4–1.6 | 15 | 0.12 |
1.6–1.8 | 8 | 0.066 |
1.8–2.0 | 1 | 0.0082 |
2.0–more | 1 | 0.0082 |
DNA Sequence | Length (Mb) | Number of PQS | PQS Frequency (/kbp) | GC Content (%) | PQSs (%) | PQSs/GC% |
---|---|---|---|---|---|---|
Chr I | 372.17 | 160,922 | 0.432 | 31.07 | 1.31 | 1.392 |
Chr II | 427.60 | 175,744 | 0.411 | 29.68 | 1.24 | 1.385 |
Chr III | 437.56 | 181,878 | 0.416 | 29.72 | 1.26 | 1.399 |
Chr IV | 446.35 | 184,737 | 0.414 | 29.90 | 1.25 | 1.384 |
Chr V | 579.27 | 244,737 | 0.422 | 30.13 | 1.28 | 1.402 |
Chr VI | 480.42 | 200,963 | 0.418 | 29.81 | 1.27 | 1.403 |
Chr VII | 491.38 | 205,775 | 0.419 | 29.87 | 1.27 | 1.402 |
Total nuclear | 3234.74 | 1,354,756 | 0.419 | 30.02 | 1.27 | 1.395 |
mtDNA | 0.36 | 573 | 1.575 | 45.07 | 4.81 | 3.494 |
cpDNA | 0.12 | 65 | 0.533 | 34.78 | 1.65 | 1.531 |
Name | Sequence | G4H | IDS | CD | FRET-MC | Concl. |
---|---|---|---|---|---|---|
Mitochondrial sequences: | ||||||
40ps1 | TGGGCGTCTGGGGTTGGTTTAAGGAAAAATCGGGGTCGGA | 1.25 | + | + | + | G4 |
28ps2 | AGGGATCAAGAAACGGATAGGGAGGGGA | 1.32 | ? | + | - | G4? |
37ps3 | AGGGAGGACCGGGGGCCAGAGCAAGTTGGGTTGGGGT | 1.41 | + | + | + | G4 |
44ps4 | TGGGGCGAGGGTCTTTCATTAAAGGGGGGAAAAGAGGGGTGGGT | 1.66 | + | + | + | G4 |
28ps5 | CGGGGGCGGGTTCTGAGCAGGATGGGGA | 1.68 | + | + | + | G4 |
31ps6 | AGGAAGCGGGGGGAGGAACACAGGGGAAGGA | 1.61 | + | + | + | G4 |
Chloroplast sequences: | ||||||
28ps16 | TGGAAGGGGTCAATAAGGGGTTGGGGGA | 1.96 | + | + | + | G4 |
32ps17 | CGGGGGGTAGATTGGGGCGTGGACATAAGGGT | 1.62 | + | + | + | G4 |
25ps18 | TGGGATCCGGGCGGTCCAGGGGGGA | 1.48 | + | ? | + | G4 |
24ps23 | AGGGGTGGGGACAGAGGTTTTGGT | 1.67 | + | + | + | G4 |
21ps26 | TGGGGGTGGTGAAGGGAGGGC | 2.00 | + | + | + | G4 |
24ps27 | CGGGGTGGAGACGATGGGGTCGGT | 1.62 | + | ? | + | G4 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dobrovolná, M.; Bohálová, N.; Peška, V.; Wang, J.; Luo, Y.; Bartas, M.; Volná, A.; Mergny, J.-L.; Brázda, V. The Newly Sequenced Genome of Pisum sativum Is Replete with Potential G-Quadruplex-Forming Sequences—Implications for Evolution and Biological Regulation. Int. J. Mol. Sci. 2022, 23, 8482. https://doi.org/10.3390/ijms23158482
Dobrovolná M, Bohálová N, Peška V, Wang J, Luo Y, Bartas M, Volná A, Mergny J-L, Brázda V. The Newly Sequenced Genome of Pisum sativum Is Replete with Potential G-Quadruplex-Forming Sequences—Implications for Evolution and Biological Regulation. International Journal of Molecular Sciences. 2022; 23(15):8482. https://doi.org/10.3390/ijms23158482
Chicago/Turabian StyleDobrovolná, Michaela, Natália Bohálová, Vratislav Peška, Jiawei Wang, Yu Luo, Martin Bartas, Adriana Volná, Jean-Louis Mergny, and Václav Brázda. 2022. "The Newly Sequenced Genome of Pisum sativum Is Replete with Potential G-Quadruplex-Forming Sequences—Implications for Evolution and Biological Regulation" International Journal of Molecular Sciences 23, no. 15: 8482. https://doi.org/10.3390/ijms23158482
APA StyleDobrovolná, M., Bohálová, N., Peška, V., Wang, J., Luo, Y., Bartas, M., Volná, A., Mergny, J.-L., & Brázda, V. (2022). The Newly Sequenced Genome of Pisum sativum Is Replete with Potential G-Quadruplex-Forming Sequences—Implications for Evolution and Biological Regulation. International Journal of Molecular Sciences, 23(15), 8482. https://doi.org/10.3390/ijms23158482