Next Article in Journal
Camellia sinensis Chloroplast Fluoride Efflux Gene CsABCB9 Is Involved in the Fluoride Tolerance Mechanism
Next Article in Special Issue
Characterization and Functional Implications of the Nonexpressor of Pathogenesis-Related Genes 1 (NPR1) in Saccharum
Previous Article in Journal
The β2-Subunit (AMOG) of Human Na+, K+-ATPase Is a Homophilic Adhesion Molecule
Previous Article in Special Issue
Expression of Pinellia pedatisecta Agglutinin PPA Gene in Transgenic Sugarcane Led to Stomata Patterning Change and Resistance to Sugarcane Woolly Aphid, Ceratovacuna lanigera Zehntner
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 23
Issue 14
10.3390/ijms23147755
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

MdMKK9-Mediated the Regulation of Anthocyanin Synthesis in Red-Fleshed Apple in Response to Different Nitrogen Signals

by
Xiaohong Sun
1,2,†,
Xinxin Li
3,†,
Yanbo Wang
3,
Jihua Xu
1,2,
Shenghui Jiang
2,3,* and
Yugang Zhang
2,3,*
1
Key Laboratory of Plant Biotechnology of Shandong Province, College of Life Sciences, Qingdao Agricultural University, Qingdao 266109, China
2
Engineering Laboratory of Genetic Improvement of Horticultural Crops of Shandong Province, Qingdao Agricultural University, Qingdao 266109, China
3
College of Horticulture, Qingdao Agricultural University, Qingdao 266109, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Int. J. Mol. Sci. 2022, 23(14), 7755; https://doi.org/10.3390/ijms23147755
Submission received: 30 May 2022 / Revised: 11 July 2022 / Accepted: 12 July 2022 / Published: 14 July 2022
(This article belongs to the Special Issue Crop Stress Biology and Molecular Breeding)
Browse Figures
Versions Notes

Abstract

:
The mitogen-activated protein kinase (MAPK) signaling cascade is a widely existing signal transduction system in eukaryotes, and plays an important role in the signal transduction processes of plant cells in response to environmental stress. In this study, we screened MdMKK9, a gene in the MAPK family. This gene is directly related to changes in anthocyanin synthesis in the ‘Daihong’ variety of red-fleshed apple (Malus sieversii f neidzwetzkyana (Dieck) Langenf). MdMKK9 expression was up-regulated in ‘Daihong’ tissue culture seedlings cultured at low levels of nitrogen. This change in gene expression up-regulated the expression of genes related to anthocyanin synthesis and nitrogen transport, thus promoting anthocyanin synthesis and causing the tissue culture seedlings to appear red in color. To elucidate the function of MdMKK9, we used the CRISPR/Cas9 system to construct a gene editing vector for MdMKK9 and successfully introduced it into the calli of the ‘Orin’ apple. The MdMKK9 deletion mutants (MUT) calli could not respond to the low level of nitrogen signal, the expression level of anthocyanin synthesis-related genes was down-regulated, and the anthocyanin content was lower than that of the wild type (WT). In contrast, the MdMKK9-overexpressed calli up-regulated the expression level of anthocyanin synthesis-related genes and increased anthocyanin content, and appeared red in conditions of low level of nitrogen or nitrogen deficiency. These results show that MdMKK9 plays a role in the adaptation of red-fleshed apple to low levels of nitrogen by regulating the nitrogen status and anthocyanin accumulation.

1. Introduction

Red-fleshed apple (Malus sieversii f neidzwetzkyana (Dieck) Langenf) is rich in anthocyanins and other flavonoids that have anti-oxidation and anti-radiation effects and help prevent cardiovascular and cerebrovascular diseases and arteriosclerosis [1,2]. At present, red-fleshed apple is cultivated in various countries, including New Zealand [3] and Can-ada [4]. In 2017, a new red-fleshed apple variety ‘Daihong’ (variety right number: CNA20162427.9) with the R1R6 genotype was bred at Qingdao Agricultural University. ‘Daihong’ fruits are sour and crispy, and can be used as fresh food and to produce processed juices [5]. In addition, this variety contains higher levels of anthocyanin than white-fleshed apples.
Anthocyanins are a major health-promoting component of red-fleshed apples. To date, studies on the biosynthesis of anthocyanins have mainly focused on their structure genes, including chalcone synthase (CHS), chalcone isomerase (CHI), flavanone 3-hydroxylase (F3H), dihydroflavonol 4-reductase (DFR), anthocyanidin synthase (ANS), uridine diphosphate-glucose: flavonoid-O-glycosyltransferase (UFGT) and anthocyanidin reductase (ANR), and regulatory genes, including myeloblastosis (MYB), helix-loop-helix (bHLH) and WD40-repeat (WD40) [3,6,7,8,9,10,11]. Anthocyanin biosynthesis is regulated by a variety of internal and external factors, including cultivation conditions, plant hormone levels, non-hormone chemicals, and genetic regulation [12,13]. The main external environmental conditions that are important for anthocyanin biosynthesis are light, temperature, and nitrogen levels [14,15]. The nitrate uptake by the root from the soil and movement of nitrate inside the plant is mediated by the membrane-bound nitrate transporters. In plants, three multigenic families (NPF, NRT2 and AMT) are involved in N uptake and utilization [16,17]. 17 NPF6 genes were identified in apples [18], these apple MdNPFs are structurally conserved, based on alignment of amino acid sequences and analyses of phylogenetics and conserved domains [19]. Wang et al. reported that overexpressing MdNPF6.5 in apple calli improved the tolerance to low nitrogen stress and the nitrogen absorption capacity [19]. Huang et al. reported that two NRT family gene MdNRT2.4 and MdNRT2.7 were involved in the response to PEG induced drought stress in apple [20]. Expression analysis of red-fleshed apples revealed that nitrate starvation induced the expression of MdNRT2.4 [21]. Overexpressing the high-affinity transporter MdNRT2.4 enhanced low N stress tolerance in Arabidopsis [22]. When the MdTyDc was overexpressed in apple leaves, the transcript levels of N-absorption-related genes (i.e., MdAMT1.5, MdAMT3.1) were higher than in WT lines under alkaline stress [23]. The expression of MdAMT3.1 in apple roots increased significantly with the decrease of N supply level [20]. Nitrogen deficiency has been found to significantly promote anthocyanin accumulation in Arabidopsis, grape, and radish [6,24,25]. High nitrogen concentrations induce transcription factors such as LBD37, LBD38, and LBD39—members of the lateral organ boundary domain (LBD) protein family in Arabidopsis—that negatively regulate anthocyanin synthesis by inhibiting the expression of genes related to anthocyanin synthesis [6]. In Arabidopsis thaliana, the DELLA protein (whose N-terminal has a conserved amino acid sequence, D-E-L-L-A) can directly interact with PAP1 to regulate nitrogen stress-induced anthocyanin accumulation [26]. The BTB/TAZ protein (encoded by the nitrate response gene MdBT2) interacts with MdMYB1 to regulate anthocyanin accumulation in apple [8]. Moreover, the overexpression of MdATG18a can improve anthocyanin accumulation in transgenic apple lines and enhance their tolerance to low nitrogen stress [27].
The mitogen-activated protein kinase (MAPK) signaling cascade is a signal transduction system that is widely distributed in eukaryotes and plays an important role in the signal transduction processes of plant cells responding to environmental stress [28,29,30]. MAPK cascades are key signaling modules downstream of receptors or sensors that perceive endogenous and exogenous stimuli, such as hormones, peptide ligands, and effectors [31]. For example, MdMKKK1 regulates resistance to Botryosphaeria dothidea infection in apples [32], and MKK9 negatively regulates abiotic stress response and enhances abscisic acid levels and salt tolerance in Arabidopsis [33]. In Arabidopsis, MKK9 is an important member of group D MKKs (a MAPK signaling cascade pathway) and regulates anthocyanin synthesis in response to low nitrogen levels and phosphorus stress [34,35]. The MKK9–MPK6 cascade plays a role in the salt stress response of A. thaliana by regulating the phosphorylation of RCA, FTSZ2-2, TOR2, and PRPS1 [36]. MKK9 is a positive factor for H2O2 accumulation in salt-treated calli of A. thaliana, and plays a key role in enhancing respiration by forming the cascade with MAPK3/6 [37]. MPK6 is a direct target of MKK9, and its knockout delays leaf senescence [38]. MKK9 also regulates the adaptation of Arabidopsis plants to low nitrogen stress by regulating their anthocyanin levels and nitrogen status [39]. Although the genome-wide analysis of the MAPK family has been carried out in some species, little is known about MAPKK genes in apple [29]. Moreover, it is not clear how MKK9 regulates anthocyanin synthesis in apple under nitrogen stress.
The excessive use of nitrogen in apple orchards reduces fruit coloring and quality, which affects their commercial value and edibility [40,41]. In this study, we investigated how MdMKK9 regulates anthocyanin accumulation in apple in response to low nitrogen stress. Our results provide a basis for the rational application of nitrogen fertilizers in the production and cultivation of new red-fleshed apple varieties.

2. Results

2.1. MdMKK9 Is Directly Related to Changes in the Anthocyanin Content of Red-Fleshed Apples

‘Daihong’ fruits were collected for observation at 69 d (S1), 88 d (S2), and 116 d (S3) after full bloom (Figure 1A). Corresponding samples were collected from ‘Gala’ (white-fleshed apple) plants as a control. ‘Daihong’ S1 (young fruits at an early growth stage) had red skin, pink flesh, and high levels of anthocyanin. With increasing fruit volume at stages S2 and S3, the color of the skin and flesh became lighter and the anthocyanin levels decreased. However, anthocyanin levels were higher in ‘Daihong’ than in ‘Gala’ at all stages of growth (Figure 1B).
The MAPK family of genes plays an important role in the growth, development, and stress resistance of A. thaliana. We obtained the MdMKK2–MdMKK9 sequences from NCBI and designed primers to measure the expression levels of these genes in the leaves, stems, skin, and flesh of ‘Daihong’ and ‘Gala’ fruits at different developmental stages (Figure 2). The expression levels of MdMKK2 were higher in the leaves, stems, skin, and flesh of ‘Gala’ than in those of ‘Daihong’ in the S1 and S2 stages (Figure 2A,B). MdMKK2 expression was highest in the stems of ‘Daihong’ in the S3 stage (Figure 2C). The expression levels of MdMKK3 were higher in leaves and stems of ‘Daihong’ than in those of ‘Gala’ in all stages, and higher in the flesh of ‘Daihong’ than in that of ‘Gala’ only in S3. MdMKK4 expression was higher in the skin and flesh of ‘Daihong’ than in those of ‘Gala’ in S3. MdMKK5 expression was higher in the leaves and stems of ‘Daihong’ than in those of ‘Gala’ in S3; however, its expression level in the fruit flesh was always lower in ‘Daihong’ than in ‘Gala’. The expression level of MdMKK6 was higher in the leaves and stems of ‘Daihong’ than in those of ‘Gala’; however, its expression level in the fruit flesh was lower in ‘Daihong’ than in ‘Gala’ in the S2 stage. The expression levels of MdMKK9 in the leaves and stems of ‘Daihong’ increased gradually relative to those in the leaves and stems of ‘Gala’ from S1 to S3. MdMKK9 expression was higher in the skin and flesh of ‘Daihong’ than in those of ‘Gala’, and decreased gradually from S1 to S3. The above results suggested that only the expression levels of MdMKK9 gene in both skin and flesh of red-fleshed apple were significantly higher than that in white-fleshed apples at the three developmental stages. We speculated that the expression level of MdMKK9 was closely related to changes in the anthocyanin contents of the fruits, and MdMKK9 was thus selected for further study in subsequent experiments.

2.2. The Increase in Anthocyanin Content Is Mediated by the Up-Regulation of MdMKK9 in ‘Daihong’ under Low Nitrogen Stress

In tissue culture seedlings grown on nitrogen-deficient mediums (0 and 4 mM NO3−), the leaves and stems gradually turned red with increasing culture duration; the lower the nitrogen concentration, the darker the red color (Figure 3A). The relative expression of MdMKK9 was measured by qRT-PCR at various time points across 24 h of culture. With increasing culture duration, the relative expression levels of MdMKK9 increased significantly in tissue culture seedlings grown on mediums with 4 mM and 0 mM NO3−. The lower the nitrogen concentration, the higher the expression of MdMKK9 (Figure 3B). The ‘Daihong’ tissue culture seedlings were further grown in the different mediums for 25 days, and the nitrogen content of the tissues were measured again. The nitrogen content of plant tissues decreased with decreasing nitrogen concentration of the medium (Figure 3C). There was no significant difference in the nitrogen content of tissue culture seedlings grown on culture mediums with 4 mM and 0 mM NO3−. However, there was a significant difference in nitrogen content between tissue culture seedlings grown with 40 mM NO3− and those grown with 4 mM and 0 mM NO3− (Figure 3C). The anthocyanin content of ‘Daihong’ tissue culture seedlings increased with decreasing nitrogen concentration of the medium (Figure 3D). There was no significant difference in anthocyanin content between tissue culture seedlings grown at nitrogen concentrations of 4 mM and 0 mM NO3−, both of which had significantly higher anthocyanin levels than the tissue culture seedlings grown at 40 mM NO3− (Figure 3D). Therefore, we speculated that MdMKK9 was involved in increasing the anthocyanin content of ‘Daihong’ tissue culture seedlings under low nitrogen stress. Moreover, the application of a small amount of nitrogen to the growth medium (40 mM/4 mM = 10X) did not decrease nitrogen uptake by plants to the same extent (5.3/2.3 = 2.3X).
In this case, qRT-PCR was used to detect the relative expression level of structural genes related to anthocyanin synthesis—including MdPAL, MdCHS, MdCHI, MdF3H, MdDFR, MdANS, MdANR and MdUFGT—in tissue culture seedlings grown in mediums with 4 and 0 mM NO3− for 24 h. The time taken to reach the maximum expression level differed between genes and culture mediums (Figure 4). The expression levels of all genes were highest at 6 h in the 4 mM NO3− medium (Figure 4A), whereas the expression levels of MdCHI, MdANR and MdUFGT were highest at 24 h. In the 0 mM NO3− medium, the expression levels of MdCHS, MdF3H and MdDFR were highest at 6 h in the 0 mM NO3− medium. The expression levels of regulatory genes (MYB10, MdbHLH3, MdbHLH33, and MdWD40) were higher in the 0 mM NO3− medium than in the 4 mM NO3− medium. The expression levels of MdMYB10 and MdbHLH3 were highest at 6 h in both mediums, whereas those of MdbHLH33 and MdWD40 were highest at 24 h (Figure 4B).
Most studies on nitrogen uptake and transport in plants focus on A. thaliana, a model plant. For our experiments, we selected the following apple genes: MdNFP6.8–6.9, MdNRT2.4–2.7 and MdAMT1.5–3.1. MdNFP6.8–6.9 and AtNRT1.1 have high amino acid sequence homology (57.1−45.3%); MdNRT2.4–2.7 had high homology with AtNRT2.1 family in amino acid sequence (71.3−75.6%); and MdAMT1.5–3.1 from the ammonium transporter gene family of apple (The homology of amino acid sequence between MdAMT1.5–3.1 and other plant AMTs were shown in Supplementary Figure S1). We obtained the relative expression of nitrogen transport-related genes in tissue cultured seedlings of ‘Daihong’ cultured in mediums with 4 and 0 mM NO3− (Figure 5). The expression level of MdNFP6.8 (Figure 5A) was highest at 12 h in the 0 mM NO3− medium, whereas those of MdNFP6.9 (Figure 5B) had changed little in the 4 and 0 mM NO3− medium. The expression level of MdNRT2.4 (Figure 5C) at 6 h was highest in the 4 mM NO3− medium, and then gradually decreased, the expression level of MdNRT2.4 increased gradually in the 0 mM NO3− medium and reached the highest level in 24 h. The expression levels of MdNRT2.7 (Figure 5D) were higher in the 0 mM NO3− medium than in the 4 mM NO3− medium, whereas MdAMT1.5 and MdAMT3.1 (Figure 5E,F) showed the opposite trend. Among these above genes, only the expression level of MdNRT2.7 in 0 mM NO3− medium was always higher than that in 4 mM NO3− medium, and increased with the extension of treatment time.

2.3. Calli with MdMKK9 Deletion No Longer Respond to the Low Nitrogen Signal

2.3.1. Construction of a CRISPR/Cas9 MdMKK9 Gene Editing Vector and Obtaining MdMKK9 Deletion Mutant Calli

To examine whether MdMKK9 could increase the anthocyanin content of apple in response to a low nitrogen signal, we cloned the coding sequence region of MdMKK9 (GenBank accession number: ON427820) from the ‘Daihong’ variety of red-fleshed apple, constructed an overexpression vector, and successfully introduced it into the calli of the ‘Orin’ variety. We obtained six MdMKK9 overexpressed calli lines (OE) in which the relative expression levels of MdMKK9 were significantly higher than those in wild-type calli (WT) (Supplementary Figure S2).
To elucidate the function of the MdMKK9 gene, we performed gene editing in apple calli based on the CRISPR/Cas9 system to produce mutagenesis in the MdMKK9 gene. We selected target sequences from the exons of the MdMKK9 gene using the online CCTOP tool and constructed a gene editing vector (Figure 6A). The new construct was introduced into ‘Orin’ calli using Agrobacterium-mediated transformation methods obtaining MdMKK9 deletion mutant calli (MUT). Kanamycin-resistant calli were subcultured twice, and calli that tested positive for transformation were subjected to molecular examination. We sequenced four positive calli lines and found two different sequence mutations at the target site in all sequenced calli. The mutations included a 4-bp deletion at MdMKK9-MUT-site1 and a 1-bp deletion at MdMKK9-MUT-site2 (Figure 6B,C).

2.3.2. Increase in the Anthocyanin Content of Calli in Transgenic ‘Orin’ under Low Nitrogen Stress Is Mediated by the Up-Regulation of MdMKK9

The calli of WT, OE, and MUT lines were cultured on mediums with 40, 4, 0.4, and 0 mM NO3− for 5 d at 16 °C under dark conditions. The OE calli began to appear slightly red at 4 mM NO3−, and the red phenotype gradually deepened with decreasing nitrogen concentration of the medium. The WT calli started to appear red at 0.4 mM NO3−, and the MUT lines exhibited a red phenotype at 0 mM NO3−. The anthocyanin contents of WT and OE calli increased with decreasing nitrogen concentration the medium, and there were significant differences within and across culture conditions. The anthocyanin contents of MUT calli did not differ significantly between culture conditions with different nitrogen concentration (Figure 7B). The relative expression levels of the MdMKK9 gene are shown in Figure 7C. In all four nitrogen concentrations, the expression levels of MdMKK9 were significantly higher in OE calli than in WT calli and MUT calli. However, there were no significant differences between WT calli and MUT calli.
In this case, qRT-PCR was used to determine the relative expression levels of anthocyanin synthesis-related structural genes (MdPAL, MdCHS, MdCHI, MdF3H, MdDFR, MdANS, MdANR and MdUFGT) (Figure 8A) and regulatory genes (MdMYB10, MdbHLH3 and MdWD40) (Figure 8B) in the calli of different lines. In growth mediums with 40, 4, 0.4 and 0 mM NO3−, there were progressively increased in the expression levels of all anthocyanin synthesis-related genes in WT and OE calli. The expression levels of those genes in MUT calli showed little difference across growth mediums with different nitrogen concentrations. In the culture medium with 0.4 mM NO3−, the expression level of each gene increased significantly in the OE and WT lines and remained high even with decreasing nitrogen concentrations of the medium. In culture mediums with 0.4 mM and 0 mM NO3−, the gene expression levels of OE lines were slightly higher than those of WT lines and significantly higher than those of MUT lines.
Overall, the expression levels of nitrogen transport-related genes in WT, OE and MUT calli decreased with decreasing nitrogen concentration of the medium (Figure 9). The relative expression levels of MdNFP6.9, MdNRT2.4, and MdAMT3.1 in OE calli cultured at 40 mM NO3− were higher than those of MUT and WT calli. The relative expression levels of MdNFP6.8 and MdAMT1.5 in OE calli were not significantly different from those in MUT and WT, and there were no differences in color between these calli at this time. The expression of nitrogen transport-related genes in different calli in the 0 mM NO3− treatment did not change significantly, however, the relative expression levels of MdNPF6.9, MdNTR2.7 and MdAMT3.1 in OE calli were higher than those in MUT and WT calli. The expression levels of genes in the 0.4 mM and 0 mM NO3− treatments were slightly lower compared to those in the 40 mM and 4 mM NO3− treatments, respectively; however, this decrease was smaller than the corresponding decrease in the nitrogen concentration of the medium. Among all these above genes, after treated with different nitrogen concentrations, only the expression level of MdNTR2.7 in OE calli was higher than that of WT and MUT calli.

3. Discussion

MAPK/MPK is a type of serine (Ser)/threonine (Thr) protein kinase that is ubiquitous in eukaryotes, including yeast, animals, and plants [42,43]. The MAPK-mediated signaling cascade is one of the most important pathways in the signal transmission network of eukaryotes. It is involved in intracellular signaling and extracellular signal amplification, induces appropriate physiological and biochemical responses in recipient cells, and plays an important role in the regulation of plant immunity [44]. MAPKKs are involved in various aspects of physiological and developmental processes in apple [29]. In this study, we identified MdMKK9, a member of the MAPK gene family that is closely associated with the anthocyanin content of the ‘Daihong’ variety of red-fleshed apples.
‘Daihong’ is a newly bred red-fleshed apple variety that can be used as fresh food or for processing [5]. As such, it has not been studied in detail. The anthocyanin content of the skin and flesh of ‘Daihong’ fruits decreased with fruit development, and the expression levels of the MdMKK9 gene also decreased significantly. This indicated that MdMKK9 is a member of the MAPK gene family and is directly associated with changes in the anthocyanin content of red-fleshed apples. MdMKK9 and AtMKK9 are members of the same subfamily, and share a close genetic relationship [45] (Supplementary Figure S3). The 3D structures of Arabidopsis AtMKK9 and apple MdMKK9 were very similar and share a high degree of overlap (Supplementary Figure S4). Therefore, the function of MdMKK9 can be inferred based on the predicted functional network diagram of AtMKK9-interacting proteins.
Low nitrogen stress has been reported to induce anthocyanin accumulation in apple [9], radish [11], and grape [6]. In this study, we found that after 25 days of growth in a low-nitrogen medium, the tissue culture seedlings of ‘Daihong’ gradually turned red in color. Moreover, their anthocyanin content gradually increased with decreasing nitrogen content of the medium. Structural genes in the anthocyanin synthesis pathway (such as MdCHS, MdCHI, MdDFR, MdANS, and MdUFGT) were up-regulated in ‘Daihong’ seedlings after 24 h of treatment in low nitrogen and nitrogen-deficient conditions. Among them, MdDFR and MdUFGT are important enzymes for the increase of anthocyanin content [46]. NRT2 is a high-affinity nitrate transporter [19], and in A. thaliana, AtNRT2.7 is known to play a specific role in seed nitrate accumulation. AtNRT2.7 is induced by nitrate and hormones, enhances the growth of the root system, and improves the absorption and utilization of nitrogen [47]. In apples, the expression of MdNRT1.5/MdNPF7.3 inhibits the transport of nitrate from root to branch [48]. Nitrate has been reported to mediate phosphorus absorption and starvation signals by activating the NIGT1-SPX-PHR cascade signaling pathway [49]. MdNPF6.5 confers a high capacity for nitrogen uptake under low-nitrogen conditions [19]. AtNRT2.4 is a nitrate transporter, which can promote root uptake of nitrogen under N starvation [18]. In this study, we found that genes related to nitrogen and ammonium root transport (such as MdNPF6.9, MdNRT2.4, and MdNRT2.7) were up-regulated after 24 h of nitrogen treatment. Only MdNRT2.7 expression levels were higher in conditions of nitrogen deficiency (0 mM NO3−) than under low nitrogen stress (4 mM NO3−). Moreover, the expression levels of MdAMT1.5 and MdAMT3.1 were higher under low nitrogen stress (4 mM NO3−) than in conditions of nitrogen deficiency (0 mM NO3−). When MdMKK9 was normally expressed, the decrease in nitrogen content and increase in anthocyanin content in two culture conditions (4 and 0 mM NO3−) were significantly different from those in the 40 mM NO3− culture condition. Interestingly, there were no significant differences in the nitrogen or anthocyanin contents of tissue culture seedlings between the 4 and 0 mM NO3− growth mediums, this was suggested that plants did not significantly reduced nitrogen uptake due to low nitrogen culture.
Since it is difficult and time-consuming to obtain transgenic apple plants, we used the calli of the ‘Orin’ variety of apple plants for the functional analysis of MdMKK9. The calli of ‘Orin’ have some favorable traits, such as an unlimited proliferation potential, non-differentiation during subculturing, and ease of transformation by Agrobacterium-mediated methods. As such, it has been successfully used to study gene functions in apple [50,51,52]. The CRISPR/Cas9 system is a revolutionary genome editing technique that has been widely used in numerous plants, including Arabidopsis [53], citrus [54], tomato [55,56], and apple [32,52,57]. To investigate the function of the MdMKK9, we established gene deletion systems. Through genetic transformation and antibiotic screening, we obtained four positive clones. The sequencing results showed that the MdMKK9 gene in the mutant ‘Orin’ calli had two mutations—a 4-bp deletion and a 1-bp deletion—at the target site that would destroy the translation of the MdMKK9 protein. Therefore, the mutant calli were used to investigate the function of the MdMKK9 gene. Low nitrogen is known to stimulate anthocyanin production in the skin cells of red varieties of grapes [6]; however, the color and anthocyanin content of the MdMKK9 deletion mutant calli did not change significantly under low nitrogen stress. Thus, we speculated that the mutation of MdMKK9 inhibited the low nitrogen-induced synthesis of anthocyanin. The accumulation patterns of certain pigments give fruits different colors, and red cultivars are generally characterized by higher levels of anthocyanins [58]. When transgenic calli with MdMKK9 overexpression were subjected to different levels of nitrogen treatment, the calli gradually turned red, and the anthocyanin content of the red calli increased with decreasing nitrogen levels.

4. Materials and Methods

4.1. Plant Materials

The plant materials used in this study included the leaves, stems, skin, and flesh of the ‘Daihong’ and ‘Gala’ cultivars of apple, tissue culture seedlings of ‘Daihong’, the calli of the ‘Orin’ cultivar, and Nicotiana benthamiana leaves. ‘Daihong’ and ‘Gala’ plants at the Jiaozhou Modern Agriculture Demonstration Park of Qingdao Agricultural University were sampled at different growth stages. The calli of ‘Orin’ used in the present study were kindly provided by Prof. Songling Bai from the College of Agriculture and Biotechnology, Zhejiang University, Hangzhou, China.

4.2. Nitrogen Treatments of Tissue Culture Seedlings

The ‘Daihong’ tissue culture seedlings were cultured on MS medium for 15–20 days after subculture, and then transferred to MS medium containing different concentrations of nitrogen for 0, 6, 12, and 24 h. The plants were frozen in liquid nitrogen and stored at −80 °C until further use.
The nitrogen-deficient culture mediums were prepared as follows: NH4NO3 and KNO3 were removed from MS medium; 0, 4, and 40 mM NO3− were added; 40, 3.6, and 0 mM KCl were added, respectively, to supplement the difference in K+ concentration; culture mediums with 0, 4, and 40 mM nitrogen concentration were configured. The tissue culture seedlings of ‘Daihong’ were grown in mediums with three nitrogen concentrations for 25 days, and their phenotypic changes were observed. Some of the plants were frozen in liquid nitrogen and stored at −80 °C for the determination of total anthocyanin content, and the remaining were used to determine the nitrogen content.

4.3. Extraction and Determination of Total Anthocyanin

The plant material was powdered in liquid nitrogen and 1.0 g of sample powder was added to 10 mL of methanol extraction solution containing 1% HCl. This mixture was used for ultrasonic extraction (frequency, 40 kHz; power, 120 W) at 20 °C for 20 min (KQ-300DE; Kunshan Ultrasonic Instruments Co., Ltd. Kunshan, Jiangsu, China) and then placed at 4 °C for overnight extraction in dark conditions. The extracted solutions were obtained the following day by centrifugation at 10,000× g for 10 min at 4 °C (Centrifuge 5804R; Eppendorf, Hamburg, Germany). A 10 mL aliquot of extracting solution was added to the residue and the process was repeated. The two extracted solutions were combined into the test sample, and the anthocyanin contents of various test samples were determined using the pH difference method [59,60].

4.4. Nitrogen Measurement

The tissue culture seedlings of ‘Daihong’ were heated at 105 °C for 20–30 min and baked at 70–80 °C for 2–3 days until constant weight. Total nitrogen was determined by micro-Kjeldahl digestion (KDN-102C; Shanghai Xianjian Instruments Co., Ltd., Shanghai, China) following standard methods (China Food and Drug Administration 2016a).

4.5. RNA Extraction and Gene Expression Analysis

Gene expression was analyzed by CFX96 Touch Real-Time PCR Detection System (Bio-rad, CFX96 touch). Total RNA was extracted from the leaves, stems, skin, flesh, calli, and tissue culture seedlings of apples using the TIANGEN Plant RNA Extraction Kit (TIANGEN, Beijing, China) according to the manufacturer’s instructions. cDNA was synthesized using the PrimeScriptTM II 1st Strand cDNA Synthesis Kit (TaKaRa, Kusatsu, Japan) according to the manufacturer’s instructions. The cDNA was serially diluted 10 times and stored at −20 °C. qRT-PCR was performed using the ChamQ SYBR Color qPCR Master Mix Kit (Vazyme, Nanjing, China) using 1 μL of the template cDNA and 0.5 μL of each gene-specific primer (Supplementary Table S1). The NCBI Primer-BLAST tool was used to design the primers. The MdActin gene (XM_029088423.1) was used as an internal reference. The relative expression levels of the target genes were determined using the 2−ΔΔCT method, as described by Livak and Schmittgen [61]. The specificity of each gene was determined using a dissociation curve analysis. All experiments were repeated with three biological replicates and three technical replicates. The gene-specific primer sequences are shown in Supplemental Table S1.

4.6. Construction of the CRISPR/Cas9 MdMKK9 Gene Editing Vector and Overexpression Vector

Based on the restriction enzyme sites of the pRI101 vector map, the primers pRI-MdMKK9-F and pRI-MdMKK9-R (Supplementary Table S1) were designed to amplify the open reading frame region of MdMKK9 using ‘Daihong’ cDNA as the template. The MdMKK9 overexpression vector was constructed by connecting MdMKK9 to the pRI101-AN vector using the SalI and BamHI double restriction sites. The MdMKK9 overexpression vector was introduced into Agrobacterium tumefaciens strain EHA105 and stored at −80 °C.
To examine how the MdMKK9 gene increases the anthocyanin content of apples under nitrogen stress, we generated a gene mutation of MdMKK9 through gene editing based on the CRISPR/Cas9 system. The target sequence (TGACGGCGGTGGGAGGGAGGGGG) was selected through the online CRISPR/Cas9 target online predictor (CCTOP) tool [62] using citrus (GCF-00317415.1) as the reference species, and its specificity was verified using the apple database. MdMKK9 was homologously recombined into the pHDE-35s-Cas9-mCherry-UBQ vector through the SpeI restriction site [63]. The MdU6 promoter (accession no. MT584802) was amplified from apple DNA using the primers MdU6-F and MdU6-R (Supplementary Table S1) and was used to promote gRNA expression. The HygR gene was replaced with the KanR gene to allow convenient selection using kanamycin. The gene editing vector was introduced into A. tumefaciens EHA105 and stored at −80 °C for future use.

4.7. Agrobacterium-Mediated Transformation of the Calli of ‘Orin’ Apples

The calli of ‘Orin’ apples were used for Agrobacterium-mediated genetic transformation [52,64,65]. The calli were subcultured three times at two-week intervals on a subculture medium (MS + 0.4 mg L−1 6-BA + 0.5 mg L−1 2, 4-dichlorophenoxyacetic acid (2, 4-d) pH 5.8) before being used for gene transformation. A 50 μL solution of A. tumefaciens EHA105 was added to 50–60 mL of a liquid medium (100 mg L−1 Kanamycin + 50 mg L−1 Rifampin) and shaken at 28 °C until the bacterial solution concentration was at OD600 = 0.4–0.5. The fresh calli were soaked in an Agrobacterium suspension in a suspension buffer (MS + 200 mM Acetosyringone) for 16 min, and then transferred to a selection medium (MS + 0.4 mg L−1 6-BA +0.5 mg L−1 2,4-D + 200 mg L−1 Timentin + 100 mg L−1 Kanamycin) for transgenic selection. To examine gene mutations and/or overexpression, DNA were extracted from the resistant calli, and the target genes were amplified using PCR. The PCR product was cloned into the pMD19-T simple vector and sequenced. For each antibiotic-resistant calli line, eight clones were randomly picked and sent for sequencing.

4.8. Nitrogen Treatments of Transgenic Calli

The calli of wild-type (WT), transformed pRI101-MdMKK9 (OE) and transformed CRISPR/Cas9-MdMKK9 (MUT) were placed at 0 mM, 0.4 mM, 4 mM and 40 mM NO3− concentration nitrogen MS medium, respectively (the configuration of nitrogen-deficient medium was carried out as described above), cultured in 16 °C incubator for 25 days under dark condition. The calli were snap-frozen in liquid nitrogen after photographing and stored at −80 °C which were used for extraction RNA and anthocyanin.

4.9. Statistical Analysis

All data were analyzed with GraphPad Prism 8.0.2 (263) software (GraphPad Software Inc., San Diego, CA, USA). Two-way ANOVA and Tukey’s multiple comparisons test were used to compare the results under different nitrogen concentrations versus the control.

5. Conclusions

The excessive use of nitrogen fertilizer in soil is a great waste of energy and seriously affects the global goal of carbon neutralization and carbon peak. Our results suggest that MdMKK9 plays a role in the adaptation of red-fleshed apple to low nitrogen signals by regulating the anthocyanin accumulation and nitrogen status of fruits. Low nitrogen signal mediated the up-regulated expression of MdMKK9, and the expression of MdMKK9 increased the expression level of anthocyanin synthesis related genes (MdCHI, MdF3H, MdANS, MdUFGT) and nitrogen transport gene (MdNRT2.7), which promoted anthocyanin synthesis. These results provide new information that can be applied to further investigations into the functions of apple MKK9 when plants are responding to changes in nitrogen status levels. The interactions between MdMKK9 and nitrogen transport-related proteins will be the focus of follow-up work, which has potential value for improving the tolerance of apples and other crops (possibly) to nitrogen deficiency.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms23147755/s1.

Author Contributions

Conceptualization, Y.Z. and X.S.; methodology, X.S. and X.L.; software, X.L.; validation, X.L.; formal analysis, X.L.; investigation, X.S., Y.W. and X.L.; resources, Y.Z. and X.S.; data curation, X.L.; writing—original draft preparation, X.S. and X.L.; writing—review and editing, Y.Z., X.S., X.L. and S.J.; visualization, J.X. and. S.J.; supervision, Y.Z.; project administration, Y.Z.; funding acquisition, Y.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Natural Sciences Foundation of Shandong Province (ZR2019MC003), National Key R&D Program of China (2019YFD1001403), China Agriculture Research System Foundation (CARS-27), the Shandong Provincial Improved Variety Engineering System (2021LZGC024), Qingdao Agricultural University High-level Talent Research Fund (663/1118016).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available in the article and the Supplementary Materials here.

Acknowledgments

We are grateful to all lab members for the stimulating discussion and technical advice.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Xiang, Y.; Lai, F.N.; He, G.F.; Li, Y.P.; Yang, L.L.; Shen, W.; Huo, H.Q.; Zhu, J.; Dai, H.Y.; Zhang, Y.G. Alleviation of Rosup-induced oxidative stress in porcine granulosa cells by anthocyanins from red-fleshed apples. PLoS ONE 2017, 12, e0184033. [Google Scholar] [CrossRef]
  2. Zhang, Y.G.; Zhao, R.X.; Liu, W.L.; Sun, X.H.; Bai, S.H.; Xiang, Y.; Dai, H.Y. The anthocyanins component and the influence factors of contents in red-flesh apple ‘Hong-Xun No.1’. Eur. J. Hortic. Sci. 2016, 81, 248–254. [Google Scholar] [CrossRef]
  3. Espley, R.V.; Brendolise, C.; Chagné, D.; Kutty-Amma, S.; Green, S.; Volz, R.; Putterill, J.; Schouten, H.J.; Gardiner, S.E.; Hellens, R.P.; et al. Multiple repeats of a promoter segment causes transcription factor autoregulation in red apples. Plant Cell 2009, 21, 168–183. [Google Scholar] [CrossRef] [Green Version]
  4. Rupasinghe, H.P.V.; Huber, G.M.; Embree, C.; Forsline, P.L. Red-fleshed apple as a source for functional beverages. Can. J. Biochem. 2010, 90, 95–100. [Google Scholar] [CrossRef]
  5. Sun, X.H.; Bai, S.H.; Hou, H.M.; Sun, X.; Zhu, J.; Dai, H.Y.; Zhang, Y.G. A New Red-fleshed Apple Cultivar ‘Daihong’. Acta Hortic. Sin. 2019, 46, 2729–2730. [Google Scholar]
  6. Feng, X.X.; An, Y.Y.; Zheng, J.; Sun, M.; Wang, L.J. Proteomics and SSH analyses of ALA-promoted fruit coloration and evidence for the involvement of a MADS-Box gene, MdMADS1. Front. Plant Sci. 2016, 7, 1615. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  7. Soubeyrand, E.; Basteau, C.; Hilbert, G.; Leeuwen, C.V.; Delrot, S.; Gomès, E. Nitrogen supply affects anthocyanin biosynthetic and regulatory genes in grapevine cv. Cabernet-Sauvignon berries. Phytochemistry 2014, 103, 38–49. [Google Scholar] [CrossRef] [PubMed]
  8. Ryu, J.-A.; Duan, S.C.; Jeong, H.-Y.; Lee, C.H.; Kang, I.-K.; Eom, S.H. Pigmentation and Flavonoid Metabolite Diversity in Immature ‘Fuji’ Apple Fruits in Response to Lights and Methyl Jasmonate. Int. J. Mol. Sci. 2022, 23, 1722. [Google Scholar] [CrossRef]
  9. An, J.P.; Wang, X.F.; Li, Y.Y.; Song, L.Q.; Zhao, L.L.; You, C.X.; Hao, Y.J. EIN3-LIKE1, MYB1, and ETHYLENE RESPONSE FACTOR3 act in a regulatory loop that synergistically modulates ethylene biosynthesis and anthocyanin accumulation. Plant Physiol. 2018, 178, 808–823. [Google Scholar] [CrossRef]
  10. Wang, X.F.; An, J.P.; Liu, X.; Li, Y.Y.; Su, L.; You, C.X.; Hao, Y.J. The nitrate-responsive protein MdBT2 regulates anthocyanin biosynthesis by interacting with the MdMYB1 transcription factor. Plant Physiol. 2018, 178, 890–906. [Google Scholar] [CrossRef] [Green Version]
  11. Feng, F.J.; Li, M.J.; Ma, F.W.; Cheng, L.L. Phenylpropanoid metabolites and expression of key genes involved in anthocyanin biosynthesis in the shaded peel of apple fruit in response to sun exposure. Plant Physiol. Biochem. 2013, 69, 54–61. [Google Scholar] [CrossRef] [PubMed]
  12. He, J.; Giusti, M.M. Anthocyanins: Natural colorants with health promoting properties. Annu. Rev. Food Sci. Technol. 2010, 1, 163–187. [Google Scholar] [CrossRef]
  13. Meng, J.F.; Ning, P.F.; Xu, T.F.; Zhang, Z.W. Effect of rain-shelter cultivation of Vitis vinifera cv. Cabernet Gernischet on the phenolic profile of berry skins and the incidence of grape diseases. Molecules 2013, 18, 381–397. [Google Scholar] [CrossRef]
  14. Laura, J. New insights into the regulation of anthocyanin biosynthesis in fruits. Trends Plant Sci. 2013, 18, 477–483. [Google Scholar]
  15. Ji, X.H.; Wang, Y.T.; Zhang, R.; Wu, S.J.; An, M.M.; Li, M.; Wang, C.Z.; Chen, X.L.; Zhang, Y.M.; Chen, X.S. Effect of auxin cytokinin and nitrogen on anthocyanin biosynthesis in calli cultures of red-fleshed apple (Malus sieversiif. niedzwetzkyana). Plant Cell Tissue Organ Cult. 2015, 120, 325–337. [Google Scholar] [CrossRef]
  16. Castaings, L.; Marchive, C.; Meyer, C.; Krapp, A. Nitrogen signaling in Arabidopsis: How to obtain insights into a complex signaling network. J. Exp. Bot. 2011, 62, 1391–1397. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  17. Wittgenstein, N.J.V.; Le, C.H.; Hawkins, B.J.; Ehlting, J. Evolutionary classification of ammonium, nitrate, and peptide transporters in land plants. BMC Evol. Biol. 2014, 14, 11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  18. Chao, H.B.; He, J.J.; Cai, Q.Q.; Zhao, W.G.; Fu, H.; Hua, Y.P.; Li, M.T.; Huang, J.Y. The expression characteristics of NPF genes and their response to vernalization and nitrogen deficiency in rapeseed. Int. J. Mol. Sci. 2021, 22, 4944. [Google Scholar] [CrossRef]
  19. Wang, Q.; Liu, C.H.; Dong, Q.L.; Huang, D.; Li, C.Y.; Li, P.M.; Ma, F.W. Genome-wide identification and analysis of apple NITRATE TRANSPORTER 1/PEPTIDE TRANSPORTER family (NPF) genes reveals MdNPF6.5 confers high capacity for ni-trogen uptake under low-nitrogen conditions. Int. J. Mol. Sci. 2018, 19, 2761. [Google Scholar] [CrossRef] [Green Version]
  20. Huang, L.L.; Li, M.J.; Yun, S.; Sun, T.T.; Li, C.Y. Ammonium uptake increases in response to PEG-induced drought stress in Malus hupehensis Rehd. Environ. Exp. Bot. 2018, 151, 32–42. [Google Scholar] [CrossRef]
  21. Liu, X.; Liu, H.F.; Li, H.L.; An, X.H.; Song, L.Q.; You, C.X.; Zhao, L.L.; Tian, Y.; Wang, X.F. MdMYB10 affects nitrogen uptake and reallocation by regulating the nitrate transporter MdNRT2.4-1 in red-fleshed apple. Horticul. Res. 2022, 9, uhac016. [Google Scholar] [CrossRef]
  22. Wang, Q.; Liu, C.H.; Huang, D.; Dong, Q.L.; Li, P.M.; Ma, F.W. High-efficient utilization and uptake of N contribute to higher NUE of ‘Qinguan’ apple under drought and N-deficient conditions compared with ‘Honeycrisp’. Tree Physiol. 2019, 39, 1880–1895. [Google Scholar] [CrossRef] [PubMed]
  23. Liu, X.M.; Jin, Y.B.; Tan, K.X.; Zheng, J.Z.; Gao, T.T.; Zhang, Z.J.; Zhao, Y.J.; Ma, F.W.; Li, C. MdTyDc overexpression improves alkalinity tolerance in Malus domestica. Front. Plant Sci. 2021, 12, 625890. [Google Scholar] [CrossRef] [PubMed]
  24. Dugassa, N.F.; Solveig, M.O.; Behzad, H.; Cathrine, L. Nitrogen depletion and small R3-MYB transcription factors affecting anthocyanin accumulation in Arabidopsis leaves. Phytochemistry 2014, 98, 34–40. [Google Scholar]
  25. Su, N.N.; Wu, Q.; Cui, J. Increased Sucrose in the Hypocotyls of radish sprouts contributes to nitrogen deficiency-induced anthocyanin accumulation. Front. Plant Sci. 2016, 7, 1976. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Zhang, Y.Q.; Liu, Z.J.; Liu, J.P.; Lin, S.; Wang, J.F.; Lin, W.X.; Xu, W.F. GA-DELLA pathway is involved in regulation of nitrogen deficiency-induced anthocyanin accumulation. Plant Cell Rep. 2017, 36, 557–569. [Google Scholar] [CrossRef] [PubMed]
  27. Sun, X.; Jia, X.; Huo, L.Q.; Che, R.M.; Gong, X.Q.; Wang, P.; Ma, F.W. MdATG18a overexpression improves tolerance to ni-trogen deficiency and regulates anthocyanin accumulation through increased autophagy in transgenic apple. Plant Cell Environ. 2018, 41, 469–480. [Google Scholar] [CrossRef]
  28. Fiil, B.K.; Petersen, K.; Petersen, M.; Mundy, J. Gene regulation by MAP kinase cascades. Curr. Opin. Plant Biol. 2008, 12, 615–621. [Google Scholar] [CrossRef] [PubMed]
  29. Zhang, S.C.; Xu, R.R.; Luo, X.C.; Jiang, Z.S.; Shu, H.R. Genome-wide identification and expression analysis of MAPK and MAPKK gene family in Malus domestica. Gene 2013, 531, 377–387. [Google Scholar] [CrossRef]
  30. Liu, J.Y.; Yang, H.B.; Bao, F.; Ao, K.; Zhang, X.Y.; Zhang, Y.L.; Yang, S.H. IBR5 modulates temperature-dependent R protein CHS3-mediated defense responses in Arabidopsis. PLoS Genet. 2015, 11, e1005584. [Google Scholar] [CrossRef]
  31. Zhang, M.M.; Su, J.B.; Zhang, Y.; Xu, J.; Zhang, S.Q. Conveying endogenous and exogenous signals: MAPK cascades in plant growth and defense. Curr. Opin. Plant Biol. 2018, 45, 1–10. [Google Scholar] [CrossRef] [PubMed]
  32. Wang, N.; Liu, Y.S.; Dong, C.H.; Zhang, Y.G.; Bai, S.H. MdMAPKKK1 regulates apple resistance to Botryosphaeria dothidea by interacting with MdBSK1. Int. J. Mol. Sci. 2022, 23, 4415. [Google Scholar] [CrossRef] [PubMed]
  33. Alzwiy, I.A.; Morris, P.C. A mutation in the Arabidopsis MAP kinase kinase 9 gene results in enhanced seedling stress tolerance. Plant Sci. 2007, 173, 302–308. [Google Scholar] [CrossRef]
  34. Wang, J.; Wang, Y.; Yang, J.; Ma, C.L.; Zhang, Y.; Ge, T.; Qi, Z.; Kang, Y. Arabidopsis root hair defective3 is involved in nitrogen starvation-induced anthocyanin accumulation. J. Integr. Plant Boil. 2015, 57, 708–721. [Google Scholar] [CrossRef]
  35. Luo, J.; Wang, X.; Feng, L.; Li, Y.; He, J.X. The mitogen-activated protein kinase kinase 9 (MKK9) modulates nitrogen acquisition and anthocyanin accumulation under nitrogen-limiting condition in Arabidopsis. Biochem. Biophys. Res. Commu. 2017, 487, 539–544. [Google Scholar] [CrossRef]
  36. Liu, Z.B.; Li, Y.; Cao, H.W.; Ren, D.T. Comparative phospho-proteomics analysis of salt-responsive phosphoproteins regulated by the MKK9-MPK6 cascade in Arabidopsis. Plant Sci. 2015, 241, 138–150. [Google Scholar] [CrossRef]
  37. Liu, J.; Wang, X.M.; Yang, L.; Nan, W.B.; Ruan, M.J.; Bi, Y.R. Involvement of active MKK9-MAPK3/MAPK6 in increasing respiration in salt-treated Arabidopsis callus. Protoplasma 2020, 257, 965–977. [Google Scholar] [CrossRef]
  38. Zhou, C.J.; Cai, Z.H.; Guo, Y.F.; Gan, S.S. An Arabidopsis mitogen-activated protein kinase cascade, MKK9-MPK6, plays a role in leaf senescence. Plant Physiol. 2009, 150, 167–177. [Google Scholar] [CrossRef] [Green Version]
  39. Zhao, L.; Wang, C.C.; Zhu, F.; Li, Y. Mild osmotic stress promotes 4-methoxy indolyl-3-methyl glucosinolate biosynthesis mediated by the MKK9–MPK3/MPK6 cascade in Arabidopsis. Plant Cell Rep. 2017, 36, 543–555. [Google Scholar] [CrossRef]
  40. Neilsen, G.H.; Neilsen, D.; Herbert, L. Nitrogen fertigation concentration and timing of application affect nitrogen nutrition, yield, firmness, and color of apples grown at high density. HortScience 2009, 44, 1425–1431. [Google Scholar] [CrossRef] [Green Version]
  41. Fallahi, E.; Colt, W.M.; Fallahi, B. Optimum ranges of leaf nitrogen for yield, fruit quality, and photosynthesis in ‘BC-2 Fuji’ apple. J. Am. Pomol. Soc. 2001, 55, 68–75. [Google Scholar]
  42. Munnik, T.; Meijer, H.J.G. Osmotic stress activates distinct lipid and MAPK signaling pathways in plants. FEBS Lett. 2001, 498, 172–178. [Google Scholar] [CrossRef] [Green Version]
  43. Asai, T.; Tena, G.; Plotnikova, J.; Willmann, M.R.; Chiu, W.L.; Gomez-Gomez, L.; Boller, T.; Ausubel, F.M.; Sheen, J. MAP kinase signaling cascade in Arabidopsis innate immunity. Nature 2002, 415, 977–983. [Google Scholar] [CrossRef] [PubMed]
  44. Rodriguez, M.C.S.; Petersen, M.; Mundy, J. Mitogen-activated protein kinase signaling in plants. Annu. Rev. Plant Biol. 2010, 61, 621–649. [Google Scholar]
  45. Colcombet, J.; Hirt, H. Arabidopsis MAPKs: A complex signaling network involved in multiple biological processes. Biochem. J. 2008, 413, 217–226. [Google Scholar] [CrossRef]
  46. Zhang, H.L.; Mao, K.; Liu, Z.; Xie, X.B.; Feng, X.M.; Hao, Y.J. In silico analysis and expression confirmation of the regulation of fruit coloration by transcriptional factor MdMYB1 in Delicious apple. Acta. Hortic. Sin. 2010, 36, 1581–1588. [Google Scholar]
  47. Chopin, F.; Orsel, M.; Dorbe, M.F.; Chardon, F.; Truong, H.N.; Mille, A.J.; Krapp, A.; Daniel-Vedele, F. The Arabidopsis ATNRT2.7 nitrate transporter controls nitrate content in seeds. Plant Cell 2007, 19, 1590–1602. [Google Scholar] [CrossRef] [Green Version]
  48. Liu, Y.J.; Gao, N.; Ma, Q.J.; Zhang, J.C.; Wang, X.; Lu, J.; Hao, Y.J.; Wang, X.F.; You, C.X. The MdABI5 transcription factor interacts with the MdNRT1.5/MdNPF7.3 promoter to fine-tune nitrate transport from roots to shoots in apple. Hortic.Res. 2021, 8, 236. [Google Scholar] [CrossRef]
  49. Ueda, Y.; Kiba, T.; Yanagisawa, S. Nitrate-inducible NIGT1 proteins modulate phosphate uptake and starvation signalling via transcriptional regulation of SPX genes. Plant J. 2020, 102, 448–466. [Google Scholar] [CrossRef]
  50. Han, P.L.; Dong, Y.H.; Gu, K.D.; Yu, J.Q.; Hu, D.G.; Hao, Y.J. The apple U-box E3 ubiquitin ligase MdPUB29 contributes to activate plant immune response to the fungal pathogen Botryosphaeria dothidea. Planta 2019, 249, 1177–1188. [Google Scholar] [CrossRef]
  51. Zhao, X.Y.; Qi, C.H.; Jiang, H.; Zhong, M.S.; Zhao, Q.; You, C.X.; Li, Y.Y.; Hao, Y.J. MdWRKY46-enhanced apple resistance to Botryosphaeria dothidea by activating the expression of MdPBS3.1 in the salicylic acid signaling pathway. Mol. Plant Microbe Interact. 2019, 32, 1391–1401. [Google Scholar] [CrossRef] [PubMed]
  52. Zhou, H.J.; Bai, S.H.; Wang, N.; Sun, X.H.; Zhang, Y.G.; Zhu, J.; Dong, C.H. CRISPR/Cas9-mediated mutagenesis of MdCNGC2 in apple callus and VIGS-mediated silencing of MdCNGC2 in fruits improve resistance to Botryosphaeria dothidea. Front. Plant Sci. 2020, 11, 575477. [Google Scholar] [CrossRef] [PubMed]
  53. Li, R.Y.; Vavrik, C.; Danna, C.H. Proxies of CRISPR/Cas9 activity to aid in the identification of mutagenized Arabidopsis plants. G3-Genes Genom. Genet. 2020, 10, 2033–2042. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  54. Xu, Y.H.; Zhang, L.; Lu, L.Q.; Liu, J.H.; Yi, H.L.; Wu, J.X. An efficient CRISPR/Cas9 system for simultaneous editing two target sites in Fortunella hindsii. Horticul. Res. 2022, 9, uhac064. [Google Scholar] [CrossRef]
  55. Li, R.; Liu, C.X.; Zhao, R.R.; Wang, L.; Chen, L.; Yu, W.Q.; Zhang, S.J.; Sheng, J.P.; Shen, L. CRISPR/Cas9-Mediated SlNPR1 mutagenesis reduces tomato plant drought tolerance. BMC Plant Biol. 2019, 19, 38. [Google Scholar] [CrossRef] [Green Version]
  56. Ueta, R.; Abe, C.; Watanabe, T.; Sugano, S.S.; Ishihara, R.; Ezura, H.; Osakabe, Y.; Osakabe, K. Rapid breeding of parthenocarpic tomato plants using CRISPR/Cas9. Sci. Rep. 2020, 10, 16776. [Google Scholar] [CrossRef]
  57. Pompili, V.; Costa, L.D.; Piazza, S.; Pindo, M.; Malnoy, M. Reduced fire blight susceptibility in apple cultivars using a high-efficiency CRISPR/Cas9-FLP/FRT-based gene editing system. Plant Biotechnol. J. 2020, 18, 845–858. [Google Scholar] [CrossRef]
  58. Karanjalker, G.R.; Ravishankar, K.V.; Shivashankara, K.S.; Karanjalker, G.R.; Ravishankar, K.V.; Shivashankara, K.S.; Dinesh, M.R.; Roy, T.K.; Sudhakar Rao, D.V. A Study on the expression of genes involved in carotenoids and anthocyanins during ripening in fruit peel of green, yellow, and red colored mango cultivars. Appl. Biochem. Biotechnol. 2018, 184, 140–154. [Google Scholar] [CrossRef]
  59. Giusti, M.M.; Wrolstad, R.E. Characterization and measurement of anthocyanins by UV-visible spectroscopy. In Current Protocols in Food Analytical Chemistry; Wrolstad, R.E., Acree, T.E., Decker, E.A., Penner, M.H., Reid, D.S., Schwartz, S.J., Shoemaker, C.F., Smith, D.M., Sporns, P., Eds.; John Wiley and Sons Inc.: New York, NY, USA, 2001; pp. F1.2.1–F1.2.13. [Google Scholar]
  60. Williams, P.; Huang, Z.L.; Wang, B.W.; Pace, R.D. Identification of anthocyanins in muscadine grapes with HPLC-ESI-MS. LWT-Food Sci. Technol. 2009, 42, 819–824. [Google Scholar]
  61. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  62. Stemmer, M.; Thumberger, T.; Keyer, M.D.S.; Wittbrodt, J.; Mateo, J.L. CCTop: An intuitive, flexible and reliable CRISPR/Cas9 target prediction tool. PLoS ONE 2015, 10, e0124633. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  63. Gao, X.H.; Chen, J.L.; Dai, X.H.; Zhang, D.; Zhao, Y.D. An effective strategy for reliably isolating heritable and Cas9-free Arabidopsis mutants generated by CRISPR/Cas9-mediated genome editing. Plant Physiol. 2016, 171, 1794–1800. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  64. An, J.P.; Liu, X.; Song, L.Q.; You, C.X.; Wang, X.F.; Hao, Y.J. Apple RING finger E3 ubiquitin MdMIEL1 negatively regulates salt and oxidative stress tolerance. J. Plant Biol. 2017, 60, 137–145. [Google Scholar] [CrossRef]
  65. Lv, L.L.; Liu, Y.S.; Bai, S.H.; Turakulov, K.S.; Dong, C.H.; Zhang, Y.G. A TIR-NBS-LRR gene MdTNL1 regulates resistance to glomerella leaf spot in apple. Int. J. Mol. Sci. 2022, 23, 6323. [Google Scholar] [CrossRef] [PubMed]
Ijms 23 07755 g001 550
Figure 1. The phenotypes and anthocyanin contents of ‘Gala’ and ‘Daihong’ apples at different stages of growth. (A): Color changes in the skin and flesh of ‘Gala’ (GL) and ‘Daihong’ (DH) apples during the S1, S2, and S3 stages of fruit development. (B): Anthocyanin contents of the skin and flesh of ‘Gala’ and ‘Daihong’ apples during the S1, S2, and S3 stages. The bars represent means ± SD (n = 3). Asterisks indicate statistically significant differences (*** p < 0.001; **** p < 0.0001).
Figure 1. The phenotypes and anthocyanin contents of ‘Gala’ and ‘Daihong’ apples at different stages of growth. (A): Color changes in the skin and flesh of ‘Gala’ (GL) and ‘Daihong’ (DH) apples during the S1, S2, and S3 stages of fruit development. (B): Anthocyanin contents of the skin and flesh of ‘Gala’ and ‘Daihong’ apples during the S1, S2, and S3 stages. The bars represent means ± SD (n = 3). Asterisks indicate statistically significant differences (*** p < 0.001; **** p < 0.0001).
Ijms 23 07755 g001
Ijms 23 07755 g002 550
Figure 2. Relative expression levels of genes in the MAPK gene family at different developmental stages in ‘Gala’ and ‘Daihong’. (A) MdMKK2 (a, Leaf, b, Stem, c, Skin, d, Flesh, the same below). (B) MdMKK3. (C) MdMKK4. (D) MdMKK5. (E): MdMKK6. (F): MdMKK9. The relative gene expression was calculated according to the 2−ΔCT method. The bars represent means ± SD (n = 3). Asterisks indicate statistically significant differences (* p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001).
Figure 2. Relative expression levels of genes in the MAPK gene family at different developmental stages in ‘Gala’ and ‘Daihong’. (A) MdMKK2 (a, Leaf, b, Stem, c, Skin, d, Flesh, the same below). (B) MdMKK3. (C) MdMKK4. (D) MdMKK5. (E): MdMKK6. (F): MdMKK9. The relative gene expression was calculated according to the 2−ΔCT method. The bars represent means ± SD (n = 3). Asterisks indicate statistically significant differences (* p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001).
Ijms 23 07755 g002
Ijms 23 07755 g003 550
Figure 3. The phenotype, nitrogen content, anthocyanin content, and relative expression level of the MdMKK9 gene in ‘Daihong’ tissue culture seedlings grown in culture mediums with different nitrogen concentrations. (A) Phenotype. (B) Relative expression levels of MdMKK9. The relative level of MdMKK9 in ‘Dahong’ tissue culture seedlings at 0 h was set to 1. Asterisks indicate statistically significant differences (* p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001). (C) Nitrogen content. (D) Anthocyanin content. In (C,D), different letters above the bars indicate significant differences (p < 0.05). The bars represent means ± SD (n = 3).
Figure 3. The phenotype, nitrogen content, anthocyanin content, and relative expression level of the MdMKK9 gene in ‘Daihong’ tissue culture seedlings grown in culture mediums with different nitrogen concentrations. (A) Phenotype. (B) Relative expression levels of MdMKK9. The relative level of MdMKK9 in ‘Dahong’ tissue culture seedlings at 0 h was set to 1. Asterisks indicate statistically significant differences (* p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001). (C) Nitrogen content. (D) Anthocyanin content. In (C,D), different letters above the bars indicate significant differences (p < 0.05). The bars represent means ± SD (n = 3).
Ijms 23 07755 g003
Ijms 23 07755 g004 550
Figure 4. Relative expression of anthocyanin synthesis-related genes in ‘Daihong’ tissue culture seedlings grown in mediums with 4 and 0 mM NO3−. (A) Relative expression of structural genes involved in anthocyanin synthesis (a: MdPAL, b: MdCHS, c: MdCHI, d: MdF3H, e: MdDFR, f: MdANS, g: MdANR, h: MdUFGT). (B) Relative expression of regulatory genes related to anthocyanin synthesis (a: MdMYB10, b: MdbHLH33, c: MdbHLH3, d: MdWD40). The relative level of anthocyanin synthesis-related genes in ‘Dahong’ tissue culture seedlings at 0 h was set to 1. The bars represent means ± SD (n = 3). Asterisks indicate statistically significant differences (* p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001).
Figure 4. Relative expression of anthocyanin synthesis-related genes in ‘Daihong’ tissue culture seedlings grown in mediums with 4 and 0 mM NO3−. (A) Relative expression of structural genes involved in anthocyanin synthesis (a: MdPAL, b: MdCHS, c: MdCHI, d: MdF3H, e: MdDFR, f: MdANS, g: MdANR, h: MdUFGT). (B) Relative expression of regulatory genes related to anthocyanin synthesis (a: MdMYB10, b: MdbHLH33, c: MdbHLH3, d: MdWD40). The relative level of anthocyanin synthesis-related genes in ‘Dahong’ tissue culture seedlings at 0 h was set to 1. The bars represent means ± SD (n = 3). Asterisks indicate statistically significant differences (* p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001).
Ijms 23 07755 g004
Ijms 23 07755 g005 550
Figure 5. Relative expression of nitrogen transport-related genes in tissue cultured seedlings of ‘Daihong’ cultured in mediums with 4 and 0 mM NO3−. (A). MdNPF6.8, (B). MdNPF6.9, (C). MdNRT2.4, (D) MdNRT2.7, (E) MdAMT1.5, (F) MdNMT3.1. The relative level of nitrogen transport-related genes in ‘Dahong’ tissue culture seedlings at 0 h was set to 1. The bars represent means ± SD (n = 3). Asterisks indicate statistically significant differences (* p < 0.05; ** p < 0.01; **** p < 0.0001).
Figure 5. Relative expression of nitrogen transport-related genes in tissue cultured seedlings of ‘Daihong’ cultured in mediums with 4 and 0 mM NO3−. (A). MdNPF6.8, (B). MdNPF6.9, (C). MdNRT2.4, (D) MdNRT2.7, (E) MdAMT1.5, (F) MdNMT3.1. The relative level of nitrogen transport-related genes in ‘Dahong’ tissue culture seedlings at 0 h was set to 1. The bars represent means ± SD (n = 3). Asterisks indicate statistically significant differences (* p < 0.05; ** p < 0.01; **** p < 0.0001).
Ijms 23 07755 g005
Ijms 23 07755 g006 550
Figure 6. Mutagenesis of the MdMKK9 gene based on the CRISPR/Cas9 system. (A) Expression cassette of the gene-editing vector derived from pHDE-35S-Cas9-mCherry-UBQ. The red box indicates the target site. (B) MdMKK9 mutations resulting from four positive lines of gene editing. WT, wild-type. MdMKK9-MUT-site1 and MdMKK9-MUT-site2 represent two different clones. The blue dots indicate the missing bases. Red letters indicate the protospacer adjacent motifs. (C) Sequencing chromatogram of partial genomic DNA of MdMKK9 corresponding to the mutations. The orange frames indicate target sites for gene editing.
Figure 6. Mutagenesis of the MdMKK9 gene based on the CRISPR/Cas9 system. (A) Expression cassette of the gene-editing vector derived from pHDE-35S-Cas9-mCherry-UBQ. The red box indicates the target site. (B) MdMKK9 mutations resulting from four positive lines of gene editing. WT, wild-type. MdMKK9-MUT-site1 and MdMKK9-MUT-site2 represent two different clones. The blue dots indicate the missing bases. Red letters indicate the protospacer adjacent motifs. (C) Sequencing chromatogram of partial genomic DNA of MdMKK9 corresponding to the mutations. The orange frames indicate target sites for gene editing.
Ijms 23 07755 g006
Ijms 23 07755 g007 550
Figure 7. The phenotype, anthocyanin content, and MdMKK9 expression levels of calli from wild-type (WT) ‘Orin’ plants, transformed CRISPR/Cas9-MdMKK9 (MUT) lines, and transformed pRI101-MdMKK9 (OE) lines grown in mediums with different nitrogen concentrations. (A) Phenotypes of the calli. (B) Anthocyanin content. (C) Relative expression levels of MdMKK9. The relative level of MdMKK9 in 40 mM NO3− treated WT calli was set to 1. The bars represent means ± SD (n = 3). Asterisks indicate statistically significant differences (* p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001).
Figure 7. The phenotype, anthocyanin content, and MdMKK9 expression levels of calli from wild-type (WT) ‘Orin’ plants, transformed CRISPR/Cas9-MdMKK9 (MUT) lines, and transformed pRI101-MdMKK9 (OE) lines grown in mediums with different nitrogen concentrations. (A) Phenotypes of the calli. (B) Anthocyanin content. (C) Relative expression levels of MdMKK9. The relative level of MdMKK9 in 40 mM NO3− treated WT calli was set to 1. The bars represent means ± SD (n = 3). Asterisks indicate statistically significant differences (* p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001).
Ijms 23 07755 g007
Ijms 23 07755 g008 550
Figure 8. Expression levels of structural genes related to anthocyanin synthesis in the calli of wild-type (WT) plants, transformed CRISPR/Cas9-MdMKK9 (MUT) lines, and transformed pRI101-MdMKK9 (OE) lines grown in mediums with different nitrogen concentrations. (A) Relative expression of structural genes involved in anthocyanin synthesis (a: MdPAL, b: MdCHS, c: MdCHI, d: MdF3H, e: MdDFR, f: MdANS, g: MdANR, h: MdUFGT). (B) Relative expression of regulatory genes related to anthocyanin synthesis (a: MdMYB10, b: MdbHLH3, c: MdWD40). The relative level of anthocyanin synthesis-related genes in 40 mM NO3− treated WT calli was set to 1. The bars represent means ± SD (n = 3). Asterisks indicate statistically significant differences (* p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001).
Figure 8. Expression levels of structural genes related to anthocyanin synthesis in the calli of wild-type (WT) plants, transformed CRISPR/Cas9-MdMKK9 (MUT) lines, and transformed pRI101-MdMKK9 (OE) lines grown in mediums with different nitrogen concentrations. (A) Relative expression of structural genes involved in anthocyanin synthesis (a: MdPAL, b: MdCHS, c: MdCHI, d: MdF3H, e: MdDFR, f: MdANS, g: MdANR, h: MdUFGT). (B) Relative expression of regulatory genes related to anthocyanin synthesis (a: MdMYB10, b: MdbHLH3, c: MdWD40). The relative level of anthocyanin synthesis-related genes in 40 mM NO3− treated WT calli was set to 1. The bars represent means ± SD (n = 3). Asterisks indicate statistically significant differences (* p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001).
Ijms 23 07755 g008
Ijms 23 07755 g009 550
Figure 9. Expression levels of nitrogen regulatory genes in the calli of wild-type (WT) plants, transformed CRISPR/Cas9-MdMKK9 (MUT) lines, and transformed pRI101-MdMKK9 (OE) lines grown in mediums with different nitrogen concentrations. The relative level of nitrogen transport-related genes in 40 mM NO3− treated WT calli was set to 1. The bars represent means ± SD (n = 3). Asterisks indicate statistically significant differences (* p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001).
Figure 9. Expression levels of nitrogen regulatory genes in the calli of wild-type (WT) plants, transformed CRISPR/Cas9-MdMKK9 (MUT) lines, and transformed pRI101-MdMKK9 (OE) lines grown in mediums with different nitrogen concentrations. The relative level of nitrogen transport-related genes in 40 mM NO3− treated WT calli was set to 1. The bars represent means ± SD (n = 3). Asterisks indicate statistically significant differences (* p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001).
Ijms 23 07755 g009
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Sun, X.; Li, X.; Wang, Y.; Xu, J.; Jiang, S.; Zhang, Y. MdMKK9-Mediated the Regulation of Anthocyanin Synthesis in Red-Fleshed Apple in Response to Different Nitrogen Signals. Int. J. Mol. Sci. 2022, 23, 7755. https://doi.org/10.3390/ijms23147755

AMA Style

Sun X, Li X, Wang Y, Xu J, Jiang S, Zhang Y. MdMKK9-Mediated the Regulation of Anthocyanin Synthesis in Red-Fleshed Apple in Response to Different Nitrogen Signals. International Journal of Molecular Sciences. 2022; 23(14):7755. https://doi.org/10.3390/ijms23147755

Chicago/Turabian Style

Sun, Xiaohong, Xinxin Li, Yanbo Wang, Jihua Xu, Shenghui Jiang, and Yugang Zhang. 2022. "MdMKK9-Mediated the Regulation of Anthocyanin Synthesis in Red-Fleshed Apple in Response to Different Nitrogen Signals" International Journal of Molecular Sciences 23, no. 14: 7755. https://doi.org/10.3390/ijms23147755

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop