Possible Role of Circulating Bone Marrow Mesenchymal Progenitors in Modulating Inflammation and Promoting Wound Repair
Abstract
:1. Introduction
2. Results
2.1. Isolation, Culture, and Characterisation of Bone Marrow Mesenchymal Progenitor Cells
2.2. Effects of Scratch Injury Assay, and Supplementation of Tnfα, HGF, and BMMPs on Gene Expression in the Skin Equivalent Model
2.3. Protein Secretion
3. Discussion
4. Materials and Methods
4.1. Isolation, Culture and Viability Assay of Circluating Bone Marrow Mesenchymal Progenitors
4.2. Flow Cytometry Analysis of the Circulating Bone Marrow Mesenchymal Progenitors
4.3. Differentiation of the BMMPS into Osteocytes, Chondrocytes, and Adipocytes
4.4. The In Vitro Experimental Model of Wound Healing
4.5. RNA Extraction and qPCR
4.6. Enzyme-Linked Immunosorbent Assay
4.7. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
References
- Mori, L.; Bellini, A.; Stacey, M.A. Fibrocytes contribute to the myofibroblast population in wounded skin and originate from the bone-marrow. Exp. Cell Res. 2005, 304, 81–90. [Google Scholar] [CrossRef] [PubMed]
- Gang, H.; Peng, L.; Jie, F.; Yan, J. A Novel Population of Mesenchymal Progenitors with Hematopoietic Potential Originated from CD14-Peripheral Blood Mononuclear Cells. Int. J. Med. Sci. 2011, 8, 16–29. [Google Scholar] [CrossRef] [Green Version]
- Ronald, A.; Reilkoff, R.B.; Erica, L. Herzog Fibrocytes: Emerging effector cells in chronic inflammation. Nat. Rev. Immunol. 2011, 11, 427–435. [Google Scholar]
- Metz, C.N. Fibrocytes: A unique cell population implicated in wound healing CMLS. Cell. Mol. Life Sci. 2003, 60, 1342–1350. [Google Scholar] [CrossRef] [PubMed]
- Chesney, J.; Metz, C.; Stavitsky, A.B.; Bacher, M.; Bucala, R. Regulated production of type I collagen and inflamma-tory cytokines by peripheral blood fibrocytes. J. Immunol. 1998, 160, 419–425. [Google Scholar]
- Hartlapp, I.; Abe, R.; Saeed, R.W.; Peng, T.; Voelter, W.; Bucala, R.; Metz, C.N. Fibrocytes induce an angiogenic phenotype in cultured endothelial cells and promote angiogenesis in vivo. FASEB J. 2001, 15, 2215–2224. [Google Scholar] [CrossRef] [Green Version]
- Schmidt, M.; Sun, G.; Stacey, M.A. Identification of circulating fibrocytes as precursors of bronchial myofibroblasts in asthma. J. Immunol. 2003, 171, 380–389. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abe, R.; Donnelly, S.C.; Peng, T. Peripheral blood fibrocytes: Differentiation pathway and migration to wound sites. J. Immunol. 2001, 166, 7556–7562. [Google Scholar] [CrossRef] [Green Version]
- Quan, T.E.; Cowper, S.; Wu, S.P. Circulating fibrocytes: Collagen-secreting cells of the peripheral blood. Int. J. Biochem. Cell Biol. 2004, 36, 598–606. [Google Scholar] [CrossRef] [PubMed]
- Grieb, G.; Steffens, G.; Pallua, N.; Bernhagen, J.; Bucala, R. Circulating fibrocytes--biology and mechanisms in wound healing and scar formation. Int. Rev. Cell Mol. Biol. 2011, 291, 1–19. [Google Scholar] [PubMed]
- Hu, M.S.; Borrelli, M.R.; Lorenz, H.P.; Longaker, M.T.; Wan, D.C. Mesenchymal Stromal Cells and Cutaneous Wound Healing: A Comprehensive Review of the Background, Role, and Therapeutic Potential. Stem Cells Int. 2018, 2018, 6901983. [Google Scholar] [CrossRef] [Green Version]
- Jiang, W.; Xu, J. Immune modulation by mesenchymal stem cells. Cell Prolif. 2020, 53, e12712. [Google Scholar] [CrossRef]
- Bernardo, M.E.; Fibbe, W.E. Mesenchymal stromal cells: Sensors and switchers of inflammation. Cell Stem Cell 2013, 13, 392–402. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Waterman, R.S.; Tomchuck, S.L.; Henkle, S.L.; Betancourt, A.M. A new mesenchymal stem cell (BMMPS) paradigm: Polarization into a pro-inflammatory BMMPS1 or an Immunosuppressive BMMPS2 phenotype. PLoS ONE 2010, 5, e10088. [Google Scholar] [CrossRef] [PubMed]
- Le Blanc, K.; Mougiakakos, D. Multipotent mesenchymal stromal cells and the innate immune system. Nat. Rev. Immunol. 2012, 12, 383–396. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.H.; Jin, S.Y.; Song, J.S.; Seo, K.K.; Cho, K.H. Paracrine effects of adipose-derived stem cells on keratinocytes and dermal fibroblasts. Ann. Dermatol. 2012, 24, 136–143. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Seria, E.; Galea, G.; Borg, J.; Schembri, K.; Grech, G.; Tagliaferro, S.S.; Felice, A. Novel leukocyte-depleted platelet-rich plasma-based skin equivalent as an in vitro model of chronic wounds: A preliminary study. BMC Mol. Cell Biol. 2021, 22, 1–13. [Google Scholar] [CrossRef]
- Vassalli, P. The pathophysiology of tumor necrosis factors. Annu. Rev. Immunol. 1992, 10, 411–452. [Google Scholar] [CrossRef] [PubMed]
- Nakamura, T.; Mizuno, S. The discovery of Hepatocyte Growth Factor (HGF) and its significance for cell biology, life sciences and clinical medicine. Proc. Jpn. Acad. Ser. B 2010, 86, 588–610. [Google Scholar] [CrossRef] [Green Version]
- Park, J.; Jeon, H.; Kim, T.Y.; Lee, K.; Park, K.; Lee, E.S.; Choi, J.; Park, C.; Jeon, S. Comparative analysis of mesenchymal stem cell surface marker expression for human dental mesenchymal stem cells. Regen. Med. 2013, 8, 453–466. [Google Scholar] [CrossRef]
- Enoch, S.; Grey, J.E.; Harding, K.G. Recent advances and emerging treatments. BMJ 2006, 332, 962–965. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, X.; Hamza, M.; Wu, T.; Dionne, R. Upregulation of IL-6, IL-8 and CCL2 gene expression after acute inflammation: Correlation to clinical pain. Pain 2009, 142, 275–283. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gragnani, A.; Müller, B.; Silva, I.; Noronha, S.; Ferreira, L. Keratinocyte growth factor, tumor necrosis factor-alpha and interleukin-1 beta gene expression in cultured fibroblasts and keratinocytes from burned patients. Acta Cir. Bras. 2013, 28, 551–558. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xu, F.; Zhang, C.; Graves, D. Abnormal Cell Responses and Role of TNF-αin Impaired Diabetic Wound Healing. BioMed Res. Int. 2013, 2013, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Ritsu, M.; Kawakami, K.; Kanno, E.; Tanno, H.; Ishii, K.; Imai, Y.; Maruyama, R.; Tachi, M. Critical role of tumor necrosis factor-α in the early process of wound healing in skin. J. Dermatol. Dermatol. Surg. 2017, 21, 14–19. [Google Scholar] [CrossRef] [Green Version]
- Spiekstra, S.; Breetveld, M.; Rustemeyer, T.; Scheper, R.; Gibbs, S. Wound-healing factors secreted by epidermal keratinocytes and dermal fibroblasts in skin substitutes. Wound Repair Regen. 2007, 15, 708–717. [Google Scholar] [CrossRef] [PubMed]
- Martins-Green, M.; Petreaca, M.; Wang, L. Chemokines and Their Receptors Are Key Players in the Orchestra That Regulates Wound Healing. Adv. Wound Care 2013, 2, 327–347. [Google Scholar] [CrossRef] [Green Version]
- Pradhan, L.; Cai, X.; Wu, S.; Andersen, N.; Martin, M.; Malek, J.; Guthrie, P.; Veves, A.; LoGerfo, F. Gene Expression of Pro-Inflammatory Cytokines and Neuropeptides in Diabetic Wound Healing. J. Surg. Res. 2011, 167, 336–342. [Google Scholar] [CrossRef] [Green Version]
- Chen, L.; DiPietro, L. Toll-Like Receptor Function in Acute Wounds. Adv. Wound Care 2017, 6, 344–355. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zaja-Milatovic, S.; Richmond, A. CXC chemo-kines and their receptors: A case for a significant biological role in cutaneous wound healing. Histol. Histopathol. 2008, 23, 1399. [Google Scholar] [PubMed]
- Behm, B.; Babilas, P.; Landthaler, M.; Schreml, S. Cytokines, chemokines and growth factors in wound healing. J. Eur. Acad. Derm. Venereol. 2012, 26, 812. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; Wang, D.R.; Cao, Y.L. TGF-beta: A fibrotic factor in wound scarring and a potential target for anti-scarring gene therapy. Curr. Gene Ther. 2004, 4, 123–136. [Google Scholar] [CrossRef]
- Yang, L.; Scott, P.G.; Dodd, C.; Medina, A.; Jiao, H.; Shankowsky, H.A. Identification of fibrocytes in postburn hypertrophic scar. Wound Repair Regen. 2005, 13, 398–404. [Google Scholar] [CrossRef]
- Wang, J.; Jiao, H.; Stewart, T.L.; Shankowsky, H.A.; Scott, P.G.; Tredget, E.E. Fibrocytes from burn patients regulate the activity of fibroblasts. Wound Repair Regen. 2007, 15, 113–121. [Google Scholar] [CrossRef]
- Chesney, J.; Bucala, R. Peripheral blood fibrocytes: Novel fibroblast-like cells that present antigen and mediate tissue repair. Biochem. Soc. Trans. 1997, 25, 520–524. [Google Scholar] [CrossRef] [PubMed]
- Thul, P. A Subcellular Map of the Human Proteome. Science 2017, 356. [Google Scholar] [CrossRef] [PubMed]
- Picher, M.; Lauranell, H.B.; Andrew, J.H.; Spychala, J.; Richard, C.B. Ecto 5’-Nucleotidase and Nonspecific Alkaline Phosphatase. Two AMP-Hydrolyzing Ectoenzymes with Distinct Roles in Human Airways. J. Biol. Chem. 2003, 278, 13468–13479. [Google Scholar] [CrossRef] [Green Version]
- Ehrentraut, H.; Eric, T. CD73+Regulatory T Cells Contribute to Adenosine-Mediated Resolution of Acute Lung Injury. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 2013, 27, 2207–2219. [Google Scholar] [CrossRef] [Green Version]
- Tobias, E.; Füllbier, L.; Wehrmann, M.; Khoury, J.; Mittelbronn, M.; Ibla, J.; Rosenberger, P. Identification of Ectonucleotidases CD39 and CD73 in Innate Protection during Acute Lung Injury. J. Immunol. 2007, 178, 8127–8137. [Google Scholar] [CrossRef]
- Majid, K.; Soleimani, M.; Cronstein, B.N. Adenosine A2A Receptors Play an Active Role in Mouse Bone-marrow-Derived Mesenchymal Stem Cell Development. J. Leukoc. Biol. 2009, 85, 438–444. [Google Scholar] [CrossRef] [Green Version]
- Xu, S.; Zhu, W.; Shao, M.; Zhang, F.; Guo, J.; Xu, H.; Jiang, J.; Ma, X.; Xia, X.; Zhi, X.; et al. Ecto-5′-nucleotidase (CD73) attenuates inflammation after spinal cord injury by promoting macrophages/microglia M2 polarization in mice. J. Neuroinflamm. 2018, 15, 155. [Google Scholar] [CrossRef] [Green Version]
- Haynesworth, S.E.; Baber, M.A.; Caplan, A.I. Cytokine expression by human marrow-derived mesenchymal progenitor cells in vitro: Effects of dexamethasone and IL-1 alpha. J. Cell. Physiol. 1996, 166, 585–592. [Google Scholar] [CrossRef]
- Couper, K.N.; Blount, D.G.; Riley, E.M. IL-10: The master regulator of immunity to infection. J. Immunol. 2008, 180, 5771–5777. [Google Scholar] [CrossRef] [PubMed]
- Di Nicola, M.; Carlo-Stella, C.; Magni, M.; Milanesi, M.; Longoni, P.D.; Matteucci, P.; Grisanti, S.; Gianni, A.M. Human bone-marrow stromal cells suppress T-lymphocyte proliferation induced by cellular or nonspecific mitogenic stimuli. Blood 2002, 99, 3838–3843. [Google Scholar] [CrossRef]
- Patel, S.A.; Meyer, J.R.; Greco, S.J.; Corcoran, K.E.; Bryan, M.; Rameshwar, P. Mesenchymal stem cells protect breast cancer cells through regulatory T cells: Role of mesenchymal stem cell-derived TGF-beta. J. Immunol. 2010, 184, 5885–5894. [Google Scholar] [CrossRef]
- Conway, K.; Price, P.; Harding, K.G.; Jiang, W.G. The molecular and clinical impact of hepatocyte growth factor, its receptor, activators, and inhibitors in wound healing. Wound Repair Regen. 2006, 14, 2–10. [Google Scholar] [CrossRef] [PubMed]
- Wilson, S.E.; Walker, J.W.; Chwang, E.L.; He, Y.G. Hepatocyte growth factor, keratinocyte growth factor, their receptors, fibroblast growth factor recep-tor-2, and the cells of the cornea. Invest. Ophthalmol. Vis. Sci. 1993, 34, 2544–2561. [Google Scholar]
- Montesano, R.; Matsumoto, K.; Nakamura, T.; Orci, L. Identification of a fibroblast-derived epithelial morphogen as hepatocyte growth factor. Cell 1991, 67, 901–908. [Google Scholar] [CrossRef]
- Omoto, M.; Suri, K.; Amouzegar, A.; Li, M.; Katikireddy, K.R.; Mitta, S.K.; Chauhan, S.K. Hepatocyte Growth Factor Suppresses Inflammation and Promotes Epithelium Repair in Corneal Injury Molecular Therapy. Am. Soc. Gene Cell Ther. 2017, 25, 1881–1888. [Google Scholar] [CrossRef] [Green Version]
Gene | Condition and Day | Adjusted p-Value | Gene | Condition and Day | Adjusted p-Value |
---|---|---|---|---|---|
IL-8 | scratch + HGF + BMMPs:3-scratch + BMMPs:3 | 1.144 × 10−11 | CD73 | scratch + TNFα + BMMPs:5-scratch + TNFα:5 | 4.796 × 10−14 |
IL-8 | scratch + HGF + BMMPs:3-HGF:3 | 5.007 × 10−10 | CD73 | scratch + TNFα + BMMPs:1-scratch + TNFα:1 | 2.999 × 10−13 |
IL-8 | scratch + HGF + BMMPs:5-HGF:5 | 5.065 × 10−10 | CD73 | scratch + HGF + BMMPs:1-scratch + BMMPs:1 | 1.030 × 10−12 |
IL-8 | scratch + HGF + BMMPs:5-scratch:5 | 1.177 × 10−7 | CD73 | scratch:3-HGF:3 | 1.505 × 10−11 |
IL-8 | scratch + HGF + BMMPs:3-scratch:3 | 3.034 × 10−7 | CD73 | scratch + HGF:3-scratch:3 | 1.995 × 10−11 |
IL-8 | scratch + HGF + BMMPs:1-HGF:1 | 3.849 × 10−7 | CD73 | scratch + HGF:1-HGF:1 | 8.371 × 10−11 |
IL-8 | scratch + HGF + BMMPs:1-scratch:1 | 1.220 × 10−6 | CD73 | scratch + TNFα:1-scratch:1 | 9.267 × 10−10 |
IL-8 | scratch + HGF:3-scratch:3 | 0.000 | CD73 | scratch + HGF + BMMPs:1-scratch + HGF:1 | 7.003 × 10−9 |
IL-8 | scratch + HGF:5-scratch:5 | 0.000 | CD73 | scratch + HGF + BMMPs:3-scratch + HGF:3 | 2.312 × 10−6 |
IL-8 | scratch + HGF:1-scratch:1 | 0.013 | CD73 | scratch + TNFα + BMMPs:5-scratch:5 | 8.096 × 10−5 |
IL-8 | scratch + HGF:5-HGF:5 | 0.030 | CD73 | scratch + BMMPs:5-scratch:5 | 0.000 |
IL-8 | scratch + TNFα + BMMPs:5-scratch:5 | 0.032 | CD73 | scratch + TNFα:5-scratch:5 | 0.001 |
IL-8 | scratch + HGF:1-HGF:1 | 0.033 | CD73 | scratch + TNFα:1-TNFα:1 | 0.002 |
IL-8 | scratch + TNFα + BMMPs:3-scratch:3 | 0.0425 | CD73 | scratch + TNFα + BMMPs:1-scratch + BMMPs:1 | 0.004 |
IL-8 | scratch + TNFα + BMMPs:1-TNFα:1 | 0.044 | CD73 | scratch + HGF + BMMPs:1-scratch:1 | 0.006 |
Protein | Condition and Day | Adj. p-Value |
---|---|---|
IL-8 | scratch + TNFα + BMMPs:1-control:1 | 4.37 × 10−13 |
IL-8 | scratch+HGF + BMMPs:1-scratch:1 | 4.37 × 10−13 |
IL-8 | scratch + TNFα:3-control:3 | 4.37 × 10−13 |
IL-8 | scratch + TNFα + BMMPs:3-control:3 | 4.37 × 10−13 |
IL-8 | scratch + HGF + BMMPs:3-scratch + HGF:3 | 0.003 |
IL-8 | scratch + HGF + BMMPs:5-scratch + BMMPs:5 | 0.000 |
IL-8 | scratch + BMMPs:5-scratch:5 | 0.000 |
FGF-1 | scratch + HGF + BMMPs:1-scratch + BMMPs:1 | 4.67 × 10−13 |
FGF-1 | scratch + TNFα+BMMPs:1-scratch + BMMPs:1 | 5.18 × 10−13 |
FGF-1 | scratch + BMMPs:1-control:1 | 8.21 × 10−11 |
FGF-1 | scratch + TNFα + BMMPs:5-TNFα:5 | 0.000 |
FGF-1 | scratch + TNFα + BMMPs:3-TNFα:3 | 0.001 |
SCF | scratch + BMMPs:1-control:1 | 4.37 × 10−13 |
SCF | scratch + HGF + BMMPs:1-control:1 | 4.37 × 10−13 |
SCF | scratch + HGF + BMMPs:3-scratch + HGF:3 | 4.37 × 10−13 |
SCF | scratch + TNFα + BMMPs:3-scratch:3 | 4.37 × 10−13 |
SCF | scratch + HGF + BMMPs:3-HGF:3 | 4.37 × 10−13 |
SCF | scratch + HGF + BMMPs:5-control:5 | 4.37 × 10−13 |
SCF | scratch + HGF + BMMPs:5-scratch:5 | 4.37 × 10−13 |
SCF | scratch + HGF + BMMPs:5-scratch + BMMPs:5 | 4.37 × 10−13 |
SCF | scratch + TNFα + BMMPs:5-scratch + TNFα:5 | 4.37 × 10−13 |
SCF | scratch + HGF + BMMPs:3-scratch + BMMPs:3 | 4.38 × 10−13 |
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Fragment Size |
---|---|---|---|
CD34 | TGAAGCCTAGCCTGTCAC | ATAAGACCTCCAGCTGTGCG | 180 bp |
CD45 | GTGTTTCATCAGTACAGACG | GCTGTCATTTCAACCACAAC | 191 bp |
CD29 | GGATTCTCCAGAAGGTGGTTTCG | GGAGATGGGAAACTTGGTGGCA | 121 bp |
CD105 | GGGGTCAACACCACAGAG | CACATCCTGAGGGTCCTG | 261 bp |
CD73 | GGATTCTCCAGAAGGTGGTTTCG | CATCGCTCAGAAAGTGAGG | 310 bp |
IL-8 | GAGAGTGATTGAGAGTGGACCAC | AAACTGGGTGCAGAGGGTTGTG | 90 bp |
ACTB | AGTCCTAGCTACTCCGGAGGC | CGGCTATTCTCGCAGCTCAC | 113 bp |
Condition | Day | Condition:Day | |
---|---|---|---|
IL-8 | F(8) = 544.06; p-value < 2 × 10−16 | F(2) = 107.29; p-value < 2 × 10−16 | F(16,54) = 21.31; p-value < 2 × 10−16 |
FGF-1 | F(8) = 21.06; p-value = 4.55 × 10−14 | F(2) = 85.82; p-value < 2 × 10−16 | F(16,54) = 10.86; p-value = 1.17 × 10−11 |
SCF | F(8) = 2658.3; p-value < 2 × 10−16 | F(2)= 1682.7; p-value < 2 × 10−16 | F(16.54)= 863.1; p-value < 2 × 10−16 |
Condition | Day | Condition:Day | |
---|---|---|---|
CD73 | F(7) = 219.7; p-value < 2 × 10−16 | F(2) = 752.8; p-value < 2 × 10−16 | F(14,48) = 397.0; p-value < 2 × 10−16 |
IL-8 | F(7) = 93.248; p-value < 2 × 10−16 | F(2) = 3135.047; p-value < 2 × 10−16 | F(14,48) = 0.769; p-value = 0.696 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Grech, L.; Ebejer, J.-P.; Mazzitelli, O.; Schembri, K.; Borg, J.; Seria, E. Possible Role of Circulating Bone Marrow Mesenchymal Progenitors in Modulating Inflammation and Promoting Wound Repair. Int. J. Mol. Sci. 2022, 23, 78. https://doi.org/10.3390/ijms23010078
Grech L, Ebejer J-P, Mazzitelli O, Schembri K, Borg J, Seria E. Possible Role of Circulating Bone Marrow Mesenchymal Progenitors in Modulating Inflammation and Promoting Wound Repair. International Journal of Molecular Sciences. 2022; 23(1):78. https://doi.org/10.3390/ijms23010078
Chicago/Turabian StyleGrech, Laura, Jean-Paul Ebejer, Oriana Mazzitelli, Kevin Schembri, Joseph Borg, and Elisa Seria. 2022. "Possible Role of Circulating Bone Marrow Mesenchymal Progenitors in Modulating Inflammation and Promoting Wound Repair" International Journal of Molecular Sciences 23, no. 1: 78. https://doi.org/10.3390/ijms23010078
APA StyleGrech, L., Ebejer, J.-P., Mazzitelli, O., Schembri, K., Borg, J., & Seria, E. (2022). Possible Role of Circulating Bone Marrow Mesenchymal Progenitors in Modulating Inflammation and Promoting Wound Repair. International Journal of Molecular Sciences, 23(1), 78. https://doi.org/10.3390/ijms23010078