Artificial Intelligence in Aptamer–Target Binding Prediction
Abstract
:1. Introduction
2. Aptamer Affinity Prediction through Structural Information
2.1. Secondary Structure Prediction for Aptamers
2.2. 3D Structure Prediction for Aptamers
2.2.1. Structure Prediction for RNA Aptamers
2.2.2. Structure Prediction for DNA Aptamers
2.3. Docking
2.4. Molecular Dynamics (MD)
2.5. Structure Prediction of G-Quadruplex (G4) Aptamers
3. Aptamer Affinity Prediction through Machine/Deep Learning
3.1. Machine Learning in Aptamer Prediction
3.1.1. Sequence-Based Clustering
3.1.2. Structure-Based Clustering
3.1.3. Feature-Based Machine Learning
3.2. Deep Learning in Aptamer Prediction
4. Perspectives
4.1. Machine/Deep Learning in Aptamer 2D Structure Prediction
4.2. Machine/Deep Learning in Aptamer 3D Structure Prediction
4.3. Improvement and Potential of Machine/Deep Learning in Aptamer Prediction
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Tuerk, C.; Gold, L. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 1990, 249, 505–510. [Google Scholar] [CrossRef] [PubMed]
- Ellington, A.D.; Szostak, J.W. In vitro selection of RNA molecules that bind specific ligands. Nature 1990, 346, 818–822. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.; Rossi, J. Aptamers as targeted therapeutics: Current potential and challenges. Nat. Rev. Drug Discov. 2017, 16, 181–202. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- He, J.; Wang, J.; Zhang, N.; Shen, L.; Wang, L.; Xiao, X.; Wang, Y.; Bing, T.; Liu, X.; Li, S.; et al. In vitro selection of DNA aptamers recognizing drug-resistant ovarian cancer by cell-SELEX. Talanta 2019, 194, 437–445. [Google Scholar] [CrossRef] [PubMed]
- Ferreira, C.S.M.; Missailidis, S. Aptamer-based Therapeutics and their Potential in Radiopharmaceutical Design. Braz. Arch. Biol. Technol. 2007, 50, 14. [Google Scholar] [CrossRef]
- Mascini, M. Aptamers and their applications. Anal. Bioanal. Chem. 2008, 390, 987–988. [Google Scholar] [CrossRef]
- Ning, Y.; Hu, J.; Lu, F. Aptamers used for biosensors and targeted therapy. Biomed. Pharmacother. 2020, 132, 110902. [Google Scholar] [CrossRef] [PubMed]
- Yu, Y.; Liang, C.; Lv, Q.; Li, D.; Xu, X.; Liu, B.; Lu, A.; Zhang, G. Molecular Selection, Modification and Development of Therapeutic Oligonucleotide Aptamers. Int. J. Mol. Sci. 2016, 17, 358. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kong, H.Y.; Byun, J. Nucleic Acid aptamers: New methods for selection, stabilization, and application in biomedical science. Biomol. Ther. 2013, 21, 423–434. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kinghorn, A.B.; Fraser, L.A.; Lang, S.; Shiu, S.C.C.; Tanner, J.A. Aptamer Bioinformatics. Int. J. Mol. Sci. 2017, 18, 2516. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Buglak, A.A.; Samokhvalov, A.V.; Zherdev, A.V.; Dzantiev, B.B. Methods and Applications of In Silico Aptamer Design and Modeling. Int. J. Mol. Sci. 2020, 21, 8420. [Google Scholar] [CrossRef]
- Chushak, Y.; Stone, M.O. In silico selection of RNA aptamers. Nucleic Acids Res. 2009, 37, e87. [Google Scholar] [CrossRef] [Green Version]
- Hofacker, I.L. Vienna RNA secondary structure server. Nucleic Acids Res. 2003, 31, 3429–3431. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ahirwar, R.; Nahar, S.; Aggarwal, S.; Ramachandran, S.; Maiti, S.; Nahar, P. In silico selection of an aptamer to estrogen receptor alpha using computational docking employing estrogen response elements as aptamer-alike molecules. Sci. Rep. 2016, 6, 21285. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Thafar, M.; Raies, A.B.; Albaradei, S.; Essack, M.; Bajic, V.B. Comparison Study of Computational Prediction Tools for Drug-Target Binding Affinities. Front. Chem. 2019, 7, 782. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ain, Q.U.; Aleksandrova, A.; Roessler, F.D.; Ballester, P.J. Machine-learning scoring functions to improve structure-based binding affinity prediction and virtual screening. Wiley Interdiscip. Rev. Comput. Mol. Sci. 2015, 5, 405–424. [Google Scholar] [CrossRef] [PubMed]
- Zhuo, Z.; Wan, Y.; Guan, D.; Ni, S.; Wang, L.; Zhang, Z.; Liu, J.; Liang, C.; Yu, Y.; Lu, A.; et al. A Loop-Based and AGO-Incorporated Virtual Screening Model Targeting AGO-Mediated miRNA-mRNA Interactions for Drug Discovery to Rescue Bone Phenotype in Genetically Modified Mice. Adv. Sci. 2020, 7, 1903451. [Google Scholar] [CrossRef] [PubMed]
- Sullivan, R.; Adams, M.C.; Naik, R.R.; Milam, V.T. Analyzing Secondary Structure Patterns in DNA Aptamers Identified via CompELS. Molecules 2019, 24, 1572. [Google Scholar] [CrossRef] [Green Version]
- Pagba, C.V.; Lane, S.M.; Cho, H.; Wachsmann-Hogiu, S. Direct detection of aptamer-thrombin binding via surface-enhanced Raman spectroscopy. J. Biomed. Opt. 2010, 15, 047006. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jeddi, I.; Saiz, L. Three-dimensional modeling of single stranded DNA hairpins for aptamer-based biosensors. Sci. Rep. 2017, 7, 1178. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Domin, G.; Findeiss, S.; Wachsmuth, M.; Will, S.; Stadler, P.F.; Morl, M. Applicability of a computational design approach for synthetic riboswitches. Nucleic Acids Res. 2017, 45, 4108–4119. [Google Scholar] [CrossRef] [Green Version]
- Zuker, M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 2003, 31, 3406–3415. [Google Scholar] [CrossRef]
- Heiat, M.; Najafi, A.; Ranjbar, R.; Latifi, A.M.; Rasaee, M.J. Computational approach to analyze isolated ssDNA aptamers against angiotensin II. J. Biotechnol. 2016, 230, 34–39. [Google Scholar] [CrossRef] [PubMed]
- Bellaousov, S.; Reuter, J.S.; Seetin, M.G.; Mathews, D.H. RNAstructure: Web servers for RNA secondary structure prediction and analysis. Nucleic Acids Res. 2013, 41, W471–W474. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rockey, W.M.; Hernandez, F.J.; Huang, S.Y.; Cao, S.; Howell, C.A.; Thomas, G.S.; Liu, X.Y.; Lapteva, N.; Spencer, D.M.; McNamara, J.O.; et al. Rational truncation of an RNA aptamer to prostate-specific membrane antigen using computational structural modeling. Nucleic Acid Ther. 2011, 21, 299–314. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhao, C.; Xu, X.; Chen, S.J. Predicting RNA Structure with Vfold. Methods Mol. Biol. 2017, 1654, 3–15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nguyen, P.D.M.; Zheng, J.; Gremminger, T.J.; Qiu, L.; Zhang, D.; Tuske, S.; Lange, M.J.; Griffin, P.R.; Arnold, E.; Chen, S.J.; et al. Binding interface and impact on protease cleavage for an RNA aptamer to HIV-1 reverse transcriptase. Nucleic Acids Res. 2020, 48, 2709–2722. [Google Scholar] [CrossRef] [PubMed]
- Sato, K.; Hamada, M.; Asai, K.; Mituyama, T. CENTROIDFOLD: A web server for RNA secondary structure prediction. Nucleic Acids Res. 2009, 37, W277–W280. [Google Scholar] [CrossRef] [Green Version]
- Hu, W.P.; Kumar, J.V.; Huang, C.J.; Chen, W.Y. Computational selection of RNA aptamer against angiopoietin-2 and experimental evaluation. BioMed Res. Int. 2015, 2015, 658712. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zuker, M.; Stiegler, P. Optimal computer folding of large RNA sequences using thermodynamics and auxiliary information. Nucleic Acids Res. 1981, 9, 133–148. [Google Scholar] [CrossRef] [PubMed]
- Lu, Z.J.; Gloor, J.W.; Mathews, D.H. Improved RNA secondary structure prediction by maximizing expected pair accuracy. RNA 2009, 15, 1805–1813. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ding, Y.; Lawrence, C.E. A statistical sampling algorithm for RNA secondary structure prediction. Nucleic Acids Res. 2003, 31, 7280–7301. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Duan, S.; Mathews, D.H.; Turner, D.H. Interpreting oligonucleotide microarray data to determine RNA secondary structure: Application to the 3′ end of Bombyx mori R2 RNA. Biochemistry 2006, 45, 9819–9832. [Google Scholar] [CrossRef] [PubMed]
- Bellaousov, S.; Mathews, D.H. ProbKnot: Fast prediction of RNA secondary structure including pseudoknots. RNA 2010, 16, 1870–1880. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hilder, T.A.; Hodgkiss, J.M. The Bound Structures of 17beta-Estradiol-Binding Aptamers. Eur. J. Chem. Phys. Phys. Chem. 2017, 18, 1881–1887. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.; Zhao, P.; Chen, S.J. Vfold: A web server for RNA structure and folding thermodynamics prediction. PLoS ONE 2014, 9, e107504. [Google Scholar] [CrossRef]
- Zok, T.; Antczak, M.; Zurkowski, M.; Popenda, M.; Blazewicz, J.; Adamiak, R.W.; Szachniuk, M. RNApdbee 2.0: Multifunctional tool for RNA structure annotation. Nucleic Acids Res. 2018, 46, W30–W35. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Biesiada, M.; Pachulska-Wieczorek, K.; Adamiak, R.W.; Purzycka, K.J. RNAComposer and RNA 3D structure prediction for nanotechnology. Methods 2016, 103, 120–127. [Google Scholar] [CrossRef]
- Wang, J.; Wang, J.; Huang, Y.; Xiao, Y. 3dRNA v2.0: An Updated Web Server for RNA 3D Structure Prediction. Int. J. Mol. Sci. 2019, 20, 4116. [Google Scholar] [CrossRef] [Green Version]
- Soon, S.; Nordin, N.A. In silico predictions and optimization of aptamers against Streptococcus agalactiae surface protein using computational docking. Mater. Today Proc. 2019, 16, 5. [Google Scholar] [CrossRef]
- Xu, X.; Dickey, D.D.; Chen, S.J.; Giangrande, P.H. Structural computational modeling of RNA aptamers. Methods 2016, 103, 175–179. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Boniecki, M.J.; Lach, G.; Dawson, W.K.; Tomala, K.; Lukasz, P.; Soltysinski, T.; Rother, K.M.; Bujnicki, J.M. SimRNA: A coarse-grained method for RNA folding simulations and 3D structure prediction. Nucleic Acids Res. 2016, 44, e63. [Google Scholar] [CrossRef] [PubMed]
- Cataldo, R.; Ciriaco, F.; Alfinito, E. A validation strategy for in silico generated aptamers. Comput. Biol. Chem. 2018, 77, 123–130. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, Q.L.; Cui, H.F.; Du, J.F.; Lv, Q.Y.; Song, X. In silico post-SELEX screening and experimental characterizations for acquisition of high affinity DNA aptamers against carcinoembryonic antigen. RSC Adv. 2019, 9, 7. [Google Scholar] [CrossRef] [Green Version]
- Sabri, M.Z.; Abdul Hamid, A.A.; Sayed Hitam, S.M.; Abdul Rahim, M.Z. In Silico Screening of Aptamers Configuration against Hepatitis B Surface Antigen. Adv. Bioinform. 2019, 2019, 6912914. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, J.; Fu, A.; Zhang, L. An Overview of Scoring Functions Used for Protein-Ligand Interactions in Molecular Docking. Interdiscip. Sci. Comput. Life Sci. 2019, 11, 320–328. [Google Scholar] [CrossRef] [PubMed]
- Pierce, B.G.; Wiehe, K.; Hwang, H.; Kim, B.H.; Vreven, T.; Weng, Z. ZDOCK server: Interactive docking prediction of protein-protein complexes and symmetric multimers. Bioinformatics 2014, 30, 1771–1773. [Google Scholar] [CrossRef]
- Pierce, B.G.; Hourai, Y.; Weng, Z. Accelerating protein docking in ZDOCK using an advanced 3D convolution library. PLoS ONE 2011, 6, e24657. [Google Scholar] [CrossRef]
- Huang, S.Y.; Zou, X. MDockPP: A hierarchical approach for protein-protein docking and its application to CAPRI rounds 15-19. Proteins 2010, 78, 3096–3103. [Google Scholar] [CrossRef] [Green Version]
- Biesiada, J.; Porollo, A.; Velayutham, P.; Kouril, M.; Meller, J. Survey of public domain software for docking simulations and virtual screening. Hum. Genom. 2011, 5, 497–505. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lang, P.T.; Brozell, S.R.; Mukherjee, S.; Pettersen, E.F.; Meng, E.C.; Thomas, V.; Rizzo, R.C.; Case, D.A.; James, T.L.; Kuntz, I.D. DOCK 6: Combining techniques to model RNA-small molecule complexes. RNA 2009, 15, 1219–1230. [Google Scholar] [CrossRef] [Green Version]
- Shcherbinin, D.S.; Gnedenko, O.V.; Khmeleva, S.A.; Usanov, S.A.; Gilep, A.A.; Yantsevich, A.V.; Shkel, T.V.; Yushkevich, I.V.; Radko, S.P.; Ivanov, A.S.; et al. Computer-aided design of aptamers for cytochrome p450. J. Struct. Biol. 2015, 191, 112–119. [Google Scholar] [CrossRef]
- Trott, O.; Olson, A.J. AutoDock Vina: Improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. J. Comput. Chem. 2010, 31, 455–461. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Quiroga, R.; Villarreal, M.A. Vinardo: A Scoring Function Based on Autodock Vina Improves Scoring, Docking, and Virtual Screening. PLoS ONE 2016, 11, e0155183. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vieira, T.E.; Sousa, S.F. Comparing AutoDock and Vina in Ligand/Decoy Discrimination for Virtual Screening. Appl. Sci. 2019, 9, 4538. [Google Scholar] [CrossRef] [Green Version]
- Abraham, D.B.; Murtola, T.; Schulz, R.; Pall, S.; Smith, J.C.; Hess, B.; Lindahl, E. GROMACS: High performance molecular simulations through multi-level parallelism from laptops to supercomputers. SoftwareX 2015, 1, 7. [Google Scholar] [CrossRef] [Green Version]
- Case, D.A.; Cheatham, T.E., III; Darden, T.; Gohlke, H.; Luo, R.; Merz, K.M., Jr.; Onufriev, A.; Simmerling, C.; Wang, B.; Woods, R.J. The Amber biomolecular simulation programs. J. Comput. Chem. 2005, 26, 1668–1688. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pronk, S.; Pall, S.; Schulz, R.; Larsson, P.; Bjelkmar, P.; Apostolov, R.; Shirts, M.R.; Smith, J.C.; Kasson, P.M.; van der Spoel, D.; et al. GROMACS 4.5: A high-throughput and highly parallel open source molecular simulation toolkit. Bioinformatics 2013, 29, 845–854. [Google Scholar] [CrossRef]
- Genheden, S.; Ryde, U. The MM/PBSA and MM/GBSA methods to estimate ligand-binding affinities. Expert Opin. Drug Discov. 2015, 10, 449–461. [Google Scholar] [CrossRef]
- Zavyalova, E.; Golovin, A.; Reshetnikov, R.; Mudrik, N.; Panteleyev, D.; Pavlova, G.; Kopylov, A. Novel modular DNA aptamer for human thrombin with high anticoagulant activity. Curr. Med. Chem. 2011, 18, 3343–3350. [Google Scholar] [CrossRef]
- Platella, C.; Riccardi, C.; Montesarchio, D.; Roviello, G.N.; Musumeci, D. G-quadruplex-based aptamers against protein targets in therapy and diagnostics. Biochim. Biophys. Acta Gen. Subj. 2017, 1861, 1429–1447. [Google Scholar] [CrossRef] [PubMed]
- Goncalves, D.P.; Ladame, S.; Balasubramanian, S.; Sanders, J.K. Synthesis and G-quadruplex binding studies of new 4-N-methylpyridinium porphyrins. Org. Biomol. Chem. 2006, 4, 3337–3342. [Google Scholar] [CrossRef] [PubMed]
- Riccardi, C.; Napolitano, E.; Platella, C.; Musumeci, D.; Montesarchio, D. G-quadruplex-based aptamers targeting human thrombin: Discovery, chemical modifications and antithrombotic effects. Pharmacol. Ther. 2021, 217, 107649. [Google Scholar] [CrossRef]
- Roxo, C.; Kotkowiak, W.; Pasternak, A. G-Quadruplex-Forming Aptamers-Characteristics, Applications, and Perspectives. Molecules 2019, 24, 3781. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tasset, D.M.; Kubik, M.F.; Steiner, W. Oligonucleotide inhibitors of human thrombin that bind distinct epitopes. J. Mol. Biol. 1997, 272, 688–698. [Google Scholar] [CrossRef] [PubMed]
- Da Silva, M.W. NMR methods for studying quadruplex nucleic acids. Methods 2007, 43, 264–277. [Google Scholar] [CrossRef] [PubMed]
- Campbell, N.H.; Parkinson, G.N. Crystallographic studies of quadruplex nucleic acids. Methods 2007, 43, 252–263. [Google Scholar] [CrossRef] [PubMed]
- Lombardi, E.P.; Londono-Vallejo, A. A guide to computational methods for G-quadruplex prediction. Nucleic Acids Res. 2020, 48, 1–15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Moccia, F.; Platella, C.; Musumeci, D.; Batool, S.; Zumrut, H.; Bradshaw, J.; Mallikaratchy, P.; Montesarchio, D. The role of G-quadruplex structures of LIGS-generated aptamers R1.2 and R1.3 in IgM specific recognition. Int. J. Biol. Macromol. 2019, 133, 839–849. [Google Scholar] [CrossRef] [PubMed]
- Tucker, W.O.; Shum, K.T.; Tanner, J.A. G-quadruplex DNA aptamers and their ligands: Structure, function and application. Curr. Pharm. Des. 2012, 18, 2014–2026. [Google Scholar] [CrossRef] [Green Version]
- Troisi, R.; Balasco, N.; Vitagliano, L.; Sica, F. Molecular dynamics simulations of human α-thrombin in different structural contexts: Evidence for an aptamer-guided cooperation between the two exosites. J. Biomol. Struct. Dyn. 2020, 1–11. [Google Scholar] [CrossRef]
- Mitchell, T. Machine Learning; McGraw Hill: New York, NY, USA, 1997. [Google Scholar]
- Schmidhuber, J. Deep learning in neural networks: An overview. Neural Netw. 2015, 61, 85–117. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wornow, M. Applying Deep Learning to Discover Highly Functionalized Nucleic Acid Polymers that Bind to Small Molecules. Ph.D. Thesis, Harvard University, Cambridge, MA, USA, 2020. [Google Scholar]
- Hoinka, J.; Berezhnoy, A.; Sauna, Z.E.; Gilboa, E.; Przytycka, T.M. AptaCluster—A Method to Cluster HT-SELEX Aptamer Pools and Lessons from its Application. In Proceedings of the International Conference on Research in Computational Molecular Biology, Pittsburgh, PA, USA, 2–5 April 2014; Volume 8394, pp. 115–128. [Google Scholar] [CrossRef] [Green Version]
- Alam, K.K.; Chang, J.L.; Burke, D.H. FASTAptamer: A Bioinformatic Toolkit for High-throughput Sequence Analysis of Combinatorial Selections. Mol. Ther. Nucleic Acids 2015, 4, e230. [Google Scholar] [CrossRef] [PubMed]
- Dao, P.; Hoinka, J.; Takahashi, M.; Zhou, J.; Ho, M.; Wang, Y.; Costa, F.; Rossi, J.J.; Backofen, R.; Burnett, J.; et al. AptaTRACE Elucidates RNA Sequence-Structure Motifs from Selection Trends in HT-SELEX Experiments. Cell Syst. 2016, 3, 62–70. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Caroli, J.; Taccioli, C.; de La Fuente, A.; Serafini, P.; Bicciato, S. APTANI: A computational tool to select aptamers through sequence-structure motif analysis of HT-SELEX data. Bioinformatics 2016, 32, 161–164. [Google Scholar] [CrossRef] [PubMed]
- Hoinka, J.; Zotenko, E.; Friedman, A.; Sauna, Z.E.; Przytycka, T.M. Identification of sequence-structure RNA binding motifs for SELEX-derived aptamers. Bioinformatics 2012, 28, i215–i223. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Song, J.; Zheng, Y.; Huang, M.; Wu, L.; Wang, W.; Zhu, Z.; Song, Y.; Yang, C. A Sequential Multidimensional Analysis Algorithm for Aptamer Identification based on Structure Analysis and Machine Learning. Anal. Chem. 2020, 92, 3307–3314. [Google Scholar] [CrossRef] [PubMed]
- Ishida, R.; Adachi, T.; Yokota, A.; Yoshihara, H.; Aoki, K.; Nakamura, Y.; Hamada, M. RaptRanker: In silico RNA aptamer selection from HT-SELEX experiment based on local sequence and structure information. Nucleic Acids Res. 2020, 48, e82. [Google Scholar] [CrossRef]
- Russell, S.J.; Norvig, P. Artificial Intelligence: A Modern Approach, 4th ed.; Prentice Hall: Upper Saddle River, NJ, USA, 2020. [Google Scholar]
- Li, B.Q.; Zhang, Y.C.; Huang, G.H.; Cui, W.R.; Zhang, N.; Cai, Y.D. Prediction of aptamer-target interacting pairs with pseudo-amino acid composition. PLoS ONE 2014, 9, e86729. [Google Scholar] [CrossRef] [Green Version]
- Cruz-Toledo, J.; McKeague, M.; Zhang, X.; Giamberardino, A.; McConnell, E.; Francis, T.; DeRosa, M.C.; Dumontier, M. Aptamer Base: A collaborative knowledge base to describe aptamers and SELEX experiments. Database 2012, 2012, bas006. [Google Scholar] [CrossRef] [PubMed]
- Zhu, H.; Jin, W.; Yang, G. An Effective Text Classification Model Based on Ensemble Strategy. J. Phys. Conf. Ser. 2019, 1229, 012058. [Google Scholar]
- Dupond, S. A thorough review on the current advance of neural network structures. Annu. Rev. Control 2019, 14, 31. [Google Scholar]
- Specht, D.F. Probabilistic neural networks and the polynomial Adaline as complementary techniques for classification. IEEE Trans. Neural Netw. 1990, 1, 111–121. [Google Scholar] [CrossRef] [PubMed]
- Valueva, M.V.; Nagornow, N.N.; Lyakhow, P.A.; Valuev, G.V.; Chervyakov, N.I. Application of the residue number system to reduce hardware costs of the convolutional neural network implementation. Math. Comput. Simul. 2020, 177, 12. [Google Scholar] [CrossRef]
- Yu, X.; Wang, Y.; Yang, H.; Huang, X. Prediction of the binding affinity of aptamers against the influenza virus. SAR QSAR Environ. Res. 2019, 30, 51–62. [Google Scholar] [CrossRef]
- Bindewald, E.; Shapiro, B.A. RNA secondary structure prediction from sequence alignments using a network of k-nearest neighbor classifiers. RNA 2006, 12, 342–352. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Singh, J.; Hanson, J.; Paliwal, K.; Zhou, Y. RNA secondary structure prediction using an ensemble of two-dimensional deep neural networks and transfer learning. Nat. Commun. 2019, 10, 5407. [Google Scholar] [CrossRef] [Green Version]
- Danaee, P.; Rouches, M.; Wiley, M.; Deng, D.; Huang, L.; Hendrix, D. bpRNA: Large-scale automated annotation and analysis of RNA secondary structure. Nucleic Acids Res. 2018, 46, 5381–5394. [Google Scholar] [CrossRef] [PubMed]
- Fudenberg, G.; Kelley, D.R.; Pollard, K.S. Predicting 3D genome folding from DNA sequence with Akita. Nat. Methods 2020, 17, 1111–1117. [Google Scholar] [CrossRef] [PubMed]
- Pahikkala, T.; Airola, A.; Pietila, S.; Shakyawar, S.; Szwajda, A.; Tang, J.; Aittokallio, T. Toward more realistic drug-target interaction predictions. Brief. Bioinform. 2015, 16, 325–337. [Google Scholar] [CrossRef]
- He, T.; Heidemeyer, M.; Ban, F.; Cherkasov, A.; Ester, M. SimBoost: A read-across approach for predicting drug-target binding affinities using gradient boosting machines. J. Cheminform. 2017, 9, 24. [Google Scholar] [CrossRef]
- Van Laarhoven, T.; Nabuurs, S.B.; Marchiori, E. Gaussian interaction profile kernels for predicting drug-target interaction. Bioinformatics 2011, 27, 3036–3043. [Google Scholar] [CrossRef] [Green Version]
- Ashtawy, H.M.; Mahapatra, N.R. A comparative assessment of ranking accuracies of conventional and machine-learning-based scoring functions for protein-ligand binding affinity prediction. IEEE ACM Trans. Comput. Biol. Bioinform. 2012, 9, 1301–1313. [Google Scholar] [CrossRef] [PubMed]
- Stepniewska-Dziubinska, M.M.; Zielenkiewicz, P.; Siedlecki, P. Development and evaluation of a deep learning model for protein-ligand binding affinity prediction. Bioinformatics 2018, 34, 3666–3674. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kwon, Y.; Shin, W.H.; Ko, J.; Lee, J. AK-Score: Accurate Protein-Ligand Binding Affinity Prediction Using an Ensemble of 3D-Convolutional Neural Networks. Int. J. Mol. Sci. 2020, 21, 8424. [Google Scholar] [CrossRef] [PubMed]
- Ashtawy, H.M.; Mahapatra, N.R. BgN-Score and BsN-Score: Bagging and boosting based ensemble neural networks scoring functions for accurate binding affinity prediction of protein-ligand complexes. BMC Bioinform. 2015, 16, S8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Karimi, M.; Wu, D.; Wang, Z.; Shen, Y. DeepAffinity: Interpretable deep learning of compound-protein affinity through unified recurrent and convolutional neural networks. Bioinformatics 2019, 35, 3329–3338. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kalchbrenne, N.; Blunsom, P. Recurrent Continuous Translation Models. In Proceedings of the 2013 Conference on Empirical Methods in Natural Language Processing, Seattle, WA, USA, 18–21 October 2013; pp. 1700–1709. [Google Scholar]
- Ozturk, H.; Ozgur, A.; Ozkirimli, E. DeepDTA: Deep drug-target binding affinity prediction. Bioinformatics 2018, 34, i821–i829. [Google Scholar] [CrossRef] [Green Version]
- Öztürk, H.; Ozkirimli, E.; Özgür, A. WideDTA: Prediction of drug-target binding affinity. arXiv 2019, arXiv:1902.04166. [Google Scholar]
- Zhao, L.; Wang, J.; Pang, L.; Liu, Y.; Zhang, J. GANsDTA: Predicting Drug-Target Binding Affinity Using GANs. Front. Genet. 2019, 10, 1243. [Google Scholar] [CrossRef]
Software | Website Address | Developers | Example |
---|---|---|---|
RNAfold | http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi (accessed on 4 March 2021) | Energy minimization [13] | RNAfold was selected to predict the tetracycline aptamer [21] |
Mfold | http://www.unafold.org/ (accessed on 4 March 2021) | Energy minimization [22] | Four ssDNA aptamers were selected to inhibit the activity of angiotensin II [23] |
RNAstructure | https://rna.urmc.rochester.edu/RNAstructure.html (accessed on 4 March 2021) | Energy minimization [24] | DNA aptamers against 17β-estradiol and the secondary structures of the aptamers were predicted using RNAstructure [25] |
Vfold2D | http://rna.physics.missouri.edu/vfold2D/ (accessed on 4 March 2021) | Energy minimization [26] | The secondary structures of aptamers against human immunodeficiency virus-1 reverse transcriptase (HIV-1 RT) were predicted from the sequence by using the Vfold2D program [27] |
CentroidFold | http://rtools.cbrc.jp/centroidfold/ (accessed on 4 March 2021) | Homologous sequence information [28] | The CentroidFold web server was used to predict the secondary structures of RNA aptamers targeting angiopoietin-2 [29] |
No. | Aptamer | Sequence | PDB ID | Structure |
---|---|---|---|---|
1 | RNA aptamer for Bacillus anthracis ribosomal protein S8 | GGGCAGUGAUGCUUCGGCAUAUCAGCCC | 2LUN | |
2 | RNA aptamer for human IgG1 | GGAGGUGCUCCGAAAGGAACUCCA | 3AGV | |
3 | RNA aptamer for human immunodeficiency virus type-1 (HIV-1) reverse transcriptase | UACCCCCCCUUCGGUGCUUUGCAC CGAAGGGGGGG | 6BHJ | |
4 | RNA aptamer for HIV-1 Rev protein | GGCUGGACUCGUACUUCGGUACUG GAGAAACAGCC | 6CF2 | |
5 | RNA aptamer for antibody fragments | GACGCGACCGAAAUGGUGAAGGACG GGUCCAGUGCGAAACACGCACUGUUG AGUAGAGUGUGAGCUCCGUAACUGGUCGCGUC | 6B14 | |
Software | Website Address | Developers | Example |
---|---|---|---|
RNAComposer | http://rnacomposer.cs.put.poznan.pl/ (accessed on 4 March 2021) | Secondary structure elements [38] | RNA aptamers targeting angiopoietin-2 [29] |
3dRNA | http://biophy.hust.edu.cn/3dRNA (accessed on 4 March 2021) | Secondary structure elements [39] | RNA aptamer targeting Streptococcus agalactiae surface protein [40] |
Vfold3D | http://rna.physics.missouri.edu/vfold3D/ (accessed on 4 March 2021) | Secondary structure elements [26] | RNA aptamer targeting prostate-specific membrane antigen [41] |
simRNA | https://genesilico.pl/SimRNAweb (accessed on 4 March 2021) | Lowest free energy [42] | RNA aptamers targeting angiopoietin-2 [43] |
Methods | Energy_Mixed | Energy_Protein | Energy_Aptamer | Energy_Binding | Energy_Binding_Variation |
---|---|---|---|---|---|
Reference | −13,472 | −7983 | −3318 | −2171 | 0 |
Vfold3D | −13,324 | −7983 | −3661 | −1680 | 491 |
SimRNA | −13,112 | −8232 | −3852 | −1028 | 1143 |
RNAcomposer | −12,971 | −8117 | −3832 | −1022 | 1149 |
3dRNA | −13,229 | −8159 | −3834 | −1236 | 935 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, Z.; Hu, L.; Zhang, B.-T.; Lu, A.; Wang, Y.; Yu, Y.; Zhang, G. Artificial Intelligence in Aptamer–Target Binding Prediction. Int. J. Mol. Sci. 2021, 22, 3605. https://doi.org/10.3390/ijms22073605
Chen Z, Hu L, Zhang B-T, Lu A, Wang Y, Yu Y, Zhang G. Artificial Intelligence in Aptamer–Target Binding Prediction. International Journal of Molecular Sciences. 2021; 22(7):3605. https://doi.org/10.3390/ijms22073605
Chicago/Turabian StyleChen, Zihao, Long Hu, Bao-Ting Zhang, Aiping Lu, Yaofeng Wang, Yuanyuan Yu, and Ge Zhang. 2021. "Artificial Intelligence in Aptamer–Target Binding Prediction" International Journal of Molecular Sciences 22, no. 7: 3605. https://doi.org/10.3390/ijms22073605
APA StyleChen, Z., Hu, L., Zhang, B.-T., Lu, A., Wang, Y., Yu, Y., & Zhang, G. (2021). Artificial Intelligence in Aptamer–Target Binding Prediction. International Journal of Molecular Sciences, 22(7), 3605. https://doi.org/10.3390/ijms22073605