The Role of the Pathogen Dose and PI3Kγ in Immunometabolic Reprogramming of Microglia for Innate Immune Memory
Abstract
1. Introduction
2. Results
2.1. Energy Metabolism in LPS-Induced IIM
2.2. Aerobic Glycolysis and β-Oxidation in LPS-Induced IIM
2.3. Role of PI3Kγ on Priming-Dependent Metabolic Rewiring in Microglial Cells
3. Discussion
4. Materials and Methods
4.1. Animals and Microglia Isolation Procedures
4.2. Microglial Cell Stimulation
4.3. Antibodies
4.4. SDS-PAGE Western Blotting
4.5. Seahorse Assay and Crystal Violet Staining
4.6. Measurement of Fatty Acid Oxidation (β-Oxidation)
4.7. RNA Isolation and Real-Time qPCR
4.8. Measurement of the Protein Concentration
4.9. cAMP Measurements
4.10. Lactate Production Measurements
4.11. Analysis of Cell Viability by MTT Assay
4.12. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Neher, J.J.; Cunningham, C. Priming Microglia for Innate Immune Memory in the Brain. Trends Immunol. 2019, 40, 358–374. [Google Scholar] [CrossRef] [PubMed]
- Prinz, M.; Jung, S.; Priller, J. Microglia Biology: One Century of Evolving Concepts. Cell 2019, 179, 292–311. [Google Scholar] [CrossRef]
- Hanisch, U.K.; Kettenmann, H. Microglia: Active sensor and versatile effector cells in the normal and pathologic brain. Nat. Neurosci. 2007, 10, 1387–1394. [Google Scholar] [CrossRef] [PubMed]
- Low, D.; Ginhoux, F. Recent advances in the understanding of microglial development and homeostasis. Cell. Immunol. 2018, 330, 68–78. [Google Scholar] [CrossRef] [PubMed]
- Nimmerjahn, A.; Kirchhoff, F.; Helmchen, F. Resting microglial cells are highly dynamic surveillants of brain parenchyma in vivo. Science 2005, 308, 1314–1318. [Google Scholar] [CrossRef] [PubMed]
- Tay, T.L.; Savage, J.C.; Hui, C.W.; Bisht, K.; Tremblay, M.E. Microglia across the lifespan: From origin to function in brain development, plasticity and cognition. J. Physiol. 2017, 595, 1929–1945. [Google Scholar] [CrossRef] [PubMed]
- Wolf, S.A.; Boddeke, H.W.; Kettenmann, H. Microglia in Physiology and Disease. Annu. Rev. Physiol. 2017, 79, 619–643. [Google Scholar] [CrossRef] [PubMed]
- Wendeln, A.C.; Degenhardt, K.; Kaurani, L.; Gertig, M.; Ulas, T.; Jain, G.; Wagner, J.; Hasler, L.M.; Wild, K.; Skodras, A.; et al. Innate immune memory in the brain shapes neurological disease hallmarks. Nature 2018, 556, 332–338. [Google Scholar] [CrossRef]
- Schaafsma, W.; Zhang, X.; van Zomeren, K.C.; Jacobs, S.; Georgieva, P.B.; Wolf, S.A.; Kettenmann, H.; Janova, H.; Saiepour, N.; Hanisch, U.K.; et al. Long-lasting pro-inflammatory suppression of microglia by LPS-preconditioning is mediated by RelB-dependent epigenetic silencing. Brain Behav. Immun. 2015, 48, 205–221. [Google Scholar] [CrossRef]
- Lajqi, T.; Lang, G.P.; Haas, F.; Williams, D.L.; Hudalla, H.; Bauer, M.; Groth, M.; Wetzker, R.; Bauer, R. Memory-Like Inflammatory Responses of Microglia to Rising Doses of LPS: Key Role of PI3Kgamma. Front. Immunol. 2019, 10, 2492. [Google Scholar] [CrossRef]
- Arts, R.J.; Novakovic, B.; Ter Horst, R.; Carvalho, A.; Bekkering, S.; Lachmandas, E.; Rodrigues, F.; Silvestre, R.; Cheng, S.C.; Wang, S.Y.; et al. Glutaminolysis and Fumarate Accumulation Integrate Immunometabolic and Epigenetic Programs in Trained Immunity. Cell Metab. 2016, 24, 807–819. [Google Scholar] [CrossRef] [PubMed]
- Netea, M.G.; Dominguez-Andres, J.; Barreiro, L.B.; Chavakis, T.; Divangahi, M.; Fuchs, E.; Joosten, L.A.B.; van der Meer, J.W.M.; Mhlanga, M.M.; Mulder, W.J.M.; et al. Defining trained immunity and its role in health and disease. Nat. Rev. Immunol. 2020, 20, 375–388. [Google Scholar] [CrossRef]
- Riksen, N.P.; Netea, M.G. Immunometabolic control of trained immunity. Mol. Asp. Med. 2020, 100897. [Google Scholar] [CrossRef]
- Mitroulis, I.; Ruppova, K.; Wang, B.; Chen, L.S.; Grzybek, M.; Grinenko, T.; Eugster, A.; Troullinaki, M.; Palladini, A.; Kourtzelis, I.; et al. Modulation of Myelopoiesis Progenitors Is an Integral Component of Trained Immunity. Cell 2018, 172, 147–161.e12. [Google Scholar] [CrossRef] [PubMed]
- Arts, R.J.; Joosten, L.A.; Netea, M.G. Immunometabolic circuits in trained immunity. Semin. Immunol. 2016, 28, 425–430. [Google Scholar] [CrossRef] [PubMed]
- O’Neill, L.A.; Kishton, R.J.; Rathmell, J. A guide to immunometabolism for immunologists. Nat. Rev. Immunol. 2016, 16, 553–565. [Google Scholar] [CrossRef]
- Van den Bossche, J.; O’Neill, L.A.; Menon, D. Macrophage Immunometabolism: Where Are We (Going)? Trends Immunol. 2017, 38, 395–406. [Google Scholar] [CrossRef]
- Hawkins, P.T.; Anderson, K.E.; Davidson, K.; Stephens, L.R. Signalling through Class I PI3Ks in mammalian cells. Biochem. Soc. Trans. 2006, 34 Pt 5, 647–662. [Google Scholar] [CrossRef]
- Hazeki, O.; Okada, T.; Kurosu, H.; Takasuga, S.; Suzuki, T.; Katada, T. Activation of PI 3-kinase by G protein betagamma subunits. Life Sci. 1998, 62, 1555–1559. [Google Scholar] [CrossRef]
- Maier, U.; Babich, A.; Nurnberg, B. Roles of non-catalytic subunits in gbetagamma-induced activation of class I phosphoinositide 3-kinase isoforms beta and gamma. J. Biol. Chem. 1999, 274, 29311–29317. [Google Scholar] [CrossRef]
- Murga, C.; Laguinge, L.; Wetzker, R.; Cuadrado, A.; Gutkind, J.S. Activation of Akt/protein kinase B by G protein-coupled receptors. A role for alpha and beta gamma subunits of heterotrimeric G proteins acting through phosphatidylinositol-3-OH kinasegamma. J. Biol. Chem. 1998, 273, 19080–19085. [Google Scholar] [CrossRef]
- Stephens, L.R.; Eguinoa, A.; Erdjument-Bromage, H.; Lui, M.; Cooke, F.; Coadwell, J.; Smrcka, A.S.; Thelen, M.; Cadwallader, K.; Tempst, P.; et al. The G beta gamma sensitivity of a PI3K is dependent upon a tightly associated adaptor, p101. Cell 1997, 89, 105–114. [Google Scholar] [CrossRef]
- Stoyanov, B.; Volinia, S.; Hanck, T.; Rubio, I.; Loubtchenkov, M.; Malek, D.; Stoyanova, S.; Vanhaesebroeck, B.; Dhand, R.; Nurnberg, B.; et al. Cloning and characterization of a G protein-activated human phosphoinositide-3 kinase. Science 1995, 269, 690–693. [Google Scholar] [CrossRef] [PubMed]
- Vanhaesebroeck, B.; Guillermet-Guibert, J.; Graupera, M.; Bilanges, B. The emerging mechanisms of isoform-specific PI3K signalling. Nat. Rev. Mol. Cell Biol. 2010, 11, 329–341. [Google Scholar] [CrossRef]
- Venable, J.D.; Ameriks, M.K.; Blevitt, J.M.; Thurmond, R.L.; Fung-Leung, W.P. Phosphoinositide 3-kinase gamma (PI3Kgamma) inhibitors for the treatment of inflammation and autoimmune disease. Recent Pat. Inflamm. Allergy Drug Discov. 2010, 4, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Bi, L.; Okabe, I.; Bernard, D.J.; Nussbaum, R.L. Early embryonic lethality in mice deficient in the p110beta catalytic subunit of PI 3-kinase. Mamm. Genome 2002, 13, 169–172. [Google Scholar] [CrossRef]
- Bi, L.; Okabe, I.; Bernard, D.J.; Wynshaw-Boris, A.; Nussbaum, R.L. Proliferative defect and embryonic lethality in mice homozygous for a deletion in the p110alpha subunit of phosphoinositide 3-kinase. J. Biol. Chem. 1999, 274, 10963–10968. [Google Scholar] [CrossRef]
- Cushing, T.D.; Metz, D.P.; Whittington, D.A.; McGee, L.R. PI3Kdelta and PI3Kgamma as targets for autoimmune and inflammatory diseases. J. Med. Chem. 2012, 55, 8559–8581. [Google Scholar] [CrossRef]
- Rommel, C.; Camps, M.; Ji, H. PI3K delta and PI3K gamma: Partners in crime in inflammation in rheumatoid arthritis and beyond? Nat. Rev. Immunol. 2007, 7, 191–201. [Google Scholar] [CrossRef]
- Liu, L.; Puri, K.D.; Penninger, J.M.; Kubes, P. Leukocyte PI3Kgamma and PI3Kdelta have temporally distinct roles for leukocyte recruitment in vivo. Blood 2007, 110, 1191–1198. [Google Scholar] [CrossRef]
- Schmid, M.C.; Avraamides, C.J.; Dippold, H.C.; Franco, I.; Foubert, P.; Ellies, L.G.; Acevedo, L.M.; Manglicmot, J.R.; Song, X.; Wrasidlo, W.; et al. Receptor tyrosine kinases and TLR/IL1Rs unexpectedly activate myeloid cell PI3kgamma, a single convergent point promoting tumor inflammation and progression. Cancer Cell 2011, 19, 715–727. [Google Scholar] [CrossRef]
- Hirsch, E.; Katanaev, V.L.; Garlanda, C.; Azzolino, O.; Pirola, L.; Silengo, L.; Sozzani, S.; Mantovani, A.; Altruda, F.; Wymann, M.P. Central role for G protein-coupled phosphoinositide 3-kinase gamma in inflammation. Science 2000, 287, 1049–1053. [Google Scholar] [CrossRef]
- Jin, R.; Yu, S.; Song, Z.; Quillin, J.W.; Deasis, D.P.; Penninger, J.M.; Nanda, A.; Granger, D.N.; Li, G. Phosphoinositide 3-kinase-gamma expression is upregulated in brain microglia and contributes to ischemia-induced microglial activation in acute experimental stroke. Biochem. Biophys. Res. Commun. 2010, 399, 458–464. [Google Scholar] [CrossRef] [PubMed]
- Schmidt, C.; Schneble, N.; Muller, J.P.; Bauer, R.; Perino, A.; Marone, R.; Rybalkin, S.D.; Wymann, M.P.; Hirsch, E.; Wetzker, R. Phosphoinositide 3-kinase gamma mediates microglial phagocytosis via lipid kinase-independent control of cAMP. Neuroscience 2013, 233, 44–53. [Google Scholar] [CrossRef]
- Frister, A.; Schmidt, C.; Schneble, N.; Brodhun, M.; Gonnert, F.A.; Bauer, M.; Hirsch, E.; Muller, J.P.; Wetzker, R.; Bauer, R. Phosphoinositide 3-Kinase gamma Affects LPS-Induced Disturbance of Blood-Brain Barrier Via Lipid Kinase-Independent Control of cAMP in Microglial Cells. Neuromol. Med. 2014, 16, 704–713. [Google Scholar] [CrossRef]
- Schmidt, C.; Frahm, C.; Schneble, N.; Muller, J.P.; Brodhun, M.; Franco, I.; Witte, O.W.; Hirsch, E.; Wetzker, R.; Bauer, R. Phosphoinositide 3-Kinase gamma Restrains Neurotoxic Effects of Microglia After Focal Brain Ischemia. Mol. Neurobiol. 2016, 53, 5468–5479. [Google Scholar] [CrossRef] [PubMed]
- Schneble, N.; Schmidt, C.; Bauer, R.; Muller, J.P.; Monajembashi, S.; Wetzker, R. Phosphoinositide 3-kinase gamma ties chemoattractant- and adrenergic control of microglial motility. Mol. Cell. Neurosci. 2017, 78, 1–8. [Google Scholar] [CrossRef]
- Ndongson-Dongmo, B.; Heller, R.; Hoyer, D.; Brodhun, M.; Bauer, M.; Winning, J.; Hirsch, E.; Wetzker, R.; Schlattmann, P.; Bauer, R. Phosphoinositide 3-kinase gamma controls inflammation-induced myocardial depression via sequential cAMP and iNOS signalling. Cardiovasc. Res. 2015, 108, 243–253. [Google Scholar] [CrossRef] [PubMed]
- Patrucco, E.; Notte, A.; Barberis, L.; Selvetella, G.; Maffei, A.; Brancaccio, M.; Marengo, S.; Russo, G.; Azzolino, O.; Rybalkin, S.D.; et al. PI3Kgamma modulates the cardiac response to chronic pressure overload by distinct kinase-dependent and -independent effects. Cell 2004, 118, 375–387. [Google Scholar] [CrossRef]
- Xie, M.; Yu, Y.; Kang, R.; Zhu, S.; Yang, L.; Zeng, L.; Sun, X.; Yang, M.; Billiar, T.R.; Wang, H.; et al. PKM2-dependent glycolysis promotes NLRP3 and AIM2 inflammasome activation. Nat. Commun. 2016, 7, 13280. [Google Scholar] [CrossRef]
- Zhang, Z.; Deng, X.; Liu, Y.; Liu, Y.; Sun, L.; Chen, F. PKM2, function and expression and regulation. Cell Biosci. 2019, 9, 52. [Google Scholar] [CrossRef] [PubMed]
- Tannahill, G.M.; Curtis, A.M.; Adamik, J.; Palsson-McDermott, E.M.; McGettrick, A.F.; Goel, G.; Frezza, C.; Bernard, N.J.; Kelly, B.; Foley, N.H.; et al. Succinate is an inflammatory signal that induces IL-1beta through HIF-1alpha. Nature 2013, 496, 238–242. [Google Scholar] [CrossRef]
- Haschemi, A.; Kosma, P.; Gille, L.; Evans, C.R.; Burant, C.F.; Starkl, P.; Knapp, B.; Haas, R.; Schmid, J.A.; Jandl, C.; et al. The sedoheptulose kinase CARKL directs macrophage polarization through control of glucose metabolism. Cell Metab. 2012, 15, 813–826. [Google Scholar] [CrossRef]
- Jha, A.K.; Huang, S.C.; Sergushichev, A.; Lampropoulou, V.; Ivanova, Y.; Loginicheva, E.; Chmielewski, K.; Stewart, K.M.; Ashall, J.; Everts, B.; et al. Network integration of parallel metabolic and transcriptional data reveals metabolic modules that regulate macrophage polarization. Immunity 2015, 42, 419–430. [Google Scholar] [CrossRef]
- Mills, E.L.; Kelly, B.; O’Neill, L.A.J. Mitochondria are the powerhouses of immunity. Nat. Immunol. 2017, 18, 488–498. [Google Scholar] [CrossRef] [PubMed]
- Lajqi, T.; Stojiljkovic, M.; Williams, D.L.; Hudalla, H.; Bauer, M.; Witte, O.W.; Wetzker, R.; Bauer, R.; Schmeer, C. Memory-Like Responses of Brain Microglia Are Controlled by Developmental State and Pathogen Dose. Front. Immunol. 2020, 11, 546415. [Google Scholar] [CrossRef]
- Cusumano, V.; Mancuso, G.; Genovese, F.; Cuzzola, M.; Carbone, M.; Cook, J.A.; Cochran, J.B.; Teti, G. Neonatal hypersusceptibility to endotoxin correlates with increased tumor necrosis factor production in mice. J. Infect. Dis. 1997, 176, 168–176. [Google Scholar] [CrossRef] [PubMed]
- Lajqi, T.; Poschl, J.; Frommhold, D.; Hudalla, H. The Role of Microbiota in Neutrophil Regulation and Adaptation in Newborns. Front. Immunol. 2020, 11, 568685. [Google Scholar] [CrossRef]
- Beutler, B.; Rietschel, E.T. Innate immune sensing and its roots: The story of endotoxin. Nat. Rev. Immunol. 2003, 3, 169–176. [Google Scholar] [CrossRef] [PubMed]
- Freudenberg, M.A.; Tchaptchet, S.; Keck, S.; Fejer, G.; Huber, M.; Schutze, N.; Beutler, B.; Galanos, C. Lipopolysaccharide sensing an important factor in the innate immune response to Gram-negative bacterial infections: Benefits and hazards of LPS hypersensitivity. Immunobiology 2008, 213, 193–203. [Google Scholar] [CrossRef]
- Weiss, J. Bactericidal/permeability-increasing protein (BPI) and lipopolysaccharide-binding protein (LBP): Structure, function and regulation in host defence against Gram-negative bacteria. Biochem. Soc. Trans. 2003, 31 Pt 4, 785–790. [Google Scholar] [CrossRef]
- Teghanemt, A.; Weiss, J.P.; Gioannini, T.L. Radioiodination of an endotoxin.MD-2 complex generates a novel sensitive, high-affinity ligand for TLR4. Innate Immun. 2013, 19, 545–560. [Google Scholar] [CrossRef] [PubMed]
- Cao, M.; Cortes, M.; Moore, C.S.; Leong, S.Y.; Durosier, L.D.; Burns, P.; Fecteau, G.; Desrochers, A.; Auer, R.N.; Barreiro, L.B.; et al. Fetal microglial phenotype in vitro carries memory of prior in vivo exposure to inflammation. Front. Cell. Neurosci. 2015, 9, 294. [Google Scholar] [CrossRef] [PubMed][Green Version]
- O’Neill, L.A.; Hardie, D.G. Metabolism of inflammation limited by AMPK and pseudo-starvation. Nature 2013, 493, 346–355. [Google Scholar] [CrossRef] [PubMed]
- Bauer, M.; Weis, S.; Netea, M.G.; Wetzker, R. Remembering Pathogen Dose: Long-Term Adaptation in Innate Immunity. Trends Immunol. 2018, 39, 438–445. [Google Scholar] [CrossRef] [PubMed]
- Perino, A.; Ghigo, A.; Ferrero, E.; Morello, F.; Santulli, G.; Baillie, G.S.; Damilano, F.; Dunlop, A.J.; Pawson, C.; Walser, R.; et al. Integrating cardiac PIP3 and cAMP signaling through a PKA anchoring function of p110gamma. Mol. Cell 2011, 42, 84–95. [Google Scholar] [CrossRef]
- Lang, G.P.; Ndongson-Dongmo, B.; Lajqi, T.; Brodhun, M.; Han, Y.; Wetzker, R.; Frasch, M.G.; Bauer, R. Impact of ambient temperature on inflammation-induced encephalopathy in endotoxemic mice-role of phosphoinositide 3-kinase gamma. J. Neuroinflamm. 2020, 17, 292. [Google Scholar] [CrossRef] [PubMed]
- Giulian, D.; Baker, T.J. Characterization of ameboid microglia isolated from developing mammalian brain. J. Neurosci. Off. J. Soc. Neurosci. 1986, 6, 2163–2178. [Google Scholar] [CrossRef]
- Saura, J.; Tusell, J.M.; Serratosa, J. High-yield isolation of murine microglia by mild trypsinization. Glia 2003, 44, 183–189. [Google Scholar] [CrossRef]
- Dohm, G.L.; Huston, R.L.; Askew, E.W.; Weiser, P.C. Effects of exercise on activity of heart and muscle mitochondria. Am. J. Physiol. 1972, 223, 783–787. [Google Scholar] [CrossRef][Green Version]
- Huynh, F.K.; Green, M.F.; Koves, T.R.; Hirschey, M.D. Measurement of fatty acid oxidation rates in animal tissues and cell lines. Methods Enzymol. 2014, 542, 391–405. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.Y.; Hickner, R.C.; Cortright, R.L.; Dohm, G.L.; Houmard, J.A. Lipid oxidation is reduced in obese human skeletal muscle. Am. J. Physiol. Endocrinol. Metab. 2000, 279, E1039–E1044. [Google Scholar] [CrossRef] [PubMed]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [PubMed]
- Lin, C.Y.; Chen, S.H.; Kou, G.H.; Kuo, C.M. An enzymatic microassay for lactate concentration in blood and hemolymph. Acta Zool. Taiwanica 1999, 10, 91–101. [Google Scholar]
Gene Name | Primer Sequences (5′–3′) | |
---|---|---|
ALDOA (Aldolase A) | Forward: | CAACGGTCACAGCACTTCG |
Reverse: | GGCTCGACCATAGGAGAAAG | |
CARKL | Forward: | CAGGCCAAGGCTGTGAAT |
(Carbohydrate kinase-like) | Reverse: | GCCAGCTGCATCATAGGACT |
ENO-2 | Forward: | TGGCAAGGATGCCACTAACGTG |
(Enolase 2) | Reverse: | AACTCAGAGGCAGCCACATCCA |
GAPDH | Forward: | CATGGCCTTCCGTGTTTCCTA |
(Glyceraldehyde-3-phosphate dehydrogenase) | Reverse: | CCTGCTTCACCACCTTCTTGAT |
HIF-1α | Forward: | CTCATCAGTTGCCACTTCC |
(Hypoxia factor -1 α) | Reverse: | TCATCTTCACTGTCTAGACCAC |
HK-2 (Hexokinase 2) | Forward: | ATTGTCCAGTGCATCGCGGA |
Reverse: | AGGTCAAACTCCTCTCGCCG | |
ICL1 | Forward: | ACCCAGCCTTTGGATGAAGG |
(Isocitrate lyase 1) | Reverse: | GTTACAGAGGTGGGACGCAA |
NDUFA9 | Forward: | TCCGCTTTCGGGTTGTTA |
(NADH: Ubiquinone oxidoreductase, subunit A9) | Reverse: | GTACCGGTTTGGCCCAGT |
PFK1 | Forward: | TGACATGACCATTGGCACAG |
(Phosphofructokinase 1) | Reverse: | TCTTGCTACTCAGGATTCGG |
PKM2 | Forward: | GTCTGGAGAAACAGCCAAGG |
(Pyruvate kinase M2) | Reverse: | CGGAGTTCCTCGAATAGCTG |
SDHA | Forward: | AACACTGGAGGAAGCACACC |
(Succinate dehydrogenase complex, subunit A) | Reverse: | AGTAGGAGCGGATAGCAGGA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lajqi, T.; Marx, C.; Hudalla, H.; Haas, F.; Große, S.; Wang, Z.-Q.; Heller, R.; Bauer, M.; Wetzker, R.; Bauer, R. The Role of the Pathogen Dose and PI3Kγ in Immunometabolic Reprogramming of Microglia for Innate Immune Memory. Int. J. Mol. Sci. 2021, 22, 2578. https://doi.org/10.3390/ijms22052578
Lajqi T, Marx C, Hudalla H, Haas F, Große S, Wang Z-Q, Heller R, Bauer M, Wetzker R, Bauer R. The Role of the Pathogen Dose and PI3Kγ in Immunometabolic Reprogramming of Microglia for Innate Immune Memory. International Journal of Molecular Sciences. 2021; 22(5):2578. https://doi.org/10.3390/ijms22052578
Chicago/Turabian StyleLajqi, Trim, Christian Marx, Hannes Hudalla, Fabienne Haas, Silke Große, Zhao-Qi Wang, Regine Heller, Michael Bauer, Reinhard Wetzker, and Reinhard Bauer. 2021. "The Role of the Pathogen Dose and PI3Kγ in Immunometabolic Reprogramming of Microglia for Innate Immune Memory" International Journal of Molecular Sciences 22, no. 5: 2578. https://doi.org/10.3390/ijms22052578
APA StyleLajqi, T., Marx, C., Hudalla, H., Haas, F., Große, S., Wang, Z.-Q., Heller, R., Bauer, M., Wetzker, R., & Bauer, R. (2021). The Role of the Pathogen Dose and PI3Kγ in Immunometabolic Reprogramming of Microglia for Innate Immune Memory. International Journal of Molecular Sciences, 22(5), 2578. https://doi.org/10.3390/ijms22052578