Suppressed Hepatic Production of Indoxyl Sulfate Attenuates Cisplatin-Induced Acute Kidney Injury in Sulfotransferase 1a1-Deficient Mice
Abstract
:1. Introduction
2. Results
2.1. Effect of Cisplatin Treatment on IS Concentration in Serum of WT and Sult1a1-/- (KO) Mice
2.2. Effect of Cisplatin Treatment on Kidney Function and Damage in WT and Sult1a1-/- (KO) Mice
2.3. Effect of Cisplatin Treatment on Apoptosis in WT and Sult1a1-/- (KO) Mice Kidney
2.4. Effect of Cisplatin Treatment on the mRNA Expression of Oxidative Stress and Inflammation-Related Factors of WT and Sult1a1-/- (KO) Mice
2.5. Effect of Treatment with or without Cisplatin and IS on HK-2 Cells
2.6. Effect of Treatment with Cisplatin and/or IS on ROS Level in HK-2 Cells
2.7. AhR Protein Expression in HK-2 Cells Treated with or without Cisplatin and IS
2.8. AhR, XO, and NOX4 Downregulation Decreased ROS Levels Induced by IS
3. Discussion
4. Materials and Methods
4.1. Reagents
4.2. Sult1a1-Deficient Mice
4.3. Animal Experiments
4.4. Liquid Chromatography/Mass Spectrometry/MS (LC/MS/MS) Analysis
4.5. HE Staining
4.6. TUNEL Assay
4.7. Quantitative PCR Assay
4.8. Cell Cultures
4.9. Analysis of Cell Survival Rate
4.10. ROS Analysis
4.11. Transfection with Small Interfering RNA (siRNA)
4.12. Western Blotting
4.13. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
IS | indoxyl sulfate |
AhR | aryl hydrocarbon receptor |
ROS | reactive oxygen species |
SULT1A1 | sulfotransferase 1A1 |
XO | xanthine oxidase |
NOX4 | NADPH oxidase 4 |
BUN | blood urea nitrogen |
TUNEL | dUTP Nick End Labeling |
CKD | chronic kidney disease |
GAPDH | glyceraldehyde 3-phosphate dehydrogenase |
FBS | fetal bovine serum |
References
- Yao, X.; Panichpisal, K.; Kurtzman, N.; Nugent, K. Cisplatin nephrotoxicity: A review. Am. J. Med. Sci. 2007, 334, 115–124. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Karasawa, T.; Steyger, P.S. An integrated view of cisplatin-induced nephrotoxicity and ototoxicity. Toxicol. Lett. 2015, 237, 219–227. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Holditch, S.J.; Brown, C.N.; Lombardi, A.M.; Nguyen, K.N.; Edelstein, C.L. Recent Advances in Models, Mechanisms, Biomarkers, and Interventions in Cisplatin-Induced Acute Kidney Injury. Int. J. Mol. Sci. 2019, 20, 3011. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Volarevic, V.; Djokovic, B.; Jankovic, M.G.; Harrell, C.R.; Fellabaum, C.; Djonov, V.; Arsenijevic, N. Molecular mechanisms of cisplatin-induced nephrotoxicity: A balance on the knife edge between renoprotection and tumor toxicity. J. Biomed. Sci. 2019, 26, 1–14. [Google Scholar] [CrossRef] [Green Version]
- Manohar, S.; Leung, N. Cisplatin nephrotoxicity: A review of the literature. J. Nephrol. 2018, 31, 15–25. [Google Scholar] [CrossRef]
- Ozkok, A.; Edelstein, C.L. Pathophysiology of cisplatin-induced acute kidney injury. BioMed Res. Int. 2014, 2014, 967826. [Google Scholar] [CrossRef]
- Miller, R.P.; Tadagavadi, R.K.; Ramesh, G.; Reeves, W.B. Mechanisms of Cisplatin Nephrotoxicity. Toxins 2010, 2, 2490–2581. [Google Scholar] [CrossRef] [Green Version]
- Yonezawa, A.; Masuda, S.; Nishihara, K.; Yano, I.; Katsura, T.; Inui, K.-I. Association between tubular toxicity of cisplatin and expression of organic cation transporter rOCT2 (Slc22a2) in the rat. Biochem. Pharmacol. 2005, 70, 1823–1831. [Google Scholar] [CrossRef]
- Sprowl, J.A.; Lancaster, C.S.; Pabla, N.; Hermann, E.; Kosloske, A.M.; Gibson, A.A.; Li, L.; Zeeh, D.; Schlatter, E.; Janke, L.J.; et al. Cisplatin-Induced Renal Injury Is Independently Mediated by OCT2 and p53. Clin. Cancer Res. 2014, 20, 4026–4035. [Google Scholar] [CrossRef] [Green Version]
- Saito, H. Pathophysiological regulation of renal SLC22A organic ion transporters in acute kidney injury: Pharmacological and toxicological implications. Pharmacol. Ther. 2010, 125, 79–91. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yokoo, S.; Yonezawa, A.; Masuda, S.; Fukatsu, A.; Katsura, T.; Inui, K.-I. Differential contribution of organic cation transporters, OCT2 and MATE1, in platinum agent-induced nephrotoxicity. Biochem. Pharmacol. 2007, 74, 477–487. [Google Scholar] [CrossRef] [PubMed]
- Malik, S.; Bhatia, J.; Suchal, K.; Gamad, N.; Dinda, A.K.; Gupta, Y.K.; Arya, D.S. Nobiletin ameliorates cisplatin-induced acute kidney injury due to its anti-oxidant, anti-inflammatory and anti-apoptotic effects. Exp. Toxicol. Pathol. 2015, 67, 427–433. [Google Scholar] [CrossRef] [PubMed]
- Iwata, K.; Watanabe, H.; Morisaki, T.; Matsuzaki, T.; Ohmura, T.; Hamada, A.; Saito, H. Involvement of Indoxyl Sulfate in Renal and Central Nervous System Toxicities During Cisplatin-induced Acute Renal Failure. Pharm. Res. 2007, 24, 662–671. [Google Scholar] [CrossRef]
- Kusumoto, M.; Kamobayashi, H.; Misato, Y.; Komori, M.; Yoshimura, M.; Hamada, A.; Kohda, Y.; Tomita, K.; Saito, H. Alleviation of cisplatin-induced acute kidney injury using phytochemical polyphenols is accompanied by reduced accumulation of indoxyl sulfate in rats. Clin. Exp. Nephrol. 2011, 15, 820–830. [Google Scholar] [CrossRef]
- Morisaki, T.; Matsuzaki, T.; Yokoo, K.; Kusumoto, M.; Iwata, K.; Hamada, A.; Saito, H. Regulation of Renal Organic Ion Transporters in Cisplatin-Induced Acute Kidney Injury and Uremia in Rats. Pharm. Res. 2008, 25, 2526–2533. [Google Scholar] [CrossRef] [PubMed]
- Wu, W.; Bush, K.T.; Nigam, S.K. Key Role for the Organic Anion Transporters, OAT1 and OAT3, in the in vivo Handling of Uremic Toxins and Solutes. Sci. Rep. 2017, 7, 1–9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Watanabe, I.; Tatebe, J.; Namba, S.; Koizumi, M.; Yamazaki, J.; Morita, T. Activation of aryl hydrocarbon receptor mediates indoxyl sulfate-induced monocyte chemoattractant protein-1 expression in human umbilical vein endothelial cells. Circ. J. 2013, 77, 224–230. [Google Scholar] [CrossRef] [Green Version]
- Itoh, Y.; Ezawa, A.; Kikuchi, K.; Tsuruta, Y.; Niwa, T. Protein-bound uremic toxins in hemodialysis patients measured by liquid chromatography/tandem mass spectrometry and their effects on endothelial ROS production. Anal. Bioanal. Chem. 2012, 403, 1841–1850. [Google Scholar] [CrossRef]
- Basu, A.; Krishnamurthy, S. Cellular Responses to Cisplatin-Induced DNA Damage. J. Nucleic Acids 2010, 2010, 201367. [Google Scholar] [CrossRef] [Green Version]
- Poljsak, B.; Šuput, D.; Milisav, I. Achieving the Balance between ROS and Antioxidants: When to Use the Synthetic Antioxidants. Oxidative Med. Cell. Longev. 2013, 2013, 956792. [Google Scholar] [CrossRef] [PubMed]
- Cetin, R.; Devrim, E.; Kılıçoğlu, B.; Avcı, A.; Çandır, Ö.; Durak, I.; Kilicoglu, B.; Candir, O. Cisplatin impairs antioxidant system and causes oxidation in rat kidney tissues: Possible protective roles of natural antioxidant foods. J. Appl. Toxicol. 2005, 26, 42–46. [Google Scholar] [CrossRef]
- De Lima, K.A.; Donate, P.B.; Talbot, J.; Davoli-Ferreira, M.; Peres, R.S.; Cunha, T.M.; Alves-Filho, J.C.; Cunha, T.M. TGFβ1 signaling sustains aryl hydrocarbon receptor (AHR) expression and restrains the pathogenic potential of TH17 cells by an AHR-independent mechanism. Cell Death Dis. 2018, 9, 1130. [Google Scholar] [CrossRef] [Green Version]
- Amirshahrokhi, K.; Khalili, A.-R. Thalidomide Ameliorates Cisplatin-Induced Nephrotoxicity by Inhibiting Renal Inflammation in an Experimental Model. Inflammation 2015, 38, 476–484. [Google Scholar] [CrossRef]
- Pollenz, R.S. The mechanism of AH receptor protein down-regulation (degradation) and its impact on AH receptor-mediated gene regulation. Chem. Interact. 2002, 141, 41–61. [Google Scholar] [CrossRef]
- Kamiński, T.; Michałowska, M.; Pawlak, D. Aryl hydrocarbon receptor (AhR) and its endogenous agonist-indoxyl sulfate in chronic kidney disease. Postępy Hig. Med. Dosw. 2017, 71, 624–632. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.Y.; Yoo, T.-H.; Cho, J.-Y.; Kim, H.C.; Lee, W.-W. Indoxyl sulfate–induced TNF-α is regulated by crosstalk between the aryl hydrocarbon receptor, NF-κB, and SOCS2 in human macrophages. FASEB J. 2019, 33, 10844–10858. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dou, L.; Poitevin, S.; Sallée, M.; Addi, T.; Gondouin, B.; McKay, N.; Denison, M.S.; Jourde-Chiche, N.; Duval-Sabatier, A.; Cerini, C.; et al. Aryl hydrocarbon receptor is activated in patients and mice with chronic kidney disease. Kidney Int. 2018, 93, 986–999. [Google Scholar] [CrossRef]
- Brito, J.S.; Borges, N.A.; Esgalhado, M.; Magliano, D.C.; Soulage, C.O.; Mafra, D. Aryl Hydrocarbon Receptor Activation in Chronic Kidney Disease: Role of Uremic Toxins. Nephron 2017, 137, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Swanson, H.I.; Bradfield, C.A. The AH-receptor: Genetics, structure and function. Pharmacogenetics 1993, 3, 213–230. [Google Scholar] [CrossRef] [PubMed]
- Vondráček, J.; Machala, M. Environmental Ligands of the Aryl Hydrocarbon Receptor and Their Effects in Models of Adult Liver Progenitor Cells. Stem Cells Int. 2016, 2016, 4326194. [Google Scholar] [CrossRef] [Green Version]
- Hankinson, O. The Aryl Hydrocarbon Receptor Complex. Annu. Rev. Pharmacol. Toxicol. 1995, 35, 307–340. [Google Scholar] [CrossRef]
- Gondouin, B.; Cerini, C.; Dou, L.; Sallée, M.; Duval-Sabatier, A.; Pletinck, A.; Calaf, R.; Lacroix, R.; Jourde-Chiche, N.; Poitevin, S.; et al. Indolic uremic solutes increase tissue factor production in endothelial cells by the aryl hydrocarbon receptor pathway. Kidney Int. 2013, 84, 733–744. [Google Scholar] [CrossRef] [Green Version]
- Soshilov, A.A.; Denison, M.S. Ligand Promiscuity of Aryl Hydrocarbon Receptor Agonists and Antagonists Revealed by Site-Directed Mutagenesis. Mol. Cell. Biol. 2014, 34, 1707–1719. [Google Scholar] [CrossRef] [Green Version]
- Nakagawa, K.; Itoya, M.; Takemoto, N.; Matsuura, Y.; Tawa, M.; Matsumura, Y.; Ohkita, M. Indoxyl sulfate induces ROS production via the aryl hydrocarbon receptor-NADPH oxidase pathway and inactivates NO in vascular tissues. Life Sci. 2021, 265, 118807. [Google Scholar] [CrossRef] [PubMed]
- Sugihara, K.; Kitamura, S.; Yamada, T.; Ohta, S.; Yamashita, K.; Yasuda, M.; Fujii-Kuriyama, Y. Aryl Hydrocarbon Receptor (AhR)-Mediated Induction of Xanthine Oxidase/Xanthine Dehydrogenase Activity by 2,3,7,8-Tetrachlorodibenzo-p-dioxin. Biochem. Biophys. Res. Commun. 2001, 281, 1093–1099. [Google Scholar] [CrossRef] [PubMed]
- Tumur, Z.; Niwa, T. Indoxyl Sulfate Inhibits Nitric Oxide Production and Cell Viability by Inducing Oxidative Stress in Vascular Endothelial Cells. Am. J. Nephrol. 2009, 29, 551–557. [Google Scholar] [CrossRef] [PubMed]
- Lee, W.-C.; Li, L.-C.; Chen, J.-B.; Chang, H.-W. Indoxyl Sulfate-Induced Oxidative Stress, Mitochondrial Dysfunction, and Impaired Biogenesis Are Partly Protected by Vitamin C and N-Acetylcysteine. Sci. World J. 2015, 2015, 1–6. [Google Scholar] [CrossRef] [Green Version]
- Yang, Y.; Liu, H.; Liu, F.; Dong, Z. Mitochondrial dysregulation and protection in cisplatin nephrotoxicity. Arch. Toxicol. 2014, 88, 1249–1256. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Saito, H.; Saigo, C.; Nomura, Y.; Yamamoto, Y.; Sagata, M.; Matsunaga, R.; Jono, H.; Nishi, K. Meclofenamate elicits a nephropreventing effect in a rat model of ischemic acute kidney injury by suppressing indoxyl sulfate production and restoring renal organic anion transporters. Drug Des. Dev. Ther. 2014, 8, 1073. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, W.-C.; Tomino, Y.; Lu, K.-C. Impacts of Indoxyl Sulfate and p-Cresol Sulfate on Chronic Kidney Disease and Mitigating Effects of AST-120. Toxins 2018, 10, 367. [Google Scholar] [CrossRef] [Green Version]
- Saito, H.; Yoshimura, M.; Saigo, C.; Komori, M.; Nomura, Y.; Yamamoto, Y.; Sagata, M.; Wakida, A.; Chuman, E.; Nishi, K.; et al. Hepatic sulfotransferase as a nephropreventing target by suppression of the uremic toxin indoxyl sulfate accumulation in ischemic acute kidney injury. Toxicol Sci 2014, 141, 206–217. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fujii, H.; Nakai, K.; Fukagawa, M. Role of Oxidative Stress and Indoxyl Sulfate in Progression of Cardiovascular Disease in Chronic Kidney Disease. Ther. Apher. Dial. 2011, 15, 125–128. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward (5′–3′) | Reverse (5′–3′) |
---|---|---|
IL-6 | TACCACTTCACAAGTCGGAGGC | CTGCAAGTGCATCATCGTTGTTC |
GPx1 | CGCTCTTTACCTTCCTGCGGAA | AGTTCCAGGCAATGTCGTTGCG |
Cat | CGGCACATGAATGGCTATGGATC | AAGCCTTCCTGCCTCTCCAACA |
HO-1 | AACAAGCAGAACCCAGTCTATGC | AGGTAGCGGGTATATGCGTGGGCC |
NQO-1 | AGGGTTCGGTATTACGATCC | AGTACAATCAGGGCTCTTCTCG |
NOX4 | CGGGATTTGCTACTGCCTCCAT | GTGACTCCTCAAATGGGCTTCC |
SOD1 | GGTGAACCAGTTGTGTTGTCAGG | ATGAGGTCCTGCACTGGTACAG |
SOD2 | TAACGCGCAGATCATGCAGCTG | AGGCTGAAGAGCGACCTGAGTT |
XO | GCTCTTCGTGAGCACACAGAAC | CCACCCATTCTTTTCACTCGGAC |
AhR | AGGCTAAGAGAGCCTTGTCT | TCCAACACTTTCTGGACAGG |
GAPDH | CGACTTCAACAGCAACTCCCACTCTTCC | TGGGTGGTCCAGGGTTTCTTACTCCTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yabuuchi, N.; Hou, H.; Gunda, N.; Narita, Y.; Jono, H.; Saito, H. Suppressed Hepatic Production of Indoxyl Sulfate Attenuates Cisplatin-Induced Acute Kidney Injury in Sulfotransferase 1a1-Deficient Mice. Int. J. Mol. Sci. 2021, 22, 1764. https://doi.org/10.3390/ijms22041764
Yabuuchi N, Hou H, Gunda N, Narita Y, Jono H, Saito H. Suppressed Hepatic Production of Indoxyl Sulfate Attenuates Cisplatin-Induced Acute Kidney Injury in Sulfotransferase 1a1-Deficient Mice. International Journal of Molecular Sciences. 2021; 22(4):1764. https://doi.org/10.3390/ijms22041764
Chicago/Turabian StyleYabuuchi, Nozomi, Huixian Hou, Nao Gunda, Yuki Narita, Hirofumi Jono, and Hideyuki Saito. 2021. "Suppressed Hepatic Production of Indoxyl Sulfate Attenuates Cisplatin-Induced Acute Kidney Injury in Sulfotransferase 1a1-Deficient Mice" International Journal of Molecular Sciences 22, no. 4: 1764. https://doi.org/10.3390/ijms22041764