The Upregulated Expression of the Citrus RIN4 Gene in HLB Diseased Citrus Aids Candidatus Liberibacter Asiaticus Infection
Abstract
1. Introduction
2. Results
2.1. Cloning and Sequence Analysis of Citrus Clementina RIN4
2.2. Subcellular Localization of RIN4
2.3. Effect of CLas Infection on RIN4 Expression
2.4. RIN4 Expression Levels under Different Phytohormone and Stress Treatments
2.5. Vector Construction and Genetic Transformation Results
2.6. Analysis of RIN4 Expression in Transgenic Plants
2.7. Evaluation of HLB Resistance in RIN4-Overexpression Plants
3. Discussion
4. Materials and Methods
4.1. Plant Materials
4.2. Gene Cloning and Sequence Characterization
4.3. Sequence Analyses of RIN4 and Its Corresponding Protein and Promoter
4.4. qRT-PCR Analysis of RIN4 Expression under Different Treatments
4.5. Vector Construction
4.6. Subcellular Localization Analysis
4.7. Citrus Transformation and HLB Resistance Evaluation
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Yuan, M.; Jiang, Z.; Bi, G.; Nomura, K.; Liu, M.; Wang, Y.; Cai, B.; Zhou, J.M.; He, S.Y.; Xin, X.F. Pattern-recognition receptors are required for NLR-mediated plant immunity. Nature 2021, 592, 105–109. [Google Scholar] [CrossRef] [PubMed]
- Gentzel, I.; Giese, L.; Ekanayake, G.; Mikhail, K.; Zhao, W.; Cocuron, J.; Alonso, A.P.; Mackey, D. Dynamic nutrient acquisition from a hydrated apoplast supports biotrophic proliferation of a bacterial pathogen of maize. Cell Host Microbe 2022, 30, 502–517. [Google Scholar] [CrossRef] [PubMed]
- Jelenska, J.; Lee, J.; Manning, A.J.; Wolfgeher, D.J.; Ahn, Y.; Walters-Marrah, G.; Lopez, I.E.; Garcia, L.; McClerklin, S.A.; Michelmore, R.W.; et al. Pseudomonas syringae effector HopZ3 suppresses the bacterial AvrPto1-tomato PTO immune complex via acetylation. PLoS Pathog. 2021, 17, e1010017. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.; Manning, A.J.; Wolfgeher, D.; Jelenska, J.; Cavanaugh, K.A.; Xu, H.; Fernandez, S.M.; Michelmore, R.W.; Kron, S.J.; Greenberg, J.T. Acetylation of an NB-LRR plant immune-effector complex suppresses immunity. Cell Rep. 2015, 13, 1670–1682. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Pruitt, R.N.; Nurnberger, T.; Wang, Y. Evasion of plant immunity by microbial pathogens. Nat. Rev. Microbiol. 2022. preprint. [Google Scholar] [CrossRef]
- Zhang, J.; Lu, H.; Li, X.; Li, Y.; Cui, H.; Wen, C.K.; Tang, X.; Su, Z.; Zhou, J.M. Effector-triggered and pathogen-associated molecular pattern-triggered immunity differentially contribute to basal resistance to Pseudomonas syringae. Mol. Plant Microbe Interact. 2010, 23, 940–948. [Google Scholar] [CrossRef]
- Zhang, J.; Zhou, J.M. Plant immunity triggered by microbial molecular signatures. Mol. Plant 2010, 3, 783–793. [Google Scholar] [CrossRef]
- Chang, M.; Chen, H.; Liu, F.; Fu, Z.Q. PTI and ETI: Convergent pathways with diverse elicitors. Trends Plant Sci. 2022, 27, 113–115. [Google Scholar] [CrossRef]
- Dodds, P.N.; Rathjen, J.P. Plant immunity: Towards an integrated view of plant-pathogen interactions. Nat. Rev. Genet. 2010, 11, 539–548. [Google Scholar] [CrossRef]
- Alam, M.; Tahir, J.; Siddiqui, A.; Magzoub, M.; Shahzad-Ul-Hussan, S.; Mackey, D.; Afzal, A.J. RIN4 homologs from important crop species differentially regulate the Arabidopsis NB-LRR immune receptor, RPS2. Plant Cell Rep. 2021, 40, 2341–2356. [Google Scholar] [CrossRef]
- Ray, S.K.; Macoy, D.M.; Kim, W.Y.; Lee, S.Y.; Kim, M.G. Role of RIN4 in regulating PAMP-triggered immunity and effector-triggered immunity: Current status and future perspectives. Mol. Cells 2019, 42, 503–511. [Google Scholar]
- Selote, D.; Kachroo, A. RIN4-like proteins mediate resistance protein-derived soybean defense against Pseudomonas syringae. Plant Signal Behav. 2010, 5, 1453–1456. [Google Scholar] [CrossRef] [PubMed]
- Wilton, M.; Subramaniam, R.; Elmore, J.; Felsensteiner, C.; Coaker, G.; Desveaux, D. The type III effector HopF2Pto targets Arabidopsis RIN4 protein to promote Pseudomonas syringae virulence. Proc. Natl. Acad. Sci. USA 2010, 107, 2349–2354. [Google Scholar] [CrossRef] [PubMed]
- Chung, E.H.; El-Kasmi, F.; He, Y.; Loehr, A.; Dangl, J.L. A plant phosphoswitch platform repeatedly targeted by type III effector proteins regulates the output of both tiers of plant immune receptors. Cell Host Microbe 2014, 16, 484–494. [Google Scholar] [CrossRef] [PubMed]
- Kim, M.G.; Da, C.L.; McFall, A.J.; Belkhadir, Y.; DebRoy, S.; Dangl, J.L.; Mackey, D. Two Pseudomonas syringae type III effectors inhibit RIN4-regulated basal defense in Arabidopsis. Cell 2005, 121, 749–759. [Google Scholar] [CrossRef]
- Mackey, D.; Holt, B.R.; Wiig, A.; Dangl, J.L. RIN4 interacts with Pseudomonas syringae type III effector molecules and is required for RPM1-mediated resistance in Arabidopsis. Cell 2002, 108, 743–754. [Google Scholar] [CrossRef]
- Mackey, D.; Belkhadir, Y.; Alonso, J.M.; Ecker, J.R.; Dangl, J.L. Arabidopsis RIN4 is a target of the type III virulence effector AvrRpt2 and modulates RPS2-mediated resistance. Cell 2003, 112, 379–389. [Google Scholar] [CrossRef]
- Kim, H.S.; Desveaux, D.; Singer, A.U.; Patel, P.; Sondek, J.; Dangl, J.L. The Pseudomonas syringae effector AvrRpt2 cleaves its C-terminally acylated target, RIN4, from Arabidopsis membranes to block RPM1 activation. Proc. Natl. Acad. Sci. USA 2005, 102, 6496–6501. [Google Scholar] [CrossRef]
- Cui, H.; Wang, Y.; Xue, L.; Chu, J.; Yan, C.; Fu, J.; Chen, M.; Innes, R.W.; Zhou, J.M. Pseudomonas syringae effector protein AvrB perturbs Arabidopsis hormone signaling by activating MAP kinase 4. Cell Host Microbe 2010, 7, 164–175. [Google Scholar] [CrossRef]
- Choi, S.; Prokchorchik, M.; Lee, H.; Gupta, R.; Lee, Y.; Chung, E.H.; Cho, B.; Kim, M.S.; Kim, S.T.; Sohn, K.H. Direct acetylation of a conserved threonine of RIN4 by the bacterial effector HopZ5 or AvrBsT activates RPM1-dependent immunity in Arabidopsis. Mol. Plant 2021, 14, 1951–1960. [Google Scholar] [CrossRef]
- Axtell, M.J.; Staskawicz, B.J. Initiation of RPS2-specified disease resistance in Arabidopsis is coupled to the AvrRpt2-directed elimination of RIN4. Cell 2003, 112, 369–377. [Google Scholar] [CrossRef]
- Day, B.; Dahlbeck, D.; Huang, J.; Chisholm, S.T.; Li, D.; Staskawicz, B.J. Molecular basis for the RIN4 negative regulation of RPS2 disease resistance. Plant Cell 2005, 17, 1292–1305. [Google Scholar] [CrossRef]
- Belkhadir, Y.; Nimchuk, Z.; Hubert, D.A.; Mackey, D.; Dangl, J.L. Arabidopsis RIN4 negatively regulates disease resistance mediated by RPS2 and RPM1 downstream or independent of the NDR1 signal modulator and is not required for the virulence functions of bacterial type III effectors AvrRpt2 or AvrRpm1. Plant Cell 2004, 16, 2822–2835. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Ma, X.; Chiang, Y.H.; Yadeta, K.A.; Ding, P.; Dong, L.; Zhao, Y.; Li, X.; Yu, Y.; Zhang, L.; et al. Proline isomerization of the immune receptor-interacting protein RIN4 by a cyclophilin inhibits effector-triggered immunity in Arabidopsis. Cell Host Microbe 2014, 16, 473–483. [Google Scholar] [CrossRef]
- Liu, J.; Elmore, J.M.; Fuglsang, A.T.; Palmgren, M.G.; Staskawicz, B.J.; Coaker, G. RIN4 functions with plasma membrane H+-ATPases to regulate stomatal apertures during pathogen attack. PLoS Biol. 2009, 7, e1000139. [Google Scholar] [CrossRef] [PubMed]
- Piquerez, S.J.; Harvey, S.E.; Beynon, J.L.; Ntoukakis, V. Improving crop disease resistance: Lessons from research on Arabidopsis and tomato. Front. Plant Sci. 2014, 5, 671. [Google Scholar] [CrossRef] [PubMed]
- Samaradivakara, S.P.; Chen, H.; Lu, Y.J.; Li, P.; Kim, Y.; Tsuda, K.; Mine, A.; Day, B. Overexpression of NDR1 leads to pathogen resistance at elevated temperatures. N. Phytol. 2022. preprint. [Google Scholar] [CrossRef] [PubMed]
- Day, B.; Dahlbeck, D.; Staskawicz, B.J. NDR1 interaction with RIN4 mediates the differential activation of multiple disease resistance pathways in Arabidopsis. Plant Cell 2006, 18, 2782–2791. [Google Scholar] [CrossRef]
- Kaundal, A.; Ramu, V.S.; Oh, S.; Lee, S.; Pant, B.; Lee, H.K.; Rojas, C.M.; Senthil-Kumar, M.; Mysore, K.S. General control nonrepressible4 degrades 14-3-3 and the RIN4 complex to regulate stomatal aperture with implications on nonhost disease resistance and drought tolerance. Plant Cell 2017, 29, 2233–2248. [Google Scholar] [CrossRef]
- Sabol, P.; Kulich, I.; Zarsky, V. RIN4 recruits the exocyst subunit EXO70B1 to the plasma membrane. J. Exp. Bot. 2017, 68, 3253–3265. [Google Scholar] [CrossRef]
- Stegmann, M.; Anderson, R.G.; Westphal, L.; Rosahl, S.; McDowell, J.M.; Trujillo, M. The exocyst subunit Exo70B1 is involved in the immune response of Arabidopsis thaliana to different pathogens and cell death. Plant Signal Behav. 2013, 8, e27421. [Google Scholar] [CrossRef]
- Zhu, Y.; Wu, B.; Guo, W. The role of Exo70 in exocytosis and beyond. Small GTPases 2019, 10, 331–335. [Google Scholar] [CrossRef] [PubMed]
- Luo, Y.; Caldwell, K.S.; Wroblewski, T.; Wright, M.E.; Michelmore, R.W. Proteolysis of a negative regulator of innate immunity is dependent on resistance genes in tomato and Nicotiana benthamiana and induced by multiple bacterial effectors. Plant Cell 2009, 21, 2458–2472. [Google Scholar] [CrossRef] [PubMed]
- Lindqvist-kreuze, H.; Carbajulca, D.; Gonzalez-escobedo, G.; Pérez, W.; Bonierbale, M. Comparison of transcript profiles in late blight-challenged Solanum cajamarquense and B3C1 potato clones. Mol. Plant Pathol. 2010, 11, 513–530. [Google Scholar] [CrossRef] [PubMed]
- Li, C.Y.; Deng, G.M.; Yang, J.; Viljoen, A.; Jin, Y.; Kuang, R.B.; Zuo, C.W.; Lv, Z.C.; Yang, Q.S.; Sheng, O.; et al. Transcriptome profiling of resistant and susceptible Cavendish banana roots following inoculation with Fusarium oxysporum f. sp. cubense tropical race 4. BMC Genom. 2012, 13, 374. [Google Scholar]
- Wei, X.; Zhang, Y.; Zhao, Y.; Xie, Z.; Hossain, M.R.; Yang, S.; Shi, G.; Lv, Y.; Wang, Z.; Tian, B.; et al. Root transcriptome and metabolome profiling reveal key phytohormone-related genes and pathways involved Clubroot resistance in Brassica rapa L. Front. Plant Sci. 2021, 12, 759623. [Google Scholar] [CrossRef]
- Zhong, Y.; Cheng, C.Z.; Jiang, N.H.; Jiang, B.; Zhang, Y.Y.; Wu, B.; Hu, M.L.; Zeng, J.W.; Yan, H.X.; Yi, G.J.; et al. Comparative transcriptome and iTRAQ proteome analyses of citrus root responses to Candidatus Liberibacter asiaticus Infection. PLoS ONE 2015, 10, e126973. [Google Scholar] [CrossRef]
- Li, J.; Cheng, C.Z.; Zhang, Y.Y.; Zhong, Y.; Zhong, G.Y.; Lu, Z.M. Construction of over-expression vectors for RIN4 gene from Ctirus and Arabidopsis and their transformation into Shatianyou pummelo (Citrus grandis (L.) Osbeck). J. Southwest Univ. (Nat. Sci. Ed.) 2015, 37, 16–21. (In Chinese) [Google Scholar]
- Bové, J.M. Huanglongbing: A destructive, newly-emerging, century-old disease of citrus. J. Plant Pathol. 2006, 88, 7–37. [Google Scholar]
- Wang, N.; Trivedi, P. Citrus huanglongbing: A newly relevant disease presents unprecedented challenges. Phytopathology 2013, 103, 652–665. [Google Scholar] [CrossRef]
- Duan, Y.P.; Gottwald, T.; Zhou, L.J.; Gabriel, D.W. First report of dodder transmission of ‘Candidatus Liberibacter asiaticus’ to tomato (Lycopersicon esculentum). Plant Dis. 2008, 92, 831. [Google Scholar] [CrossRef]
- Wu, H.; Acanda, Y.; Shankar, A.; Peeples, M.E.; Hubbard, C.; Orbovj, V.; Zale, J.M. Genetic transformation of commercially important mature citrus scions. Crop Sci. 2015, 55, 2786–2797. [Google Scholar] [CrossRef]
- Hao, G.; Pitino, M.; Duan, Y.; Stover, E. Reduced susceptibility to Xanthomonas citri in transgenic citrus expressing the fls2 receptor from Nicotiana benthamiana. Mol. Plant-Microbe Interact. 2016, 29, 132–142. [Google Scholar] [CrossRef] [PubMed]
- Hao, G.; Stover, E.; Gupta, G. Overexpression of a modified plant thionin enhances disease resistance to citrus canker and Huanglongbing (HLB). Front. Plant Sci. 2016, 7, 1078. [Google Scholar] [CrossRef] [PubMed]
- Dalio, R.; Magalhaes, D.M.; Rodrigues, C.M.; Arena, G.D.; Oliveira, T.S.; Souza-Neto, R.R.; Picchi, S.C.; Martins, P.; Santos, P.; Maximo, H.J.; et al. PAMPs, PRRs, effectors and R-genes associated with citrus-pathogen interactions. Ann. Bot. 2017, 119, 749–774. [Google Scholar]
- Kobayashi, A.K.; Luiz, G.E.V.; JoÃ, O.C.B.F.; Rui, P.L.J.; Luiz, F.P.P.; Hugo, B.C.M.; Viviani, V.M. Enhanced resistance to citrus canker in transgenic sweet orange expressing the sarcotoxin IA gene. Eur. J. Plant Pathol. 2017, 149, 865–873. [Google Scholar] [CrossRef]
- Ma, W.; Pang, Z.; Huang, X.; Xu, J.; Pandey, S.S.; Li, J.; Achor, D.S.; Vasconcelos, F.; Hendrich, C.; Huang, Y.; et al. Citrus Huanglongbing is a pathogen-triggered immune disease that can be mitigated with antioxidants and gibberellin. Nat. Commun. 2022, 13, 529. [Google Scholar] [CrossRef]
- Duan, Y.; Zhou, L.; Hall, D.G.; Li, W.; Doddapaneni, H.; Lin, H.; Liu, L.; Vahling, C.M.; Gabriel, D.W.; Williams, K.P.; et al. Complete genome sequence of citrus huanglongbing bacterium, ‘Candidatus Liberibacter asiaticus’ obtained through metagenomics. Mol. Plant Microbe Interact. 2009, 22, 1011–1020. [Google Scholar] [CrossRef]
- Sagaram, U.S.; DeAngelis, K.M.; Trivedi, P.; Andersen, G.L.; Lu, S.E.; Wang, N. Bacterial diversity analysis of Huanglongbing pathogen-infected citrus, using PhyloChip arrays and 16S rRNA gene clone library sequencing. Appl. Environ. Microbiol. 2009, 75, 1566–1574. [Google Scholar] [CrossRef]
- Withers, J.; Dong, X. Post-translational regulation of plant immunity. Curr. Opin. Plant Biol. 2017, 38, 124–132. [Google Scholar] [CrossRef]
- Zhao, G.; Guo, D.; Wang, L.; Li, H.; Wang, C.; Guo, X. Functions of RPM1-interacting protein 4 in plant immunity. Planta 2021, 253, 11. [Google Scholar] [CrossRef]
- Liu, J.; Elmore, J.M.; Lin, Z.J.; Coaker, G. A receptor-like cytoplasmic kinase phosphorylates the host target RIN4, leading to the activation of a plant innate immune receptor. Cell Host Microbe 2011, 9, 137–146. [Google Scholar] [CrossRef] [PubMed]
- Chung, E.H.; da Cunha, L.; Wu, A.J.; Gao, Z.; Cherkis, K.; Afzal, A.J.; Mackey, D.; Dangl, J.L. Specific threonine phosphorylation of a host target by two unrelated type III effectors activates a host innate immune receptor in plants. Cell Host Microbe 2011, 9, 125–136. [Google Scholar] [CrossRef] [PubMed]
- Feng, B.; Liu, C.; Shan, L.; He, P. Protein ADP-ribosylation takes control in plant-bacterium interactions. PLoS Pathog. 2016, 12, e1005941. [Google Scholar] [CrossRef] [PubMed]
- Redditt, T.J.; Chung, E.H.; Karimi, H.Z.; Rodibaugh, N.; Zhang, Y.; Trinidad, J.C.; Kim, J.H.; Zhou, Q.; Shen, M.; Dangl, J.L.; et al. AvrRpm1 functions as an ADP-ribosyl transferase to modify NOI domain-containing proteins, including Arabidopsis and Soybean RPM1-interacting protein 4. Plant Cell 2019, 31, 2664–2681. [Google Scholar] [CrossRef] [PubMed]
- Lee, D.; Bourdais, G.; Yu, G.; Robatzek, S.; Coaker, G. Phosphorylation of the plant immune regulator RPM1-interacting protein 4 enhances plant plasma mem-brane H(+)-ATPase activity and inhibits flagellin-triggered immune responses in Arabidopsis. Plant Cell 2015, 27, 2042–2056. [Google Scholar] [CrossRef]
- Nehela, Y.; Hijaz, F.; Elzaawely, A.A.; El-Zahaby, H.M.; Killiny, N. Citrus phytohormonal response to Candidatus Liberibacter asiaticus and its vector Diaphorina citri. Physiol. Mol. Plant Pathol. 2018, 102, 24–35. [Google Scholar] [CrossRef]
- Ramamoorthy, R.; Jiang, S.Y.; Kumar, N.; Venkatesh, P.N.; Ramachandran, S. A comprehensive transcriptional profiling of the WRKY gene family in rice under various abiotic and phytohormone treatments. Plant Cell Physiol. 2008, 49, 865–879. [Google Scholar] [CrossRef]
- Cheng, C.Z.; Yang, J.W.; Yan, H.B.; Bei, X.J.; Zhang, Y.Y.; Lu, Z.M.; Zhong, G.Y. Expressing p20 hairpin RNA of Citrus tristeza virus confers Citrus aurantium with tolerance/resistance against stem pitting and seedling yellow CTV strains. J. Integr. Agric. 2015, 14, 1767–1777. [Google Scholar] [CrossRef]
- Zhang, Y.; Zhang, D.; Zhong, Y.; Chang, X.; Hu, M.; Cheng, C. A simple and efficient in planta transformation method for pommelo (Citrus maxima) using Agrobacterium tumefaciens. Sci. Hortic. Amsterdam 2017, 214, 174–179. [Google Scholar] [CrossRef]
- Bai, Y.; Yang, Q.; Kang, J.; Sun, Y.; Gruber, M.; Chao, Y. Isolation and functional characterization of a Medicago sativa L. gene, MsLEA3-1. Mol. Biol. Rep. 2012, 39, 2883–2892. [Google Scholar] [CrossRef][Green Version]
- Cheng, C.Z.; Zhang, Y.Y.; Yang, J.W.; Zhong, Y. Expression of hairpin RNA (hpRNA) targeting the three CTV-silencing suppressor genes confers sweet orange with stem-pitting CTV tolerance. J. Hortic. Sci. Biotechnol. 2017, 92, 465–474. [Google Scholar] [CrossRef]
- Li, W.; Hartung, J.S.; Levy, L. Quantitative real-time PCR for detection and identification of Candidatus Liberibacter species associated with citrus huanglongbing. J. Microbiol. Methods 2006, 66, 104–115. [Google Scholar] [CrossRef] [PubMed]






| Primer | Primer Sequence (5′→3′) | Application | Digestion Site |
|---|---|---|---|
| RIN4F | ttGGCGCGCCATGGCACAACGTTCACATGTAC | Overexpression vector construction | AscI |
| RIN4R | tccCCCGGGTTATTTCTTGCCCCAAGGAC | Overexpression vector construction | SmaI |
| RIN4SF | ctagTCTAGAgATGGCACAACGTTCACATGTAC | Subcellular localization vector construction | XbaI |
| RIN4SR | ctagTCTAGAgTTTCTTGCCCCAAGGAC | Subcellular localization vector construction | BamHI |
| RIN4rF | CAGTCTTGAACGCTCCCCTA | qRT-PCR | - |
| RIN4rR | TCGACTCTTGGATTTGGCCT | qRT-PCR | - |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cheng, C.; Zhong, Y.; Wang, B.; Zhang, Y.; Wu, H.; Jiang, N.; Wu, B.; Lv, Y.; Jiang, B. The Upregulated Expression of the Citrus RIN4 Gene in HLB Diseased Citrus Aids Candidatus Liberibacter Asiaticus Infection. Int. J. Mol. Sci. 2022, 23, 6971. https://doi.org/10.3390/ijms23136971
Cheng C, Zhong Y, Wang B, Zhang Y, Wu H, Jiang N, Wu B, Lv Y, Jiang B. The Upregulated Expression of the Citrus RIN4 Gene in HLB Diseased Citrus Aids Candidatus Liberibacter Asiaticus Infection. International Journal of Molecular Sciences. 2022; 23(13):6971. https://doi.org/10.3390/ijms23136971
Chicago/Turabian StyleCheng, Chunzhen, Yun Zhong, Bin Wang, Yongyan Zhang, Huan Wu, Nonghui Jiang, Bo Wu, Yuanda Lv, and Bo Jiang. 2022. "The Upregulated Expression of the Citrus RIN4 Gene in HLB Diseased Citrus Aids Candidatus Liberibacter Asiaticus Infection" International Journal of Molecular Sciences 23, no. 13: 6971. https://doi.org/10.3390/ijms23136971
APA StyleCheng, C., Zhong, Y., Wang, B., Zhang, Y., Wu, H., Jiang, N., Wu, B., Lv, Y., & Jiang, B. (2022). The Upregulated Expression of the Citrus RIN4 Gene in HLB Diseased Citrus Aids Candidatus Liberibacter Asiaticus Infection. International Journal of Molecular Sciences, 23(13), 6971. https://doi.org/10.3390/ijms23136971

