Lactoferrin Deficiency Impairs Proliferation of Satellite Cells via Downregulating the ERK1/2 Signaling Pathway
Abstract
1. Introduction
2. Results
2.1. Ltf Deficiency Impairs Regenerative Capability of Skeletal Muscle
2.2. Deletion of Ltf Reduces Proliferative Capability of SCs
2.3. Decreased Proliferation of SCs Caused by Ltf Deficiency Is Regulated by the ERK Signaling Pathway
2.4. R-Ltf Promotes Damage Repair of Skeletal Muscle
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Generation of Ltf Knockout Mice
4.3. Tibialis Anterior Muscle Injury
4.4. SCs Isolation and Culture
4.5. Myofiber Isolation and Culture
4.6. Cell Proliferation Assay
4.7. Histological and Morphometric Analysis
4.8. qRT-PCR Analysis
4.9. RNA Sequencing
4.10. Western Blotting
4.11. Immunofluorescence and Immunohistochemistry
4.12. CCK-8 Assay
4.13. Intraperitoneal Injection of R-Ltf in Intervention of BaCl2 Injury to TA
4.14. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Superti, F. Lactoferrin from Bovine Milk: A Protective Companion for Life. Nutrients 2020, 12, 2562. [Google Scholar] [CrossRef] [PubMed]
- Gleerup, H.S.; Jensen, C.S.; Høgh, P.; Hasselbalch, S.G.; Simonsen, A.H. Lactoferrin in cerebrospinal fluid and saliva is not a diagnostic biomarker for Alzheimer’s disease in a mixed memory clinic population. EBioMedicine 2021, 67, 103361. [Google Scholar] [CrossRef] [PubMed]
- Telang, S. Lactoferrin: A Critical Player in Neonatal Host Defense. Nutrients 2018, 10, 1228. [Google Scholar] [CrossRef] [PubMed]
- García-Montoya, I.; Salazar-Martínez, J.; Arévalo-Gallegos, S.; Sinagawa-García, S.; Rascón-Cruz, Q. Expression and characterization of recombinant bovine lactoferrin in E. coli. BioMetals 2012, 26, 113–122. [Google Scholar] [CrossRef]
- Wang, B.; Timilsena, Y.P.; Blanch, E.; Adhikari, B. Lactoferrin: Structure, function, denaturation and digestion. Crit. Rev. Food Sci. Nutr. 2019, 59, 580–596. [Google Scholar] [CrossRef]
- Antoshin, A.A.; Shpichka, A.I.; Huang, G.; Chen, K.; Lu, P.; Svistunov, A.A.; Lychagin, A.V.; Lipina, M.M.; Sinelnikov, M.Y.; Reshetov, I.V.; et al. Lactoferrin as a regenerative agent: The old-new panacea? Pharmacol. Res. 2021, 167, 105564. [Google Scholar] [CrossRef]
- Kitakaze, T.; Oshimo, M.; Kobayashi, Y.; Ryu, M.; Suzuki, Y.A.; Inui, H.; Harada, N.; Yamaji, R. Lactoferrin promotes murine C2C12 myoblast proliferation and differentiation and myotube hypertrophy. Mol. Med. Rep. 2018, 17, 5912–5920. [Google Scholar] [CrossRef]
- Zhang, W.; Guo, H.; Jing, H.; Li, Y.; Wang, X.; Zhang, H.; Jiang, L.; Ren, F. Lactoferrin Stimulates Osteoblast Differentiation Through PKA and p38 Pathways Independent of Lactoferrin’s Receptor LRP1. J. Bone Miner. Res. 2013, 29, 1232–1243. [Google Scholar] [CrossRef]
- Huang, H.-C.; Lin, H.; Huang, M.-C. Lactoferrin promotes hair growth in mice and increases dermal papilla cell proliferation through Erk/Akt and Wnt signaling pathways. Arch. Dermatol. Res. 2019, 311, 411–420. [Google Scholar] [CrossRef]
- Moreno-Navarrete, J.M.; Ortega, F.J.; Moreno, M.; Serrano, M.; Ricart, W.; Fernández-Real, J.M. Lactoferrin gene knockdown leads to similar effects to iron chelation in human adipocytes. J. Cell. Mol. Med. 2014, 18, 391–395. [Google Scholar] [CrossRef]
- Moreno-Navarrete, J.M.; Ortega, F.J.; Ricart, W.; Fernández-Real, J.M. Lactoferrin increases 172ThrAMPK phosphorylation and insulin-induced p473SerAKT while impairing adipocyte differentiation. Int. J. Obes. 2009, 33, 991–1000. [Google Scholar] [CrossRef]
- Cutone, A.; Rosa, L.; Ianiro, G.; Lepanto, M.S.; Di Patti, M.C.B.; Valenti, P.; Musci, G. Lactoferrin’s Anti-Cancer Properties: Safety, Selectivity, and Wide Range of Action. Biomolecules 2020, 10, 456. [Google Scholar] [CrossRef]
- Zhang, Y.; Lima, C.F.; Rodrigues, L.R. Anticancer effects of lactoferrin: Underlying mechanisms and future trends in cancer therapy. Nutr. Rev. 2014, 72, 763–773. [Google Scholar] [CrossRef]
- Kowalski, K.; Kolodziejczyk, A.; Sikorska, M.; Płaczkiewicz, J.; Cichosz, P.; Kowalewska, M.; Stremińska, W.; Jańczyk-Ilach, K.; Koblowska, M.; Fogtman, A.; et al. Stem cells migration during skeletal muscle regeneration—The role of Sdf-1/Cxcr4 and Sdf-1/Cxcr7 axis. Cell Adhes. Migr. 2016, 11, 384–398. [Google Scholar] [CrossRef]
- Musarò, A.; Carosio, S. Isolation and Culture of Satellite Cells from Mouse Skeletal Muscle. Mol. Biol. 2017, 1553, 155–167. [Google Scholar] [CrossRef]
- Said, R.S.; Mustafa, A.G.; Asfour, H.A.; Shaqour, E.I. Myogenic Satellite Cells: Biological Milieu and Possible Clinical Applications. Pak. J. Biol. Sci. 2016, 20, 1–11. [Google Scholar] [CrossRef][Green Version]
- Laumonier, T.; Menetrey, J. Muscle injuries and strategies for improving their repair. J. Exp. Orthop. 2016, 3, 15. [Google Scholar] [CrossRef]
- Smith, H.K.; Maxwell, L.; Rodgers, C.D.; McKee, N.H.; Plyley, M.J. Exercise-enhanced satellite cell proliferation and new myonuclear accretion in rat skeletal muscle. J. Appl. Physiol. 2001, 90, 1407–1414. [Google Scholar] [CrossRef]
- Tierney, M.T.; Sacco, A. Inducing and Evaluating Skeletal Muscle Injury by Notexin and Barium Chloride. Methods Mol. Biol. 2016, 1460, 53–60. [Google Scholar] [CrossRef]
- Su, W.-H.; Wang, C.-J.; Fu, H.-C.; Sheng, C.-M.; Tsai, C.-C.; Cheng, J.-H.; Chuang, P.-C. Human Umbilical Cord Mesenchymal Stem Cells Extricate Bupivacaine-Impaired Skeletal Muscle Function via Mitigating Neutrophil-Mediated Acute Inflammation and Protecting against Fibrosis. Int. J. Mol. Sci. 2019, 20, 4312. [Google Scholar] [CrossRef]
- Sun, Y.; Liu, W.-Z.; Liu, T.; Feng, X.; Yang, N.; Zhou, H.-F. Signaling pathway of MAPK/ERK in cell proliferation, differentiation, migration, senescence and apoptosis. J. Recept. Signal Transduct. 2015, 35, 600–604. [Google Scholar] [CrossRef]
- Feng, Y.; Hua, X.; Niu, R.; Du, Y.; Shi, C.; Zhou, R.; Chen, F.-H. ROS play an important role in ATPR inducing differentiation and inhibiting proliferation of leukemia cells by regulating the PTEN/PI3K/AKT signaling pathway. Biol. Res. 2019, 52, 26. [Google Scholar] [CrossRef]
- Guo, Y.J.; Pan, W.W.; Liu, S.B.; Shen, Z.F.; Xu, Y.; Hu, L.L. ERK/MAPK signalling pathway and tumorigenesis. Exp. Ther. Med. 2020, 19, 1997–2007. [Google Scholar] [CrossRef]
- Pokrass, M.J.; Ryan, K.A.; Xin, T.; Pielstick, B.; Timp, W.; Greco, V.; Regot, S. Cell-Cycle-Dependent ERK Signaling Dynamics Direct Fate Specification in the Mammalian Preimplantation Embryo. Dev. Cell 2020, 55, 328–340. [Google Scholar] [CrossRef]
- Mercer, K.; Giblett, S.; Oakden, A.; Brown, J.; Marais, R.; Pritchard, C. A-Raf and Raf-1 work together to influence transient ERK phosphorylation and Gl/S cell cycle progression. Oncogene 2005, 24, 5207–5217. [Google Scholar] [CrossRef]
- Jones, N.C.; Fedorov, Y.V.; Rosenthal, R.S.; Olwin, B.B. ERK1/2 is required for myoblast proliferation but is dispensable for muscle gene expression and cell fusion. J. Cell. Physiol. 2001, 186, 104–115. [Google Scholar] [CrossRef]
- Zhong, R.; Miao, R.; Meng, J.; Wu, R.; Zhang, Y.; Zhu, D. Acetoacetate promotes muscle cell proliferation via the miR-133b/SRF axis through the Mek-Erk-MEF2 pathway. Acta Biochim. Biophys. Sin. 2021, 53, 1009–1016. [Google Scholar] [CrossRef]
- Yao, Q.; Li, H.; Fan, L.; Huang, S.; Wang, J.; Zheng, N. The combination of lactoferrin and linolenic acid inhibits colorectal tumor growth through activating AMPK/JNK-related apoptosis pathway. PeerJ 2021, 9, e11072. [Google Scholar] [CrossRef]
- Rosa, L.; Cutone, A.; Lepanto, M.S.; Paesano, R.; Valenti, P. Lactoferrin: A Natural Glycoprotein Involved in Iron and Inflammatory Homeostasis. Int. J. Mol. Sci. 2017, 18, 1985. [Google Scholar] [CrossRef]
- Gao, R.; Watson, M.; Callon, K.E.; Tuari, D.; Dray, M.; Naot, D.; Amirapu, S.; Munro, J.T.; Cornish, J.; Musson, D.S. Local application of lactoferrin promotes bone regeneration in a rat critical-sized calvarial defect model as demonstrated by micro-CT and histological analysis. J. Tissue Eng. Regen. Med. 2016, 12, e620–e626. [Google Scholar] [CrossRef]
- Reznikov, E.A.; Comstock, S.S.; Yi, C.; Contractor, N.; Donovan, S.M. Dietary Bovine Lactoferrin Increases Intestinal Cell Proliferation in Neonatal Piglets. J. Nutr. 2014, 144, 1401–1408. [Google Scholar] [CrossRef] [PubMed]
- Icriverzi, M.; Bonciu, A.; Rusen, L.; Sima, L.E.; Brajnicov, S.; Cimpean, A.; Evans, R.W.; Dinca, V.; Roseanu, A. Human Mesenchymal Stem Cell Response to Lactoferrin-based Composite Coatings. Materials 2019, 12, 3414. [Google Scholar] [CrossRef] [PubMed]
- Wei, L.; Wei, L.; Zhang, X.; Zhang, X.; Wang, J.; Wang, J.; Ye, Q.; Ye, Q.; Zheng, X.; Zheng, X.; et al. Lactoferrin deficiency induces a pro-metastatic tumor microenvironment through recruiting myeloid-derived suppressor cells in mice. Oncogene 2019, 39, 122–135. [Google Scholar] [CrossRef] [PubMed]
- Wei, L.; Liu, C.; Wang, J.; Zheng, X.; Peng, Q.; Ye, Q.; Qin, Z.; Li, Z.; Zhang, X.; Wu, Y.; et al. Lactoferrin is required for early B cell development in C57BL/6 mice. J. Hematol. Oncol. 2021, 14, 58. [Google Scholar] [CrossRef]
- Zembron-Lacny, A.; Morawin, B.; Wawrzyniak-Gramacka, E.; Gramacki, J.; Jarmuzek, P.; Kotlega, D.; Ziemann, E. Multiple Cryotherapy Attenuates Oxi-Inflammatory Response Following Skeletal Muscle Injury. Int. J. Environ. Res. Public Health 2020, 17, 7855. [Google Scholar] [CrossRef]
- Yin, H.; Price, F.; Rudnicki, M.A. Satellite Cells and the Muscle Stem Cell Niche. Physiol. Rev. 2013, 93, 23–67. [Google Scholar] [CrossRef]
- Milner, D.J.; Cameron, J.A. Muscle Repair and Regeneration: Stem Cells, Scaffolds, and the Contributions of Skeletal Muscle to Amphibian Limb Regeneration. Tuberculosis 2012, 367, 133–159. [Google Scholar] [CrossRef]
- Kargl, C.K.; Nie, Y.; Evans, S.; Stout, J.; Shannahan, J.H.; Kuang, S.; Gavin, T.P. Factors secreted from high glucose treated endothelial cells impair expansion and differentiation of human skeletal muscle satellite cells. J. Physiol. 2019, 597, 5109–5124. [Google Scholar] [CrossRef]
- Collins, C.A.; Olsen, I.; Zammit, P.S.; Heslop, L.; Petrie, A.; Partridge, T.A.; Morgan, J.E. Stem Cell Function, Self-Renewal, and Behavioral Heterogeneity of Cells from the Adult Muscle Satellite Cell Niche. Cell 2005, 122, 289–301. [Google Scholar] [CrossRef]
- Saini, J.; McPhee, J.S.; Al-Dabbagh, S.; Stewart, C.E.; Al-Shanti, N. Regenerative function of immune system: Modulation of muscle stem cells. Ageing Res. Rev. 2016, 27, 67–76. [Google Scholar] [CrossRef]
- Zhang, J.; Han, X.; Shan, Y.; Zhang, L.; Du, M.; Liu, M.; Yi, H.; Ma, Y. Effect of bovine lactoferrin and human lactoferrin on the proliferative activity of the osteoblast cell line MC3T3-E1 in vitro. J. Dairy Sci. 2018, 101, 1827–1833. [Google Scholar] [CrossRef]
- Wang, Z. Regulation of Cell Cycle Progression by Growth Factor-Induced Cell Signaling. Cells 2021, 10, 3327. [Google Scholar] [CrossRef]
- Colao, I.; Pennisi, R.; Venuti, A.; Nygårdas, M.; Heikkilä, O.; Hukkanen, V.; Sciortino, M.T. The ERK-1 function is required for HSV-1-mediated G1/S progression in HEP-2 cells and contributes to virus growth. Sci. Rep. 2017, 7, 9176. [Google Scholar] [CrossRef]
- Wang, S.; Wang, X.; Gao, Y.; Peng, Y.; Dong, N.; Xie, Q.; Zhang, X.; Wu, Y.; Li, M.; Li, J. RN181 is a tumour suppressor in gastric cancer by regulation of the ERK/MAPK–cyclin D1/CDK4 pathway. J. Pathol. 2019, 248, 204–216. [Google Scholar] [CrossRef]
- Meloche, S.; Pouysségur, J. The ERK1/2 mitogen-activated protein kinase pathway as a master regulator of the G1- to S-phase transition. Oncogene 2007, 26, 3227–3239. [Google Scholar] [CrossRef]
- Ma, Y.; Fu, S.; Lu, L.; Wang, X. Role of androgen receptor on cyclic mechanical stretch-regulated proliferation of C2C12 myoblasts and its upstream signals: IGF-1-mediated PI3K/Akt and MAPKs pathways. Mol. Cell. Endocrinol. 2017, 450, 83–93. [Google Scholar] [CrossRef]
- Guo, H.Y.; Jiang, L.; Ibrahim, S.A.; Zhang, L.; Zhang, H.; Zhang, M.; Ren, F.Z. Orally Administered Lactoferrin Preserves Bone Mass and Microarchitecture in Ovariectomized Rats. J. Nutr. 2009, 139, 958–964. [Google Scholar] [CrossRef]
- Inubushi, T.; Kosai, A.; Yanagisawa, S.; Chanbora, C.; Miyauchi, M.; Yamasaki, S.; Sugiyama, E.; Ishikado, A.; Makino, T.; Takata, T. Bovine lactoferrin enhances osteogenesis through Smad2/3 and p38 MAPK activation. J. Oral Biosci. 2020, 62, 147–154. [Google Scholar] [CrossRef]
- Liu, L.; Jiang, R.; Liu, J.; Lönnerdal, B. The bovine Lactoferrin-Osteopontin complex increases proliferation of human intestinal epithelial cells by activating the PI3K/Akt signaling pathway. Food Chem. 2019, 310, 125919. [Google Scholar] [CrossRef]
- Zhang, Y.; Wang, X.; Qiu, Y.; Cornish, J.; Carr, A.J.; Xia, Z. Effect of indomethacin and lactoferrin on human tenocyte proliferation and collagen formation in vitro. Biochem. Biophys. Res. Commun. 2014, 454, 301–307. [Google Scholar] [CrossRef]
- Jung, H.-W.; Choi, J.-H.; Jo, T.; Shin, H.; Suh, J.M. Systemic and Local Phenotypes of Barium Chloride Induced Skeletal Muscle Injury in Mice. Ann. Geriatr. Med. Res. 2019, 23, 83–89. [Google Scholar] [CrossRef]




| Primer | Sequence (5′-3′) | Access NO. |
|---|---|---|
| Cyclin A-F | GCCCTGGCTTTTAATGCAGC | NM_009828.3 |
| Cyclin A-R | AACGTTCACTGGCTTGTCTTC | |
| Cyclin D1-F | ATTGTGCCATCCATGCGGAA | NM_001379248 |
| Cyclin D1-R | GAAGACCTCCTCTTCGCACT | |
| Cyclin D2-F | CTGCGGAAAAGCTGTGCATT | NM_009829 |
| Cyclin D2-R | GAAGTCGTGAGGGGTGACTG | |
| p21-F | TAAGGACGTCCCACTTTGCC | NM_001111099.2 |
| p21-R | GACAACGGCACACTTTGCTC | |
| β-Actin-F | TTTGCAGCTCCTTCGTTGCC | NM_007393.5 |
| β-Actin-R | CCCACGATGGAGGGGAATACA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, X.; Liu, F.; An, Q.; Wang, W.; Cheng, Z.; Dai, Y.; Meng, Q.; Zhang, Y. Lactoferrin Deficiency Impairs Proliferation of Satellite Cells via Downregulating the ERK1/2 Signaling Pathway. Int. J. Mol. Sci. 2022, 23, 7478. https://doi.org/10.3390/ijms23137478
Wang X, Liu F, An Q, Wang W, Cheng Z, Dai Y, Meng Q, Zhang Y. Lactoferrin Deficiency Impairs Proliferation of Satellite Cells via Downregulating the ERK1/2 Signaling Pathway. International Journal of Molecular Sciences. 2022; 23(13):7478. https://doi.org/10.3390/ijms23137478
Chicago/Turabian StyleWang, Xiong, Fan Liu, Qin An, Wenli Wang, Zhimei Cheng, Yunping Dai, Qingyong Meng, and Yali Zhang. 2022. "Lactoferrin Deficiency Impairs Proliferation of Satellite Cells via Downregulating the ERK1/2 Signaling Pathway" International Journal of Molecular Sciences 23, no. 13: 7478. https://doi.org/10.3390/ijms23137478
APA StyleWang, X., Liu, F., An, Q., Wang, W., Cheng, Z., Dai, Y., Meng, Q., & Zhang, Y. (2022). Lactoferrin Deficiency Impairs Proliferation of Satellite Cells via Downregulating the ERK1/2 Signaling Pathway. International Journal of Molecular Sciences, 23(13), 7478. https://doi.org/10.3390/ijms23137478

